|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 274, Issue 9, 5830-5834, February 26, 1999
From the Accumulation of mesangial matrix is a pivotal
event in the pathophysiology of diabetic nephropathy. The molecular
triggers for matrix production are still being defined. Here,
suppression subtractive hybridization identified 15 genes
differentially induced when primary human mesangial cells are exposed
to high glucose (30 mM versus 5 mM) in vitro. These genes included
(a) known regulators of mesangial cell activation in
diabetic nephropathy (fibronectin, caldesmon, thrombospondin, and
plasminogen activator inhibitor-1), (b) novel genes, and
(c) known genes whose induction by high glucose has not
been reported. Prominent among the latter were genes encoding cytoskeleton-associated proteins and connective tissue growth factor
(CTGF), a modulator of fibroblast matrix production. In parallel
experiments, elevated CTGF mRNA levels were demonstrated in
glomeruli of rats with streptozotocin-induced diabetic nephropathy. Mannitol provoked less mesangial cell CTGF expression in
vitro than high glucose, excluding hyperosmolality as the key
stimulus. The addition of recombinant CTGF to cultured mesangial cells
enhanced expression of extracellular matrix proteins. High glucose
stimulated expression of transforming growth factor Diabetic nephropathy accounts for over 30% of end stage renal
failure. The pathological hallmark of diabetic nephropathy is glomerulosclerosis due to accumulation of extracellular matrix in the
glomerular mesangium (1). Mesangial matrix accumulation reflects both
increased synthesis and decreased degradation of extracellular matrix
(ECM),1 is associated with
the development of proteinuria, and is followed by subsequent
development of hypertension and progressive kidney failure (2).
Hyperglycemia is a major stimulus for mesangial cell matrix production
in diabetic nephropathy. The mechanisms by which hyperglycemia perturb
mesangial cell function are still being appreciated and include direct
effects of high extracellular glucose levels and indirect effects
transduced through alterations in glomerular hemodynamics and through
the actions of advanced glycosylation end products.
Propagation of mesangial cells under conditions of high ambient glucose
has proved a useful in vitro model with which to probe the
molecular basis for mesangial matrix accumulation in diabetes, attributable to hyperglycemia. Specifically, exposure of cultured mesangial cells to high glucose stimulates de novo synthesis
of ECM components, such as type IV collagen, fibronectin, and laminin, and other products that are accumulated in vivo (3-5).
Here, we used suppression subtractive hybridization (SSH) (6) to identify mesangial cell genes that are differentially induced by high
glucose and have focused on genes encoding potential modulators of ECM
production in diabetic nephropathy. SSH is a method based on
suppressive PCR that allows creation of subtracted cDNA libraries for the identification of genes differentially expressed in response to
an experimental stimulus (7). SSH differs from earlier subtractive methods by including a normalization step that equalizes for relative abundance of cDNAs within a target population. This modification should enhance the probability of identifying increased expression of
low abundance transcripts and represents a potential advantage over
other methods for identifying differentially regulated genes such as
differential display-PCR (8) and cDNA representation difference
analysis (9).
Cell Culture and Streptozotocin-induced Diabetic
Rats--
Primary human mesangial cells (Clonetics) were cultured as
reported previously (10, 11). Cells (passage 7-11) were maintained in
medium containing either 5 or 30 mM D-glucose
for 7 days. Culture medium was replenished three times during this
period to maintain glucose levels in the desired range. To control for
the effects of hyperosmolality, mesangial cells were cultured in medium
containing 5 mM glucose supplemented with 25 mM mannitol.
Male Munich-Wistar rats (260-290 g, Simonsen Laboratories) were
rendered diabetic by treatment with streptozotocin (STZ; Sigma), 50 g/kg intravenously as described previously (12). At months 2 and 4 after induction of diabetes mellitus, rats were anaesthetized by
intraperitoneal injection of pentobarbital (50 mg/kg), and the right
kidney was excised and weighed immediately. Glomeruli were isolated
from renal cortex by standard sieving techniques (10, 11). Glomerular
isolation was completed within 20 min of removing the kidneys. RNA
extraction proceeded immediately thereafter.
RNA Isolation--
Polyadenlyated RNA was isolated from
mesangial cells using the Microfast Track kit (Invitrogen). Total RNA
was isolated from glomeruli using RNAzol solution (TEL-test Inc.).
SSH--
SSH was performed with the PCR-SELECT cDNA
subtraction kit (CLONTECH) as directed by the
manufacturer with the modification that a 4-fold greater than
recommended amount of driver cDNA was added to the second
hybridization. Starting material consisted of 2 µg of mesangial cell
mRNA cultured in 30 mM D-glucose for 7 days
as "tester" and 2 µg of mesangial cell mRNA cultured in 5 mM D-glucose for 7 days as "driver." Thirty
primary PCR cycles and 12 secondary PCR cycles were performed.
Cloning and Sequencing of cDNAs--
PCR products generated
by SSH were subcloned into the PCR 2.1 vector using the original TA
cloning kit (Invitrogen). Subcloned cDNAs were isolated by colony
PCR amplification. Sequencing was performed using an automated ABI 370A
DNA sequencing system. Sequence reactions were carried out with the ABI
prism dye terminator cycle sequencing ready reaction kit
(Perkin-Elmer). The sequences obtained were compared against
GenBankTM/EBI and expressed sequence tag data bases using
BLAST searches.
Northern Blot Analysis and RT-PCR--
Northern blots were
performed using formaldehyde denaturation according to standard
protocols and quantitated using a phosphorimager (Bio-Rad). For RT-PCR,
chromosomal DNA was removed from total RNA using DNase I (Life
Technologies, Inc.). To generate a rat-specific CTGF probe, 2 µg of
total RNA was transcribed as cDNA using standard procedures. Equal
amounts of cDNA were subsequently amplified by PCR using specific
primers for GAPDH (GenBankTM/EBI accession number
M17851, sense: ACCACAGTCCATGCCATCAC; antisense: TCCACCACCCTGTTGCTGTA),
collagen I (GenBankTM/EBI accession number X55525, sense:
GGTCTTCCTGGCTTAAAGGG; antisense: GCTGGTCAGCCCTGTAGAAG), collagen IV
(GenBankTM/EBI accession number M11315, sense:
CCAGGAGTTCCAGGATTTCA; antisense: TTTTGGTCCCAGAAGGACAC), fibronectin
(GenBankTM/EBI accession number X02761, sense:
CGAAATCACAGCCAGTAG, antisense: ATCACATCCACACGGTAG), and the mouse
cDNA sequence for the CTGF homologue, Fisp-12
(GenBankTM/EBI accession number M70642, sense:
CTAAGACCTGTGGAATGGGC; antisense: CTCAAAGATGTCATTGTCCCC).
