|
J Biol Chem, Vol. 275, Issue 1, 487-496, January 7, 2000
The TATA Motif Specifies the Differential Activation of
Minimal Promoters by Varicella Zoster Virus Immediate-early Regulatory
Protein IE62*
Liyanage P.
Perera
From the Metabolism Branch, Division of Clinical Sciences, NCI,
National Institutes of Health, Bethesda, Maryland 20892
 |
ABSTRACT |
The immediate-early IE62 protein of varicella
zoster virus is an acidic transcriptional activator capable of
up-regulating many viral and cellular promoters with varying
efficiencies. We demonstrate that, in the context of a minimal
promoter, a TATA element is both sufficient and essential for
IE62-mediated transcriptional activation. Differential levels of
activation by IE62 in this context were conferred by a panel of
naturally occurring sequence variations within the TATA motif itself.
TATA motif-specific, differential induction was not obtained when the
IE62 acidic activation domain was targeted as a GAL4 fusion protein to
the same panel. The prototype acidic transactivator, VP16 of herpes
simplex virus, failed to discriminate between these different TATA
motifs when they were placed into an appropriate responsive promoter
context. Nonetheless, a chimeric IE62 polypeptide substituted with the VP16 activation domain retained the ability to differentially modulate
minimal promoters with various TATA motifs. Taken together with its
binding to TATA box-binding protein (TBP) and transcription factor IIB
in vitro, we suggest that IE62 has the unusual ability to
achieve differential levels of transcriptional activation through different TATA motifs, which may be accomplished either directly or
indirectly by recognizing conformational variations in DNA-bound TBP,
TBP-transcription factor IIA/B, or TBP-TATA-associated factor complexes.
 |
INTRODUCTION |
Varicella zoster virus
(VZV)1 causes chickenpox as a
primary infection, and shingles as a reactivated infection. The lytic cycle of this virus begins with the expression of its major
immediate-early protein, IE62, a DNA-binding
trans-regulatory protein containing 1310 amino acid residues
with a predicted molecular mass of 140 kDa (1). IE62 is a potent
transactivator that stimulates transcription not only of target VZV
genes, but also a variety of heterologous viral and cellular genes (2,
3). Although there is no definitive genetic proof as yet that IE62 is
essential for VZV replication, its ability to regulate the expression
of VZV genes of all three putative kinetic classes (immediate-early,
early, and late) as well as its sequence homology and functional
similarity to the essential ICP4 transactivator of herpes simplex virus
(HSV) argue that it serves a critical role in the VZV replicative
cycle. Both VZV IE62 and HSV-1 ICP4 bind to specific ATCGTC DNA
sequences at the cap site of their own promoters, and these
interactions are thought to be involved primarily in negative
transcriptional autoregulation. However, the mechanism by which these
proteins up-regulate the transcription of responsive viral promoters
has not yet been well defined.
Accumulating evidence indicates that transcriptional activators, in
general, enhance transcription by influencing or stabilizing functional
interactions among the general transcription factors including TATA
box-binding protein (TBP), TFIIA, and TFIIB, that are essential for the
formation of a functional pre-initiation complex (reviewed in Refs.
4-12). In addition, the in vitro function of
transcriptional activators requires a number of co-factors that are not
essential for basal transcription in minimal reconstituted systems.
Many of these co-factors are physically associated with the TBP
polypeptide (TATA-associated factors or TAFs) and constitute the
holoTFIID fraction along with TBP. Certain transactivators have been
shown to interact specifically with TBP and one or more TAFs, and these
interactions appear to function as molecular adapters that bridge
between the transactivator and the general transcription initiation
machinery and serve to recruit TBP and enhance a rate-limiting step in
transcription (reviewed in Refs. 5, 8, and 10).
An intriguing aspect of IE62 function is its capacity to activate in
trans a diverse array of promoters that lack any apparent conserved motifs in their promoter and upstream regions (2, 3, 13). In
addition, the magnitude of responsiveness to IE62 varies widely from
promoter to promoter. Curiously, in both HSV and VZV, most of the
immediate-early and early class promoters tend to have classical
close-to-consensus TATA motifs, whereas late class promoters typically
have highly divergent, non-consensus (but still AT-rich) TATA-like
motifs. Both types of promoters respond to IE62 and ICP4, although in
HSV other accessory viral factors clearly contribute to both maximal
and appropriate temporal responses of late promoters.
Previous deletion analysis of the VZV IE62 promoter revealed that a
minimal reporter construct possessing the TATA box with only 15 base
pairs (bp) of adjacent upstream sequence retains responsiveness to
IE62-mediated induction but not to its HSV homolog ICP4 (13). Because
this upstream sequence lacks consensus recognition motifs for binding
to IE62 or any other known transcription factors, we have focused our
attention on the TATA element itself as a potential key factor in
mediating the transcriptional effects of IE62. In this report, we
present evidence to suggest that a novel TATA
motif-dependent mechanism is both essential and sufficient for IE62-mediated transcriptional activation.
 |
EXPERIMENTAL PROCEDURES |
Target Reporter Gene Plasmids Containing Panels of Different TATA
Motifs--
Plasmids p62CAT 258 and p62CAT 45 have been described
previously (13). In pIFNTATA, a 60-bp segment
(TTGTCCCTATTTAAGAGAGATGTACACAGCAGGCTCTCAGAGAACCTGTAGGAGAAACT) extending from 38 to +22 of the murine 4 interferon gene was placed immediately upstream from the coding region of the
chloramphenicol acetyltransferase (CAT) reporter gene (14). The TATA
element and the putative initiator element (Inr), respectively, of the interferon gene are shown in bold print. In pIFN TATA and
pIFNTATA CAP, either 5 or 3 bp of the TATA or the Inr, respectively,
were deleted by site-specific mutagenesis. In pIFNTATAMCAP the putative
Inr element was changed from TCTCAG to TCTAAG. To create a TATA only synthetic promoter (pTATAx5CAT), a 44-bp oligonucleotide consisting of
five tandem copies of the -casein TATA sequence TATATATA was inserted at the XbaI site upstream of the CAT coding region
in the plasmid pCAT-B (Basic, Promega Corp.). A parallel control plasmid (p TATAx5CAT) contained a 44-bp oligonucleotide consisting of
five tandem copies of the mutant sequence TATCGATC. In pE1bTATA, a
single copy 12-bp (TAATATAGGAGA) synthetic oligonucleotide bearing the
adenovirus E1b gene TATA motif was inserted immediately upstream of the
CAT gene (15).
For analysis of the responsiveness of diverse TATA elements to IE62, a
panel of target constructs was created. To do so, the TATA element in
the pIFNTATA target plasmid was modified by site-specific mutagenesis
to resemble the TATA motifs of several viral and cellular genes. For
example, p(T)TTTTAA bears the TTTTAA motif of the VZV IE62 gene;
p(T)ATTAAA bears the ATTAAA motif of the VZV thymidine kinase (TK)
gene; p(T)ATTTAAATT bears the ATTTAAATT motif of the VZV glycoprotein C
gene; pTATAAAA bears the TATAAAA motif of the adenovirus MLP and of the
HSP90 genes; pTATATATA(A) bears the TATATATA motif of the cellular
-casein gene (16); and pTATATAA bears the TATATAA motif of the human
cytomegalovirus (HCMV) major immediate-early (MIE) promoter. The
distance between the TATA box and Inr element (25 bp) remained
unchanged for TATTAAA, TTTTTAA, TATAAAA, and TATATAA mutants. However,
this distance was reduced by 2 bp for TATATATAA mutant and by 3 bp for
TATTTAAATT mutant.
A second set of TATA motif constructs was created, by cloning a 100-bp
oligonucleotide cassette, containing five tandem GAL4-binding sites 28 bp upstream of the modified TATA boxes in the -IFN minimal promoter
panel described above to yield the following set of GAL4-responsive reporter genes, p5G-TTTTTAA, p5G-TATTAAA, p5G-TATAAAA, p5G-TATTTAAATT, p5G-TATATATAA, and p5G-TATATAA.
In ICP0-CAT (pGH83), the promoter elements, including several
Oct-1/TAATGARAT type, VP16 response motifs extending from -800 to +120
within the HSV immediate-early ICP0 gene, drive the expression of CAT
reporter gene (17). A third TATA motif panel was created based on this
construct. Specifically, the native TATA element (GGGGTATAAGTT) in
ICP0-CAT was replaced by site-specific mutagenesis with a variety of
TATA boxes, to generate ICP0-CAT/ TATA with the TATA motif deleted,
ICP0-CATM/TTTTTAA (bearing the VZV IE62 TATA motif), ICP0-CATM/TATATAA
(bearing the HCMV MIE TATA), and ICP0-CATM/TATAAAA (bearing the
consensus MLP and HSP90 TATA).