Induction of CTGF in Mesangial Cells by TGF-
The role of protein kinase C (PKC) on CTGF expression in response to
high glucose was investigated by culturing the mesangial cells in
either 5 mM, 30 mM glucose, or 30 mM glucose and the PKC inhibitor GF 109203X (13).
Induction of Collagen and Fibronectin Expression by Recombinant
CTGF--
The effect of baculovirus expressed recombinant human CTGF
(rhCTGF) (14) (8 ng/ml for 24 h; generously supplied by Dr. Gary Grotendorst) on the expression of collagens and fibronectin was determined in serum-starved mesangial cells as described above.
SSH Identifies 15 Mesangial Cell Genes Differentially Induced by
High Glucose--
SSH suggested differential induction of 16 mRNAs
in primary cultures of human mesangial cells propagated for 7 days in
30 mM glucose. Differential expression of 15 of the 16 subcloned fragments was confirmed by Northern blot (Table
I). Sequence analysis revealed induction
of four genes implicated previously in the pathogenesis of diabetic
nephropathy: fibronectin, caldesmon, plasminogen activator inhibitor-1
(PAI-1), and thrombospondin (15-18). Of 11 other cDNA fragments,
two encoded novel genes, designated IHG-1 and
IHG-2 (increased in high
glucose), and nine encoded known genes whose induction by
high glucose had not been reported previously. Prominent among the
latter genes were CTGF and several cytoskeleton-associated proteins,
namely profilin, caldesmon, adenylyl cyclase-associated protein (CAP),
actin-related protein-3 (ARP3), T-plastin, and myosin regulatory light
chain (MRLC). Subsequent studies focused on induction of CTGF, a
regulator of matrix production in several model systems (14, 19-20) as
discussed below. The prominence of genes encoding multiple
actin-binding proteins is also noteworthy, given recent reports
implicating F-actin disassembly in the pathogenesis of mesangial cell
dysfunction and glomerular hypertension in diabetic nephropathy (21,
22). The induction of profilin expression is particularly interesting
given its role as a regulator of actin polymerization under conditions
of cell stress (23).
Within a diabetic milieu, high glucose levels may perturb cellular
function through glucose-specific actions or by increasing the
osmolality of extracellular fluids. The role of hyperosmolality as a
mediator of gene induction by high glucose was assessed by comparing
mRNA levels, as determined by Northern blot, in cells cultured in
either 30 mM glucose or in 5 mM glucose
supplemented with 25 mM mannitol. High glucose was more
effective than high osmolality at inducing expression of CTGF, MRLC,
ARP3, T-plastin, and translationally controlled tumor protein (TCTP).
High glucose and mannitol-induced hyperosmolality afforded equivalent
induction of the other products.
Induction of CTGF Expression in Mesangial Cells Cultured in High
Glucose--
CTGF is a 38-kDa cysteine-rich secreted peptide known to
modulate ECM production in some extrarenal cell types (14, 19, 20).
Here, SSH identified a cDNA fragment of 250 base pairs, which was
identical to bases 814-1061 of the human CTGF cDNA. In separate
experiments, induction of CTGF mRNA expression in primary human
mesangial cells cultured in high glucose was confirmed by Northern
blotting (Fig. 1). CTGF mRNA
expression was between 2.5- and 3.3-fold higher in mesangial cells
cultured in 30 mM glucose as compared with 5 mM
glucose. CTGF is a member of a small family of highly homologous
proteins termed the CCN family (for CTGF/fisp-12,
cef10/cyr61 and Nov) (24). These
peptides are characterized by conservation of 38 cysteine residues that constitute more than 10% of the amino acid content. All members have
signal peptides and appear to be secreted via orthodox secretory pathways (20). In the context of diabetic nephropathy, it is intriguing
that CTGF stimulates the proliferation of NRK fibroblasts in
vitro and the expression of type 1 collagen, fibronectin, and CTGF Induces Mesangial Cell Matrix Production--
To investigate
the direct effects of CTGF on matrix production mesangial cells were
incubated with recombinant protein. rhCTGF up-regulates mesangial cell
collagens I and IV and fibronectin (Fig. 1B). These proteins
typify matrix accumulation seen in diabetic nephropathy (1, 2, 25).
These data demonstrate the potential of CTGF as a stimulus for
increased ECM synthesis (19) and mesangial expansion in diabetic nephropathy.
Enhanced CTGF Expression in Renal Cortex and Isolated Glomeruli of
Rats with STZ-induced Diabetic Nephropathy--
To assess CTGF
expression in diabetic nephropathy in vivo, CTGF mRNA
levels were measured in RNA isolated from the cortex of rats with
STZ-induced diabetes mellitus (Fig. 2).
To this end, PCR primers for rat CTGF were designed from the sequence
of the mouse CTGF homologue, fisp12 (26). The product was confirmed as
rat CTGF by sequence analysis; the 340-base pair product being 94%
identical at the nucleotide level (bases 783-1123) and 99% identical
at the amino acid level to mouse fisp12 (Fig. 2, A and B). Induction of CTGF mRNA was observed in the renal
cortex of rats with STZ-induced diabetic nephropathy at four months
after administration of STZ, coincident with mesangial expansion and proteinuria (Fig. 2C and data not shown). CTGF expression
was further localized to glomeruli by Northern analysis of RNA
extracted from glomeruli isolated by differential sieving from renal
cortex of rats with STZ-induced diabetic nephropathy. Glomerular levels of CTGF mRNA were increased by 2.5- and 1.6-fold after 2 and 4 months of diabetes, respectively, by comparison with age- and sex-matched controls. The significance of these observations are further supported by a recent report demonstrating CTGF expression in a
screen of human renal diseases, including diabetic nephropathy (27).