Further, a fourth TATA motif panel was created by cloning a 23-bp
oligonucleotide cassette bearing the Oct-1/TAATGARAT motif (GTGCATGCTAATGATATTCTTTC) immediately upstream of the modified TATA
elements in the -IFN minimal promoter to yield a set of VP16-responsive, minimal reporter plasmids designated pVP-TTTTTAA, pVP-TATTAAA, pVP-TATAAAA, pVP-TATTTAAATT, pVP-TATATATAA, and
pVP-TATATAA.
Effector Genes and CAT Assays--
The pCMV62 plasmid
expresses the VZV IE62 protein (3) from the HCMV MIE promoter. The
pRL45 plasmid, which expresses both the immediate-early proteins IE1
and IE2 of HCMV, has been described previously (18). Plasmid p62GAL
(9-120) expresses the chimeric protein GAL4-IE62 containing the
activation domain of IE62 (aa 9-120) fused to the GAL4 DNA binding
domain (aa 1-147) and has also been described previously (19). The
VP16 plasmid (pGH62) expresses the intact HSV-1 VP16 effector protein
from its cognate promoter (17). The plasmid pGH114 has been described
earlier (13) and expresses ICP4 from the simian cytomegalovirus
immediate early promoter. The pPRV180 plasmid expresses the IE180 of
pseudorabies virus and was a gift from P. Sheldrick. The E1A expression
plasmid (20) was a gift from G. Nabel. The plasmid pCMV62/16AD is a derivative of pCMV62 and contains the coding region of HSV VP16 activation domain (aa 411-455) obtained as a
BglII-EcoRI fragment from pVP16
(CLONTECH), cloned in-frame 5' to the IE62 coding
segment extending from codon 96 to 1310. Effector and target reporter gene plasmid DNAs were electroporated into A3.01 cells (a human T
lymphocytic cell line). The CAT activity was determined as described previously (3), quantitated with a PhosphorImager scanner (Molecular Dynamics), and expressed as percentage of conversion of
[14C]chloramphenicol to its acetylated derivatives.
RNase Protection Assay--
In RNase protection assays, 40 µg
of total cellular RNA extracted from transfected A3.01 T lymphocytic
cells were hybridized with an antisense RNA probe corresponding to CAT
gene for 12 h at 56 °C in 40 mM PIPES (pH 6.7), 350 mM NaCl, 1 mM EDTA, and 80% formamide. As
internal controls, antisense RNA probes corresponding to the CD4 cell
surface marker and two housekeeping genes, L32 ribosomal gene and
glyceraldehyde-3-phosphate dehydrogenase, were also included. Samples
were then treated with RNase A (40 µg/ml) and RNase T1 (2 µg/ml)
for 45 min at 30 °C. The reactions were terminated by adding 50 µg
of proteinase K and 10 µl of 10% SDS and incubated at 37 °C for
15 min. After phenol-chloroform extraction and ethanol precipitation,
the samples were resolved on 6% denaturing polyacrylamide gel and
subjected to autoradiography as well as phosphorimage analysis.
In Vitro Protein Matrix Affinity Binding Assays--
Three
overlapping segments (aa 9-410, 234-734, and 734-1310) spanning
nearly the entire length of the 1310-aa IE62 protein, were cloned into
an in vitro transcription/translation vector (21) to
generate portions of the IE62 polypeptide in a rabbit reticulocyte
lysate system. Agarose beads coupled to purified intact 33-kDa human
TFIIB synthesized in Escherichia coli were purchased from
Santa Cruz Biotechnology (catalog SC4001AC). TBP-N (N-terminal) and
TBP-C (C-terminal) GST-fusion proteins were expressed in E. coli and purified by incubating the bacterial supernatants with
glutathione-Sepharose beads as described previously (22). For analysis
of purity of bead-bound fusion proteins, the beads were boiled in
sample buffer and subjected to SDS-PAGE, followed by visualization of
proteins with Coomassie Blue stain. Equal amounts (25 µg) of
bead-bound proteins were incubated with in vitro translated,
35S-labeled polypeptides representing segments of the IE62
protein. The binding buffer contained 140 mM NaCl, 50 mM Tri-HCl, 0.5% Triton X-100, 2 mM
dithiothreitol, and 100 µg/ml ethidium bromide to eliminate
nonspecific protein DNA-interactions (23). After extensive washing to
remove the unbound material, the beads were resuspended in protein
sample buffer, boiled for 5 min, and resolved by SDS-PAGE.