Induction of Mesangial Cell CTGF Expression by High Glucose
Involves TGF-
Whereas the PKC inhibitor GF 109203X did not influence TGF-
In summary, SSH proved a useful technique for the identification of
mesangial cell genes induced by high glucose. The relative speed,
efficiency, and convenience of SSH suggests that it offers an
attractive method for comparative gene expression that complements more
comprehensive but technically demanding techniques such as serial
analysis of gene expression (38). SSH identified 15 mesangial cell
genes whose expression is induced by high glucose. Four of these genes
encoded for proteins already implicated in the pathophysiology of
diabetic nephropathy, nine encoded known proteins whose induction had
not been reported previously by high glucose, and two were novel genes.
Among the nine known genes was CTGF. This pro-fibrotic factor was
expressed in renal cortex and glomeruli of kidneys with diabetic
nephropathy and appeared to be induced in vitro through
TGF- We thank Drs. Gary Grotendorst and Shawn
Williams, Department of Cell Biology and Anatomy, University of
Miami, School of Medicine for the generous gift of
recombinant human CTGF. This study was funded by The Health Research
Board, Ireland, Diabetic Nephropathy Research Unit.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF079531 (Rattus norvegicus connective tissue growth factor mRNA, partial cds), AF110136 (Homo sapiens increased in high glucose (IHG-1), mRNA), AF110137 (Homo sapiens increased in high
glucose (IHG-2), mRNA).
The abbreviations used are:
ECM, extracellular
matrix;
ARP3, actin-related protein-3;
CAP, adenylyl cyclase-associated
protein;
CTGF, connective tissue growth factor;
FBS, fetal bovine
serum;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
MRLC, myosin
regulatory light chain;
PKC, protein kinase C;
PAI, plasminogen
activator inhibitor;
SSH, suppression subtractive hybridization;
STZ, streptozotocin;
TGF-
Suppression Subtractive Hybridization Identifies High Glucose
Levels as a Stimulus for Expression of Connective Tissue Growth Factor
and Other Genes in Human Mesangial Cells*
,,,
Center For Molecular Inflammation and
Vascular Research, Department of Medicine and Therapeutics, University
College Dublin, Mater Misericordiae Hospital, Dublin 7, Ireland, the
§ Renal Division, Brigham and Women's Hospital, Harvard
Medical School, Boston, Massachusetts 02115, and the ¶ Department
of Pharmacology, University College Dublin,
Belfield, Dublin 4, Ireland
ABSTRACT
Top
Abstract
Introduction
References
1 (TGF-1),
and addition of TGF-1 to mesangial cells triggered CTGF expression.
CTGF expression induced by high glucose was partially suppressed by
anti-TGF-1 antibody and by the protein kinase C inhibitor GF
109203X. Together, these data suggest that 1) high glucose stimulates
mesangial CTGF expression by TGF1-dependent and protein
kinase C dependent pathways, and 2) CTGF may be a mediator of
TGF1-driven matrix production within a diabetic milieu.
INTRODUCTION
Top
Abstract
Introduction
References
EXPERIMENTAL PROCEDURES
1 and Protein
Kinase C--
To assess the role of TGF-1 as a stimulus for CTGF
expression in response to high glucose, cells were incubated in either 5 mM glucose, 30 mM glucose plus 1 µg/ml
anti-TGF-1 antibody for 7 days with three changes of medium. In
additional experiments cells were serum starved for 24 h in RPMI
1640 and 0.5% FBS and subsequently treated with 10 ng/ml TGF-1
(Calbiochem) or 10 ng/ml TGF-1 preadsorbed with 1 µg/ml
neutralizing anti-TGF-1 polyclonal antibody (R & D Systems) and
CTGF expression assessed.
RESULTS AND DISCUSSION
Summary of cDNAs identified by SSH as being induced in mesangial
cells cultured in high glucose
5 integrin by these cells (19).
View larger version (30K):
[in a new window]
Fig. 1.
Influence of high ambient glucose on CTGF
mRNA levels in human mesangial cells. A, induction
of CTGF expression by high glucose. Mesangial cells were exposed to 5 mM glucose (lane 1), 5 mM glucose
and 25 mM mannitol (lane 2), or 30 mM glucose (lane 3) for 7 days. Right
panel, autoradiograph of CTGF mRNA levels analyzed by Northern
blot. A 2.4-kb band was detected following hybridization with the CTGF
probe. Left panel, the relative amount of CTGF mRNA as
estimated by phosphorimager quantification. Values were normalized to
GAPDH levels. The results are representative of three independent
experiments. B, rhCTGF induces expression of mesangial cell
matrix proteins. Fibronectin, collagen type IV, collagen type I, and
GAPDH mRNA levels were analyzed in total RNA purified from
mesangial cells exposed to rhCTGF (8 ng/ml) for 24 h (lane
1). Cells cultured in RPMI 1640 and 0.5% FBS served as a control
(lane 2). Shown are ethidium-stained panels of a 2% (w/v)
agarose gel containing 10 µl of each PCR reaction after
electrophoresis.
View larger version (44K):
[in a new window]
Fig. 2.
CTGF mRNA levels in kidneys of
STZ-diabetic rats. RT-PCR was performed on total RNA extracted
from renal cortex of STZ-diabetic rats and age-matched controls. The
sequence of the rat CTGF transcript (GenBankTM/EBI
accession number AF079531) was 94% identical at the nucleotide level
(A) and 99% identical at the amino acid level
(B) to the mouse CTGF homologue fisp12 (bases 783-1123,
accession number M70642). Nucleotides that differ between the two
species are given in uppercase, and the single different
amino acid is in bold. C, shown are
ethidium-stained panels of a 2% (w/v) agarose gel containing 10 µl
of each PCR reaction after electrophoresis. CTGF and GAPDH mRNA
levels were analyzed in total RNA purified from two diabetic animals
with established nephropathy after 4 months of diabetes (lanes
1 and 2) and two age-matched control animals
(lanes 3 and 4).
1-dependent and PKC-dependent
Pathways--
TGF-1 is a stimulus for mesangial matrix accumulation
in diabetic nephropathy and triggers CTGF release in several other systems (19, 28, 29). In our experimental model, high glucose concentrations provoked induction of TGF-1 mRNA expression in cultured human mesangial cells over the same temporal framework as CTGF
expression (data not shown). To explore the potential role of TGF-1
as a regulator of CTGF expression induced by high glucose, mesangial
cells were first incubated with 10 ng/ml TGF-1 for 24 h in the
presence of 5 mM glucose. Northern analysis revealed that
TGF-1 was a potent inducer of increased CTGF mRNA levels under
these conditions (Fig. 3A).
This effect was inhibited by the addition of a neutralizing
anti-TGF-1 antibody (Fig. 3A). Interestingly, the PKC
inhibitor GF 109203X was without effect on TGF-1-induced CTGF
expression in our system (data not shown). This is consistent with a
recent report indicating that TGF-1-induced CTGF expression is
PKC-independent in fibroblasts (30). Intriguingly, our data indicate
that the TGF-1 antibody only partially attenuated the
glucose-induced increase in CTGF transcript level in mesangial cells
grown in 30 mM glucose for 7 days (Fig. 3B),
suggesting that high glucose triggers mesangial cell CTGF expression
through TGF-1-dependent and -independent pathways.
Several studies have reported increased expression of TGF-1 in renal
glomeruli in human and experimental models of diabetes (31, 32). Short term administration of TGF-1 neutralizing antibodies attenuates overexpression of mRNAs encoding matrix components and
glomerulosclerosis in the STZ mouse model of diabetes (33). CTGF shares
some of the biological actions of TGF-1 such as stimulation of cell
proliferation and extracellular matrix protein synthesis in
fibroblasts. When considered in this context, our results suggest that
TGF-1 may promote mesangial matrix production, in part, by inducing
CTGF synthesis. TGF-1 has a complex profile of biological activities that includes pro-inflammatory, pro-fibrotic, and anti-inflammatory effects. By targeting CTGF it may be possible to attenuate the sclerosis-inducing effects of TGF, while preserving its more desirable anti-inflammatory activities.
View larger version (34K):
[in a new window]
Fig. 3.
Induction of CTGF mRNA by high glucose:
TGF 1- and PKC-dependent pathways.
A, mesangial cells were exposed to TGF-1 (10 ng/ml) for
24 h in the presence (lane 3) and absence (lane
2) of anti-TGF-1 neutralizing antibody (1 µg/ml). Cells
cultured in RPMI 1640 and 0.5% FBS for 24 h served as control
(lane 1). Right panel, autoradiograph of CTGF
mRNA levels analyzed by Northern blot. A 2.4-kb band was detected
following hybridization to the CTGF probe. The blot was reprobed with
GAPDH. Left panel, the relative amount of CTGF mRNA as
estimated by phosphorimager quantification. Values were normalized to
GAPDH levels. The results are representative of two independent
experiments. B, mesangial cells were exposed to 5 mM glucose (lane 1), 30 mM glucose
(lane 2), and 30 mM glucose in the presence of
anti-TGF-1 neutralizing antibodies (1 µg/ml) (lane 3)
for 7 days. Right panel, autoradiograph of CTGF mRNA
levels analyzed by Northern blot. A 2.4-kb band was detected following
hybridization to the CTGF probe. The blot was probed with GAPDH.
Left panel, the relative amount of CTGF mRNA as
estimated by phosphorimager quantification. Values were normalized to
GAPDH levels. C, mesangial cells were exposed to 5 mM glucose (lane 1), 30 mM glucose
(lane 2), and 30 mM glucose in the presence of
the PKC inhibitor GF102903X (10 µM) (lane 3)
for 4 days. Right panel, autoradiograph of CTGF mRNA
levels analyzed by Northern blot. A 2.4-kb band was detected following
hybridization to the CTGF probe. The blot was probed with GAPDH.
Left panel, the relative amount of CTGF mRNA as
estimated by phosphorimager quantification. Values were normalized
to GAPDH levels.
1
mediated up-regulation of CTGF (see above), this compound afforded partial inhibition of high glucose-induced CTGF expression (Fig. 3C). These data are particularly interesting given the
evidence that high glucose induces de novo diacylglycerol
synthesis and subsequent PKC activation in a variety of cell types,
including mesangial cells (34, 35). In fact, PKC has been identified as
a potential therapeutic target in the treatment of diabetic complications (36, 37).
1-dependent and PKC-dependent pathways.
rhCTGF increased ECM production by mesangial cells. CTGF may therefore
be an attractive target for design of novel anti-sclerotic therapies
for diabetic glomerulosclerosis.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed. Tel.:
353-1-803-2188; Fax: 353-1-830-8404; E-mail: hrbrady{at}mater.ie.
ABBREVIATIONS
1, transforming growth factor-1;
TCTP, translationally controlled tumor protein;
RT-PCR, reverse
transcription-polymerase chain reaction;
kb, kilobase(s).
REFERENCES
Top
Abstract
Introduction
References
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. A. Roxburgh, J. J. Kattla, S. P. Curran, Y. M. O'Meara, C. A. Pollock, R. Goldschmeding, C. Godson, F. Martin, and D. P. Brazil Allelic Depletion of grem1 Attenuates Diabetic Kidney Disease Diabetes, July 1, 2009; 58(7): 1641 - 1650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M B Ryan, A D Wong, J H Gillies, J Wong, and J E Taunton Sonographically guided intratendinous injections of hyperosmolar dextrose/lidocaine: a pilot study for the treatment of chronic plantar fasciitis Br. J. Sports Med., April 1, 2009; 43(4): 303 - 306. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Murphy, N. G. Docherty, B. Griffin, J. Howlin, E. McArdle, R. McMahon, H. Schmid, M. Kretzler, A. Droguett, S. Mezzano, et al. IHG-1 Amplifies TGF-{beta}1 Signaling and Is Increased in Renal Fibrosis J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1672 - 1680. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Q. Nguyen, L. Tarnow, A. Jorsal, N. Oliver, P. Roestenberg, Y. Ito, H.-H. Parving, P. Rossing, F. A. van Nieuwenhoven, and R. Goldschmeding Plasma Connective Tissue Growth Factor Is an Independent Predictor of End-Stage Renal Disease and Mortality in Type 1 Diabetic Nephropathy Diabetes Care, June 1, 2008; 31(6): 1177 - 1182. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Peng, D. Wu, B. Gao, A. J. Ingram, B. Zhang, K. Chorneyko, R. McKenzie, and J. C. Krepinsky RhoA/Rho-Kinase Contribute to the Pathogenesis of Diabetic Renal Disease Diabetes, June 1, 2008; 57(6): 1683 - 1692. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Jaffa, W. R. Usinger, M. B. McHenry, M. A. Jaffa, S. R. Lipstiz, D. Lackland, M. Lopes-Virella, L. M. Luttrell, P. W. F. Wilson, and the Diabetes Control and Complications Trial/Epide Connective Tissue Growth Factor and Susceptibility to Renal and Vascular Disease Risk in Type 1 Diabetes J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1893 - 1900. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Bhattacharyya, T. E. Marinic, I. Krukovets, G. Hoppe, and O. I. Stenina Cell Type-specific Post-transcriptional Regulation of Production of the Potent Antiangiogenic and Proatherogenic Protein Thrombospondin-1 by High Glucose J. Biol. Chem., February 29, 2008; 283(9): 5699 - 5707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. S. Kanwar, J. Wada, L. Sun, P. Xie, E. I. Wallner, S. Chen, S. Chugh, and F. R. Danesh Diabetic Nephropathy: Mechanisms of Renal Disease Progression Experimental Biology and Medicine, January 1, 2008; 233(1): 4 - 11. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Aragno, R. Mastrocola, G. Alloatti, I. Vercellinatto, P. Bardini, S. Geuna, M. G. Catalano, O. Danni, and G. Boccuzzi Oxidative Stress Triggers Cardiac Fibrosis in the Heart of Diabetic Rats Endocrinology, January 1, 2008; 149(1): 380 - 388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Sanchez-Lopez, J. Rodriguez-Vita, C. Cartier, M. Ruperez, V. Esteban, G. Carvajal, R. Rodrigues-Diez, J. J. Plaza, J. Egido, and M. Ruiz-Ortega Inhibitory effect of interleukin-1 on angiotensin II-induced connective tissue growth factor and type IV collagen production in cultured mesangial cells Am J Physiol Renal Physiol, January 1, 2008; 294(1): F149 - F160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Sha, D. Wu, L. Zhang, X. Chen, M. Lei, H. Sun, S. Lin, and J. Lang Differentially expressed genes in human endometrial endothelial cells derived from eutopic endometrium of patients with endometriosis compared with those from patients without endometriosis Hum. Reprod., December 1, 2007; 22(12): 3159 - 3169. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. J. Williams, G. Qiu, H. K. Usui, S. R. Dunn, P. McCue, E. Bottinger, R. V. Iozzo, and K. Sharma Decorin Deficiency Enhances Progressive Nephropathy in Diabetic Mice Am. J. Pathol., November 1, 2007; 171(5): 1441 - 1450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Guha, Z.-G. Xu, D. Tung, L. Lanting, and R. Natarajan Specific down-regulation of connective tissue growth factor attenuates progression of nephropathy in mouse models of type 1 and type 2 diabetes FASEB J, October 1, 2007; 21(12): 3355 - 3368. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Furlong, J. Crean, L. Thornton, R. O'Leary, M. Murphy, and F. Martin Dysregulated intracellular signaling impairs CTGF-stimulated responses in human mesangial cells exposed to high extracellular glucose Am J Physiol Renal Physiol, June 1, 2007; 292(6): F1691 - F1700. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kakoki, R. W. McGarrah, H.-S. Kim, and O. Smithies Bradykinin B1 and B2 receptors both have protective roles in renal ischemia/reperfusion injury PNAS, May 1, 2007; 104(18): 7576 - 7581. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kita, Y. Hata, M. Miura, S. Kawahara, S. Nakao, and T. Ishibashi Functional Characteristics of Connective Tissue Growth Factor on Vitreoretinal Cells Diabetes, May 1, 2007; 56(5): 1421 - 1428. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Raman, I. Krukovets, T. E. Marinic, P. Bornstein, and O. I. Stenina Glycosylation Mediates Up-regulation of a Potent Antiangiogenic and Proatherogenic Protein, Thrombospondin-1, by Glucose in Vascular Smooth Muscle Cells J. Biol. Chem., February 23, 2007; 282(8): 5704 - 5714. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kita, Y. Hata, K. Kano, M. Miura, S. Nakao, Y. Noda, H. Shimokawa, and T. Ishibashi Transforming Growth Factor-{beta}2 and Connective Tissue Growth Factor in Proliferative Vitreoretinal Diseases: Possible Involvement of Hyalocytes and Therapeutic Potential of Rho Kinase Inhibitor Diabetes, January 1, 2007; 56(1): 231 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. R. Conway, D. A. Savage, and A. Peter Maxwell Identifying genes for diabetic nephropathy--current difficulties and future directions Nephrol. Dial. Transplant., November 1, 2006; 21(11): 3012 - 3017. [Full Text] [PDF]
|
|
|
|
|
|
W. C. Burns, S. M. Twigg, J. M. Forbes, J. Pete, C. Tikellis, V. Thallas-Bonke, M. C. Thomas, M. E. Cooper, and P. Kantharidis Connective Tissue Growth Factor Plays an Important Role in Advanced Glycation End Product-Induced Tubular Epithelial-to-Mesenchymal Transition: Implications for Diabetic Renal Disease J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2484 - 2494. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Crean, F. Furlong, D. Mitchell, E. McArdle, C. Godson, and F. Martin Connective tissue growth factor/CCN2 stimulates actin disassembly through Akt/protein kinase B-mediated phosphorylation and cytoplasmic translocation of p27Kip-1 FASEB J, August 1, 2006; 20(10): 1712 - 1714. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Roestenberg, F. A. van Nieuwenhoven, J. A. Joles, C. Trischberger, P. P. Martens, N. Oliver, J. Aten, J. W. Hoppener, and R. Goldschmeding Temporal expression profile and distribution pattern indicate a role of connective tissue growth factor (CTGF/CCN-2) in diabetic nephropathy in mice Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1344 - F1354. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Q. Nguyen, L. Tarnow, S. Andersen, P. Hovind, H.-H. Parving, R. Goldschmeding, and F. A. van Nieuwenhoven Urinary Connective Tissue Growth Factor Excretion Correlates With Clinical Markers of Renal Disease in a Large Population of Type 1 Diabetic Patients With Diabetic Nephropathy Diabetes Care, January 1, 2006; 29(1): 83 - 88. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. R. A. Johnson, J. K. Burgess, Q. Ge, M. Poniris, S. Boustany, S. M. Twigg, and J. L. Black Connective Tissue Growth Factor Induces Extracellular Matrix in Asthmatic Airway Smooth Muscle Am. J. Respir. Crit. Care Med., January 1, 2006; 173(1): 32 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Kane, L Stevenson, C Godson, A W Stitt, and C O'Brien Gremlin gene expression in bovine retinal pericytes exposed to elevated glucose Br. J. Ophthalmol., December 1, 2005; 89(12): 1638 - 1642. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ihara, S. Manabe, M. Kanda, H. Kawano, T. Nakayama, I. Sekine, T. Kondo, and Y. Ito Increased expression of protein C-mannosylation in the aortic vessels of diabetic Zucker rats Glycobiology, April 1, 2005; 15(4): 383 - 392. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Tan, B. Wang, J.-S. Keum, and A. A. Jaffa Mechanisms through which bradykinin promotes glomerular injury in diabetes Am J Physiol Renal Physiol, March 1, 2005; 288(3): F483 - F492. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Okada, T. Kikuta, T. Kobayashi, T. Inoue, Y. Kanno, M. Takigawa, T. Sugaya, J. B. Kopp, and H. Suzuki Connective Tissue Growth Factor Expressed in Tubular Epithelium Plays a Pivotal Role in Renal Fibrogenesis J. Am. Soc. Nephrol., January 1, 2005; 16(1): 133 - 143. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. McLennan, X. Y. Wang, V. Moreno, D. K. Yue, and S. M. Twigg Connective Tissue Growth Factor Mediates High Glucose Effects on Matrix Degradation through Tissue Inhibitor of Matrix Metalloproteinase Type 1: Implications for Diabetic Nephropathy Endocrinology, December 1, 2004; 145(12): 5646 - 5655. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Zhou, C. Li, and L. Cai Advanced Glycation End-Products Induce Connective Tissue Growth Factor-Mediated Renal Fibrosis Predominantly through Transforming Growth Factor {beta}-Independent Pathway Am. J. Pathol., December 1, 2004; 165(6): 2033 - 2043. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. F. Higgins, M. P. Biju, Y. Akai, A. Wutz, R. S. Johnson, and V. H. Haase Hypoxic induction of Ctgf is directly mediated by Hif-1 Am J Physiol Renal Physiol, December 1, 2004; 287(6): F1223 - F1232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wang, J. Skorczewski, X. Feng, L. Mei, and J. E. Murphy-Ullrich Glucose Up-regulates Thrombospondin 1 Gene Transcription and Transforming Growth Factor-{beta} Activity through Antagonism of cGMP-dependent Protein Kinase Repression via Upstream Stimulatory Factor 2 J. Biol. Chem., August 13, 2004; 279(33): 34311 - 34322. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E J Kuiper, A N Witmer, I Klaassen, N Oliver, R Goldschmeding, and R O Schlingemann Differential expression of connective tissue growth factor in microglia and pericytes in the human diabetic retina Br. J. Ophthalmol., August 1, 2004; 88(8): 1082 - 1087. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Morrison, K. Knoll, M. J. Hessner, and M. Liang Effect of high glucose on gene expression in mesangial cells: upregulation of the thiol pathway is an adaptational response Physiol Genomics, May 19, 2004; 17(3): 271 - 282. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Roestenberg, F. A. van Nieuwenhoven, L. Wieten, P. Boer, T. Diekman, A. M. Tiller, W. M. Wiersinga, N. Oliver, W. Usinger, S. Weitz, et al. Connective Tissue Growth Factor Is Increased in Plasma of Type 1 Diabetic Patients With Nephropathy Diabetes Care, May 1, 2004; 27(5): 1164 - 1170. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Conway, A. P. Maxwell, D. A. Savage, C. C. Patterson, P. P. Doran, M. Murphy, H. R. Brady, and D. G. Fogarty Association Between Variation in the Actin-Binding Gene Caldesmon and Diabetic Nephropathy in Type 1 Diabetes Diabetes, April 1, 2004; 53(4): 1162 - 1165. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Susztak, E. Bottinger, A. Novetsky, D. Liang, Y. Zhu, E. Ciccone, D. Wu, S. Dunn, P. McCue, and K. Sharma Molecular Profiling of Diabetic Mouse Kidney Reveals Novel Genes Linked to Glomerular Disease Diabetes, March 1, 2004; 53(3): 784 - 794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Mitchell, K. Rodgers, J. Hanly, B. McMahon, H. R. Brady, F. Martin, and C. Godson Lipoxins Inhibit Akt/PKB Activation and Cell Cycle Progression in Human Mesangial Cells Am. J. Pathol., March 1, 2004; 164(3): 937 - 946. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Tikellis, M. E. Cooper, Stephen. M. Twigg, W. C. Burns, and M. Tolcos Connective Tissue Growth Factor Is Up-Regulated in the Diabetic Retina: Amelioration by Angiotensin-Converting Enzyme Inhibition Endocrinology, February 1, 2004; 145(2): 860 - 866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Lam, R. N. van der Geest, N. A.M. Verhagen, F. A. van Nieuwenhoven, I. E. Blom, J. Aten, R. Goldschmeding, M. R. Daha, and C. van Kooten Connective Tissue Growth Factor and IGF-I Are Produced by Human Renal Fibroblasts and Cooperate in the Induction of Collagen Production by High Glucose Diabetes, December 1, 2003; 52(12): 2975 - 2983. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Bao, J. Zhou, V. M. Holers, and R. J. Quigg Excessive Matrix Accumulation in the Kidneys of MRL/lpr Lupus Mice Is Dependent on Complement Activation J. Am. Soc. Nephrol., October 1, 2003; 14(10): 2516 - 2525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. B. Connolly, D. Sadlier, N. E. Kieran, P. Doran, and H. R. Brady Transcriptome Profiling and the Pathogenesis of Diabetic Complications J. Am. Soc. Nephrol., August 1, 2003; 14(90003): S279 - 283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Finckenberg, K. Inkinen, J. Ahonen, S. Merasto, M. Louhelainen, H. Vapaatalo, D. Muller, D. Ganten, F. Luft, and E. Mervaala Angiotensin II Induces Connective Tissue Growth Factor Gene Expression via Calcineurin-Dependent Pathways Am. J. Pathol., July 1, 2003; 163(1): 355 - 366. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Meek, S. K. Cooney, S. D. Flynn, R. F. Chouinard, M. H. Poczatek, J. E. Murphy-Ullrich, and K. R. Tuttle Amino acids induce indicators of response to injury in glomerular mesangial cells Am J Physiol Renal Physiol, July 1, 2003; 285(1): F79 - F86. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. I. Stenina, I. Krukovets, K. Wang, Z. Zhou, F. Forudi, M. S. Penn, E. J. Topol, and E. F. Plow Increased Expression of Thrombospondin-1 in Vessel Wall of Diabetic Zucker Rat Circulation, July 1, 2003; 107(25): 3209 - 3215. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Mason and N. A. Wahab Extracellular Matrix Metabolism in Diabetic Nephropathy J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1358 - 1373. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wang and R. Hirschberg BMP7 antagonizes TGF-beta -dependent fibrogenesis in mesangial cells Am J Physiol Renal Physiol, May 1, 2003; 284(5): F1006 - F1013. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Candido, J. M. Forbes, M. C. Thomas, V. Thallas, R. G. Dean, W. C. Burns, C. Tikellis, R. H. Ritchie, S. M. Twigg, M. E. Cooper, et al. A Breaker of Advanced Glycation End Products Attenuates Diabetes-Induced Myocardial Structural Changes Circ. Res., April 18, 2003; 92(7): 785 - 792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. S. Weston, N. A. Wahab, and R. M. Mason CTGF Mediates TGF-{beta}-Induced Fibronectin Matrix Deposition by Upregulating Active {alpha}5{beta}1 Integrin in Human Mesangial Cells J. Am. Soc. Nephrol., March 1, 2003; 14(3): 601 - 610. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Twigg, Z. Cao, S. V. MCLennan, W. C. Burns, G. Brammar, J. M. Forbes, and M. E. Cooper Renal Connective Tissue Growth Factor Induction in Experimental Diabetes Is Prevented by Aminoguanidine Endocrinology, December 1, 2002; 143(12): 4907 - 4915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. G. Crean, D. Finlay, M. Murphy, C. Moss, C. Godson, F. Martin, and H. R. Brady The Role of p42/44 MAPK and Protein Kinase B in Connective Tissue Growth Factor Induced Extracellular Matrix Protein Production, Cell Migration, and Actin Cytoskeletal Rearrangement in Human Mesangial Cells J. Biol. Chem., November 8, 2002; 277(46): 44187 - 44194. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Wahab, B. S. Weston, T. Roberts, and R. M. Mason Connective Tissue Growth Factor and Regulation of the Mesangial Cell Cycle: Role in Cellular Hypertrophy J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2437 - 2445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Wolf Molecular Mechanisms of Diabetic Mesangial Cell Hypertrophy: A Proliferation of Novel Factors J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2611 - 2613. [Full Text] [PDF]
|
|
|
|
|
|
E. Gore-Hyer, D. Shegogue, M. Markiewicz, S. Lo, D. Hazen-Martin, E. L. Greene, G. Grotendorst, and M. Trojanowska TGF-beta and CTGF have overlapping and distinct fibrogenic effects on human renal cells Am J Physiol Renal Physiol, October 1, 2002; 283(4): F707 - F716. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. J. Way, K. Isshiki, K. Suzuma, T. Yokota, D. Zvagelsky, F. J. Schoen, G. E. Sandusky, P. A. Pechous, C. J. Vlahos, H. Wakasaki, et al. Expression of Connective Tissue Growth Factor Is Increased in Injured Myocardium Associated With Protein Kinase C {beta}2 Activation and Diabetes Diabetes, September 1, 2002; 51(9): 2709 - 2718. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Candido, K. A. Jandeleit-Dahm, Z. Cao, S. P. Nesteroff;, W. C. Burns, S. M. Twigg, R. J. Dilley, M. E. Cooper, and T. J. Allen Prevention of Accelerated Atherosclerosis by Angiotensin-Converting Enzyme Inhibition in Diabetic Apolipoprotein E-Deficient Mice Circulation, July 9, 2002; 106(2): 246 - 253. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yokoi, M. Mukoyama, A. Sugawara, K. Mori, T. Nagae, H. Makino, T. Suganami, K. Yahata, Y. Fujinaga, I. Tanaka, et al. Role of connective tissue growth factor in fibronectin expression and tubulointerstitial fibrosis Am J Physiol Renal Physiol, May 1, 2002; 282(5): F933 - F942. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Twigg, A. H. Joly, M. M. Chen, J. Tsubaki, H.-S. Kim, V. Hwa, Y. Oh, and R. G. Rosenfeld Connective Tissue Growth Factor/IGF-Binding Protein-Related Protein-2 Is a Mediator in the Induction of Fibronectin by Advanced Glycosylation End-Products in Human Dermal Fibroblasts Endocrinology, April 1, 2002; 143(4): 1260 - 1269. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Clarkson, M. Murphy, S. Gupta, T. Lambe, H. S. Mackenzie, C. Godson, F. Martin, and H. R. Brady High Glucose-altered Gene Expression in Mesangial Cells. ACTIN-REGULATORY PROTEIN GENE EXPRESSION IS TRIGGERED BY OXIDATIVE STRESS AND CYTOSKELETAL DISASSEMBLY J. Biol. Chem., March 15, 2002; 277(12): 9707 - 9712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Brodsky, J. Chen, A. Lee, K. Akassoglou, J. Norman, and M. S. Goligorsky Plasmin-dependent and -independent effects of plasminogen activators and inhibitor-1 on ex vivo angiogenesis Am J Physiol Heart Circ Physiol, October 1, 2001; 281(4): H1784 - H1792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. HEUSINGER-RIBEIRO, M. EBERLEIN, N. A. WAHAB, and M. GOPPELT-STRUEBE Expression of Connective Tissue Growth Factor in Human Renal Fibroblasts: Regulatory Roles of RhoA and cAMP J. Am. Soc. Nephrol., September 1, 2001; 12(9): 1853 - 1861. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Chen, S. Brodsky, H. Li, D. J. Hampel, T. Miyata, T. Weinstein, U. Gafter, J. T. Norman, L. G. Fine, and M. S. Goligorsky Delayed branching of endothelial capillary-like cords in glycated collagen I is mediated by early induction of PAI-1 Am J Physiol Renal Physiol, July 1, 2001; 281(1): F71 - F80. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. E. Blom, A. J. van Dijk, L. Wieten, K. Duran, Y. Ito, L. Kleij, M. deNichilo, T. J. Rabelink, J. J. Weening, J. Aten, et al. In vitro evidence for differential involvement of CTGF, TGF{beta}, and PDGF-BB in mesangial response to injury Nephrol. Dial. Transplant., June 1, 2001; 16(6): 1139 - 1148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Goppelt-Struebe, A Hahn, D Iwanciw, M Rehm, and B Banas Regulation of connective tissue growth factor (ccn2; ctgf) gene expression in human mesangial cells: modulation by HMG CoA reductase inhibitors (statins) Mol. Pathol., June 1, 2001; 54(3): 176 - 179. [Abstract] [Full Text]