Electrophoretic Mobility Shift Assay (EMSA)--
Electrophoretic
mobility shift assays with purified recombinant human TATA-binding
protein TBP synthesized in E. coli (Promega TFIID, catalog
no. E3081) were performed with synthetic, double-stranded oligonucleotides 34 bp in length. The entire sequence of the top strand
of each TATA motif oligonucleotide evaluated by EMSA is shown in Table
I. The binding reactions were performed in a buffer containing 10%
glycerol, 20 mM Tris-HCl (pH 7.0) 80 mM KCl, 10 mM MgCl2, and 2 mM dithiothreitol.
As nonspecific carrier DNA, 1 µg of poly(dG-dC):poly(dG-dC) was
included in the binding reaction. One hundred femtomoles of each
32P-labeled, double-stranded oligonucleotide pair were
incubated with indicated amounts of purified bacterially expressed
human TBP (Promega) at room temperature for 20 min, loaded onto a
nondenaturing 5% polyacrylamide gel, and then electrophoresed for
4 h at 150 V. The authenticity of the commercial TBP preparation
was confirmed using an antibody specific for human TBP (Upstate
Biotechnology Inc.) to supershift the complexes formed with TATA box
containing oligonucleotide. In competition experiments, 100 fmol of the
32P-labeled, double-stranded HCMV MIE TATATAA
oligonucleotide probe was first incubated with 5 ng of TBP for 10 min
and then the competitor oligonucleotide was added and incubated for
another 10 min. The electrophoresis buffer was 0.5× TBE with 2.5 mM MgCl2 and 0.05% Nonidet P-40.
 |
RESULTS |
The TATA Element Is Essential for IE62-mediated Transcriptional
Activation--
The immediate-early protein encoded by the open
reading frame 62 constitutes the major transcriptional regulatory
protein of VZV. However, the mechanistic aspects of its transcriptional activity remain poorly understood, although its HSV counterpart ICP4
has been extensively studied. Our previous studies indicated important
differences between these two related regulatory proteins of
alphaherpesviruses. For example, unlike ICP4 which represses its
cognate promoter activity, IE62 augments the transcription from its own
promoter as well as that of the ICP4 promoter. In addition, despite
ICP4's repressive effects on its own promoter, it enhanced the
transcription from the IE62 promoter. However, the upstream
cis-elements required for the induction of IE62 promoter by
IE62 and ICP4 differed (13). Confirming our previous observations, as
shown in Fig. 1 (panel
A), the IE62 promoter with 258-bp upstream sequences with
reference to its transcription start site (p62CAT 258) responded
positively when cotransfected with either IE62 or ICP4 (120- or
25-fold, respectively). In contrast, an IE62 promoter version having
only 15-bp upstream sequences together with its TATA box (p62CAT 45)
responded only to IE62 (36-fold).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 1.
A, the cis elements in VZV
IE62 promoter necessary for positive modulation by VZV IE62 and HSV
ICP4 are separable. The two reporter constructs p62CAT 258 and
p62CAT 45 contain promoter sequences of VZV open reading frame 62 gene extending up to 258 and 45 bp upstream of its transcription start
site respectively. B, the presence of a TATA element is both
sufficient and essential for the activation of minimal promoters by VZV
IE62. The pIFNTATA target plasmid contains a 60-bp minimal promoter
derived from the mouse 4 interferon promoter elements between 38
and +22 driving the expression of a CAT reporter gene. The pIFN TATA
plasmid is a derivative of pIFNTATA with a 5-bp deletion in the TATA
element. C, IE62-mediated activation of pIFNTATA target
promoters containing mutant and deleted Inr elements. The
pIFNTATA CAP and pIFNTATAMCAP plasmids are derivatives of pIFNTATA
with either a 3-bp deletion or a single point mutation in the initiator
element (CAP) as described under "Experimental Procedures." The
effector proteins VZV IE62 and HSV ICP4 were expressed from pCMV62 and
pGH114, respectively (3), and are driven by the CMV immediate-early
promoters. The IE1 and IE2 effector proteins of HCMV were expressed
from plasmid pRL45 (18). Other effector plasmids used are described
under "Experimental Procedures." Equal amounts of the effector and
target plasmid DNAs (10 µg) were electroporated into the A3.01 human
T-lymphocytic cell line, and the CAT activity was measured as described
under "Experimental Procedures."
|
|
Scrutiny of the IE62 promoter region in p62CAT 45 revealed no
recognition motifs for binding to IE62 or any other known transcription factors other than the TATA box. Considering that IE62 activates a wide
array of viral and cellular promoters and the fact that the core
promoter element-TATA box is a common motif present in all these
responsive promoters, we focused on the TATA element as a potential
mediator of the IE62 transcriptional activity.
To explore the contribution of the TATA element to IE62-mediated
induction, a CAT reporter gene containing a 60-bp minimal promoter
derived from the murine 4 IFN promoter elements (pIFNTATA) (14) was
electroporated into the human T-lymphocytic cell line A3.01 with or
without a VZV IE62 effector plasmid. T lymphocytes have been implicated
as important vehicles for the growth and spread of VZV in
vivo (see Ref. 3 and references therein), and specific T cell
tropism for VZV has been demonstrated (24). Our previous studies with
VZV promoter targets were also carried out in these cells (3, 13,
19).
The minimal pIFNTATA promoter target was induced by the cotransfected
IE62 effector plasmid (Fig. 1, panel B), which
expressed the intact IE62 protein under the control of the HCMV MIE
promoter. Neither a control plasmid containing the HCMV MIE promoter
region alone (data not shown), nor plasmids expressing the IE62
homologs ICP4 of HSV and IE180 of pseudorabies virus, the ICP0 protein of HSV, or the adenovirus E1A protein, resulted in any obvious increase
in CAT activity when cotransfected with the target plasmids. The HCMV
IE1/IE2, however, was able to activate pIFNTATA significantly (Fig. 1,
panel B).
Two synthetic minimal core promoters consisting, first, of a 12-bp
TAATATA element from the adenovirus E1b promoter in pE1bTATA CAT (15)
and, second, one containing three tandem copies of either a wild-type
TATATATA motif only or a TATA mutant motif inserted 5' to the CAT
reporter gene in pCAT-B vector (Promega Corp.) were also tested.
Co-transfection with VZV IE62 gave 4-fold induction of pE1bTATA CAT and
26-fold induction of p(TATA)3 CAT-B, but gave no effect on either the
pCAT-B or p( TATA)3 CAT targets (data not shown).
All three minimal promoters used above lacked any recognized upstream
elements other than the TATA boxes, but pIFNTATA does contain a
putative pyrimidine-rich Inr element (CTCTCAG), of a type that can
substitute for TATA in some circumstances. Therefore, to assess the
relative contributions of the TATA element and the Inr element in
IE62-mediated transactivation, we performed transient expression assays
with a set of minimal pIFNTATA derivatives in which both of these
elements were individually mutated (Fig. 1, panels
B and C). Deletion of 5 bp of the -IFN TATA
element itself (pIFN TATA) led to complete ablation of IE62
responsiveness (Fig. 1, panel B), while deletion
or mutation of the Inr element (pIFNTATA CAP and pIFNTATAMCAP) did
not significantly affect the IE62 responsiveness of the minimal
promoter (Fig. 1, panel C). Although pIFN TATA failed to respond to IE62, it still retained the ability to respond to
HCMV IE1/IE2. Effector plasmid pRL45 expresses both IE1 and IE2 splice
variants, and it is likely that the pIFN TATA induction seen with
pRL45 is actually due to the IE1 polypeptide since IE1 polypeptide but
not IE2 has been shown to enhance transcription from TATA less
promoters (25). The above experiments imply that a TATA element is
required for responsiveness of a minimal promoter to IE62, but not to
certain other viral activators.
Naturally Occurring Sequence Variations within the TATA Motif
Confer Differential Induction Levels--
IE62 is a potent activator
of diverse eukaryotic promoters, although the extent of responsiveness
to it varies widely from promoter to promoter. For example, the VZV TK
promoter was induced 125-fold by IE62, whereas the VZV gpC promoter was
refractory to it (2, 3). These observations, together with the above data regarding the importance of the TATA element to IE62
responsiveness, led us to consider that the different TATA motifs
themselves, rather than different upstream elements, may be most
important in modulating the level of IE62 responsiveness of a promoter. To test this hypothesis, the TATA element within the mouse 4 IFN
promoter (TATTTAA) in the pIFNTATA plasmid was substituted for by the
TATA elements derived from several other well defined cellular and
viral promoters (Table I and Fig.
2).

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
The magnitude of the IE62-mediated activation
of a minimal promoter is TATA motif-dependent. The parent TATA
motif present in pIFNTATA was modified to resemble a variety of
consensus and non-consensus TATA motifs derived from several other
viral and cellular genes, or VZV downstream target genes (see
"Experimental Procedures"). Co-transfections into A3.01 cells and
quantitation of CAT activity were done as described under
"Experimental Procedures," using 10 µg of target DNA and 10 µg
of effector DNA. Asterisk (*) indicates a 10-fold dilution
of the cell extract was used in the assay. The -fold inductions given
for each target in the presence of IE62 represent the mean value of
three independent experiments ± standard error: for pIFNTATA,
50 ± 2.6; for pTATATATAA, 280 ± 32.2; for pTTTTTAA, 13 ± 1.9; for pTATTAAA, 54 ± 6; for pTATAAAA, 258 ± 30.9; for
pTATTTAAATT, 3 ± 0.6; and for pTATATAA, 114 ± 20.2, respectively.
|
|
Most of the modifications of the mouse 4 IFN promoter TATA element
did not result in obvious changes in the basal activity of the promoter
itself, within the limits of sensitivity of the CAT assays as shown in
Fig. 2 (ranged between 0.3% and 0.5% acetylation of chloramphenicol
substrate) or when determined by a sensitive RNase protection assay for
in vivo expressed CAT mRNA (see below). Nonetheless, the
panel of minimal promoter constructs bearing substituted TATA elements
displayed dramatic differences in the magnitude of their responsiveness
to activation by VZV IE62. For example, conversion of the IFN TATTTAA
motif to resemble the TTTAAATT sequence from the VZV glycoprotein C
gene almost abolished IE62 responsiveness (17-fold decrease) and
substitution with TTTTAA from the VZV IE62 promoter reduced induction
4-fold, whereas substitution with the TATAAAA consensus sequence of the
Ad2 MLP and HSP90 promoters conferred a 258-fold activation of CAT
expression in the presence of IE62. In fact, where direct comparisons
could be made (e.g. TK, gpC, and IE62) the relative degree
of responsiveness of each reporter construct to IE62 (54-, 3-, and
13-fold, respectively) resembled the previously reported (3, 13)
order of responsiveness to IE62 of the original promoter regions from
which the different TATA elements were derived. These experiments
suggested that the TATA motif itself greatly influences overall IE62 responsiveness.
To validate the differential activation of various TATA modified
promoter constructs by IE62, it is crucial to assess whether the
substitution of different TATA motifs influenced the basal promoter
activity appreciably. Therefore, the basal activity of each minimal
promoter construct examined in Fig. 2, was directly measured by a
sensitive RNase protection assay following transfection of TATA
modified promoter CAT plasmid DNA into A3.01 T cells. As evident from
the data in Fig. 3, all minimal promoter
versions were transcriptionally active, including the pIFN TATA
(which still contains the core promoter Inr element to initiate
transcription), resulting in appropriately sized protected fragment
with the CAT probe (visible after 6-day exposure). Probes for
housekeeping genes L32 ribosomal gene and glyceraldehyde-3-phosphate
dehydrogenase gene as well as the abundantly expressed CD4 gene were
included as controls for RNA integrity and quantitation standards. Upon quantitation of CAT transcripts from each promoter, the differences in
intensity were less than 2-fold. For example, the intensity of the
protected fragment generated from the consensus TATATAA motif differed
from that of the TTTTTAA and TATA motifs by 20% and 36%,
respectively. Although this was somewhat surprising, a review of
published literature revealed that, of seven motifs examined in Fig. 3,
five motifs (TATATAA, TATATATAA, TATAAAA, TATTTAA, and TATTAAA) have
previously been shown to confer high transcriptional activity (26, 27),
and our results are thus concordant with the published data. However,
the remaining two motifs, TTTTTAA and TATTTAAATT, from VZV IE62 and gC
promoters, respectively, to our knowledge have not been evaluated
previously. Nonetheless, the abundant expression of both IE62 and gC
polypeptides despite their highly divergent TATA motifs during VZV
infection very likely indicate their transcriptional competence. Taken
together, these data suggest that within the limits of sensitivity of
each assay employed the modifications of TATA elements assessed in this
study do not appreciably alter the basal activity of the minimal
promoter and the differential activation seen in the presence of IE62
with various TATA motifs is most likely to be a function of the VZV
IE62 itself.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 3.
Measurement of basal promoter activity by
RNase protection assay. Twenty micrograms of each plasmid DNA were
transfected into A3.01 cells, and after 36 h cellular RNA was
extracted. Forty micrograms of cellular RNA were hybridized with a
209-nt, 32P-labeled, antisense riboprobe corresponding to
CAT gene. The expected size of the protected fragment is 180 nt. As
internal controls labeled antisense riboprobes for CD4 (191 nt in
length and when protected yields a 162-nt fragment), L32 ribosomal (141 nt in length and when protected yields a 113-nt fragment) and
glyceraldehyde-3-phosphate dehydrogenase gene (124 nt in length and
when protected yield a 96-nt fragment) were also included in the RNase
protection assay. The protected RNA fragments were resolved on 6%
sequencing gel and subjected to autoradiography and phosphorimage
analysis.
|
|
TATA Motif-dependent, Differential Induction Is Not
Conferred by the Activation Domain of IE62--
We next sought to
determine whether TATA motif-dependent, differential
induction is conferred by the activation domain of IE62 itself or by
some other segment of the IE62 protein. This is of special relevance in
the light of recent identification of a coactivator protein (PC4) that
mediates acidic activator transcription and contains SEAC motifs in
common with VZV IE62 and many other viral transactivators (28, 29). The
strong acidic activation domain of IE62 is localized to the negatively charged N-terminal region (aa 9-120) of the 1310-amino acid protein (19, 30). Previously, we have shown that the IE62 activation domain (aa
9-120) when expressed as a fusion protein with the yeast GAL4
DNA-binding domain (GAL4-IE62) efficiently activates promoters with
upstream GAL4 binding motifs but not promoters without such sites (19).
In addition, the deletion of this single activation domain of IE62
results in ablation of transcriptional activity, although the deletant
molecule is still capable of competitively interfering with the
transcriptional activity of the native IE62 (19). To assess whether the
activation domain itself is responsible for both transcriptional
activation as well as sensing the differences in the TATA motif leading
to differential responsiveness, five tandem GAL4-binding sites were
placed upstream of the TATA box in each of the panel of TATA
substituted promoters described earlier in Fig. 2. The insertion of
GAL4 binding sites neither affected the basal activities of the
promoters nor their ability to respond differentially to native IE62
when cotransfected (data not shown). When this panel was cotransfected
with the GAL4-IE62 chimeric plasmid, all promoters responded vigorously
(Fig. 4). However, the levels of
activation varied by less than 2-fold upon substitution of the
consensus TATA motif with a variety of other non-consensus TATA motifs,
which in the context of minimal promoters lacking the GAL4-binding
sites led to nearly 100-fold TATA-dependent differences in
activation by the full-length IE62 protein. Although these findings
suggest that the activation domain is not sufficient to impart
differential induction under these circumstances, one could argue that
the tethering of activation domain via a GAL4 bridge may not represent
natural conformation or recruitment of IE62. However, if a region other
than the activation domain of IE62 is responsible for the TATA
motif-dependent, differential activation of promoters,
then, theoretically, if the modular activation domain of IE62 is
replaced with a heterologous activation domain, the chimeric protein
might still be able to display TATA motif-dependent differential effects mimicking a more natural setting if such a
molecule is transcriptionally functional. In selecting an appropriate heterologous activation domain, the preponderance of acidic residues, as well as the comparable sizes and transcriptional strengths of the
modular domains (19), favored VP16, the prototype of acidic
transcriptional activators (31). However, it was crucial that the
substituted activation domain be free of any inherent TATA
motif-dependent effects. Although HSV VP16 remains one of the most extensively studied viral transcriptional activators, the
influence of the TATA motif, if any, for VP16-mediated transcriptional activity has not been described. We therefore first examined whether the TATA motif influences VP16-mediated transcriptional activity.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
The N-terminal acidic activation domain of
IE62 is not sufficient to mediate TATA motif-dependent,
differential modulation. A 100-bp oligonucleotide cassette
containing five tandem GAL4 binding sites (68) was placed upstream of
the TATA box in the same panel of target reporter genes used earlier in
Fig. 2. The chimeric protein GAL4-IE62 expressed from p62GAL(9-120)
contains the activation domain of IE62 (aa 9-120) fused to the DNA
binding domain (aa 1-147) of yeast GAL4 protein. Because of the
sensitivity of the targets to the GAL4 chimeric effector, the amounts
of the target and effector DNAs used in co-transfections were reduced
to 100 ng each.
|
|
The promoter for the HSV immediate-early gene encoding the ICP0 protein
is efficiently activated by VP16. VP16 responsiveness is mediated
primarily by an interaction with the cellular Oct-1 protein and
subsequent binding to multiple upstream Oct-1/TAATGARAT DNA elements in
the ICP0 promoter (32, 33). As shown in Fig. 5 (panel A),
VP16-mediated activation of the ICP0 promoter was changed minimally
(range: 11-15-fold) by substitution of its TATAAG element with several
of the TATA motifs examined earlier in Fig. 2. Nonetheless, it still
remains possible that the apparent insignificance of the TATA element
for the VP16-induced activation of ICP0 promoter resulted from
compensatory effects of other transcription factors such as Sp-1 that
binds to the upstream elements in this complex promoter. To address
this issue, we devised a strategy to direct VP16 to the minimal
promoter panel used in Fig. 2. A 23-bp synthetic Oct-1/TAATGARAT
element was inserted immediately upstream of the TATA box. As shown in
Fig. 5 (panel B), when this panel was
cotransfected with a VP16 expression plasmid, once again there was no
differential TATA motif-dependent induction of the target
plasmids. Equally important was the fact that in the context of a
minimal promoter, or for that matter in the context of a natural target
promoter (ICP0 promoter), VP16 was capable of inducing transcription in the absence of a TATA box.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 5.
Lack of TATA motif specificity for
VP16-mediated activation. A, in the ICP0-CAT gene, the
VP16-responsive promoter elements extending from 800 to +120 of the
ICP0 HSV immediate-early gene drive the expression of a CAT reporter
cassette. The plasmids pICP0CAT TATA, pICP0CATMTTTTTAA,
pICP0CATMTATATAA, and pICP0CATMTATAAAA are derivatives of ICP0-CAT in
which the native TATAA element was changed by site-directed mutagenesis
to introduce a variety of different TATA motifs matching those used in
Fig. 2. The VP16 plasmid used expresses intact HSV VP16 protein from
its own promoter. Nevertheless, because of the high sensitivity of
ICP0-CAT to VP16-mediated activation, the target and the effector DNAs
used in the co-transfections were reduced to 2 µg each. B,
a 23-bp synthetic Oct-1/TAATGARAT cassette was inserted immediately
upstream of the TATA box in the panel of minimal promoter plasmids with
different TATA motifs shown in Fig. 2, and the resultant set of new
plasmids were designated with VP prefix. This panel was then
cotransfected with a plasmid expressing VP16. In cotransfections 10 µg of effector and 10 µg of target DNA were used. The -fold
inductions are the mean value of three independent experiments for each
target.
|
|
Having confirmed that VP16 is devoid of any inherent TATA
motif-dependent effects, a chimeric IE62 with VP16
activation domain substituting the cognate activation domain of IE62
was constructed (IE62/16AD). When IE62/16AD was co-expressed with the
minimal promoter panel examined in Fig. 2, with modified TATA elements, the induction of the minimal promoters were differentially modulated as
was seen with the native IE62 (compare Fig. 2 versus Fig.
6). These results taken together with the
lack of TATA specificity obtained with VP16 (Fig. 5), and also by the
HCMV IE1/IE2 proteins (see Fig. 1, panel