|
|
|
|
|
|
I E Blom, A J van Dijk, R A de Weger, M G J Tilanus, and R Goldschmeding Identification of human ccn2 (connective tissue growth factor) promoter polymorphisms Mol. Pathol., June 1, 2001; 54(3): 192 - 196. [Abstract] [Full Text]
|
|
|
|
|
|
S. M. Twigg, M. M. Chen, A. H. Joly, S. D. Chakrapani, J. Tsubaki, H.-S. Kim, Y. Oh, and R. G. Rosenfeld Advanced Glycosylation End Products Up-Regulate Connective Tissue Growth Factor (Insulin-Like Growth Factor-Binding Protein-Related Protein 2) in Human Fibroblasts: A Potential Mechanism for Expansion of Extracellular Matrix in Diabetes Mellitus Endocrinology, May 1, 2001; 142(5): 1760 - 1769. [Abstract] [Full Text]
|
|
|
|
|
|
N. YEVDOKIMOVA, N. A. WAHAB, and R. M. MASON Thrombospondin-1 Is the Key Activator of TGF-{beta}1 in Human Mesangial Cells Exposed to High Glucose J. Am. Soc. Nephrol., April 1, 2001; 12(4): 703 - 712. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. ITO, R. GOLDSCHMEDING, R. J. BENDE, N. CLAESSEN, M. A. CHAND, L. KLEIJ, T. J. RABELINK, J. J. WEENING, and J. ATEN Kinetics of Connective Tissue Growth Factor Expression during Experimental Proliferative Glomerulonephritis J. Am. Soc. Nephrol., March 1, 2001; 12(3): 472 - 484. [Abstract] [Full Text]
|
|
|
|
|
|
M. H. Poczatek, C. Hugo, V. Darley-Usmar, and J. E. Murphy-Ullrich Glucose Stimulation of Transforming Growth Factor-{beta} Bioactivity in Mesangial Cells Is Mediated by Thrombospondin-1 Am. J. Pathol., October 1, 2000; 157(4): 1353 - 1363. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. D. Hennebold, M. Tanaka, J. Saito, B. R. Hanson, and E. Y. Adashi Ovary-Selective Genes I: The Generation and Characterization of an Ovary-Selective Complementary Deoxyribonucleic Acid Library Endocrinology, August 1, 2000; 141(8): 2725 - 2734. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. El-Meanawy, J. R. Schelling, F. Pozuelo, M. M. Churpek, E. K. Ficker, S. Iyengar, and J. R. Sedor Use of serial analysis of gene expression to generate kidney expression libraries Am J Physiol Renal Physiol, August 1, 2000; 279(2): F383 - F392. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S. Frazier, A. Paredes, P. Dube, and E. Styer Connective Tissue Growth Factor Expression in the Rat Remnant Kidney Model and Association with Tubular Epithelial Cells Undergoing Transdifferentiation Vet. Pathol., July 1, 2000; 37(4): 328 - 335. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. McMahon, M. Murphy, M. Clarkson, M. Taal, H. S. Mackenzie, C. Godson, F. Martin, and H. R. Brady IHG-2, a Mesangial Cell Gene Induced by High Glucose, Is Human gremlin. REGULATION BY EXTRACELLULAR GLUCOSE CONCENTRATION, CYCLIC MECHANICAL STRAIN, AND TRANSFORMING GROWTH FACTOR-beta 1 J. Biol. Chem., March 31, 2000; 275(14): 9901 - 9904. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Goldschmeding, J. Aten, Y. Ito, I. Blom, T. Rabelink, and J. J. Weening Connective tissue growth factor: just another factor in renal fibrosis? Nephrol. Dial. Transplant., March 1, 2000; 15(3): 296 - 299. [Full Text] [PDF]
|
|
|
|
|
|
B. L. RISER, M. DENICHILO, P. CORTES, C. BAKER, J. M. GRONDIN, J. YEE, and R. G. NARINS Regulation of Connective Tissue Growth Factor Activity in Cultured Rat Mesangial Cells and Its Expression in Experimental Diabetic Glomerulosclerosis J. Am. Soc. Nephrol., January 1, 2000; 11(1): 25 - 38. [Abstract] [Full Text]
|
|
|
|
|
|
J. Wada, K. Shikata, and H. Makino Novel approaches to unravel the genesis of glomerulosclerosis by new methodologies in molecular biology and molecular genetics Nephrol. Dial. Transplant., November 1, 1999; 14(11): 2551 - 2553. [Full Text] [PDF]
|
|
|
|
 |
|
 D. R. Brigstock The Connective Tissue Growth Factor/Cysteine- Rich 61/Nephroblastoma Overexpressed (CCN) Family Endocr. Rev., April 1, 1999; 20(2): 189 - 206. [Abstract] [Full Text]
|
|
|
|
|
|
A. Hahn, J. Heusinger-Ribeiro, T. Lanz, S. Zenkel, and M. Goppelt-Struebe Induction of Connective Tissue Growth Factor by Activation of Heptahelical Receptors. MODULATION BY Rho PROTEINS AND THE ACTIN CYTOSKELETON J. Biol. Chem., November 22, 2000; 275(48): 37429 - 37435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Stanhope-Baker and B. R. G. Williams Identification of Connective Tissue Growth Factor as a Target of WT1 Transcriptional Regulation J. Biol. Chem., December 1, 2000; 275(49): 38139 - 38150. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Suzuma, K. Naruse, I. Suzuma, N. Takahara, K. Ueki, L. P. Aiello, and G. L. King Vascular Endothelial Growth Factor Induces Expression of Connective Tissue Growth Factor via KDR, Flt1, and Phosphatidylinositol 3-Kinase-Akt-dependent Pathways in Retinal Vascular Cells J. Biol. Chem., December 22, 2000; 275(52): 40725 - 40731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Hishikawa, B. S. Oemar, and T. Nakaki Static Pressure Regulates Connective Tissue Growth Factor Expression in Human Mesangial Cells J. Biol. Chem., May 11, 2001; 276(20): 16797 - 16803. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |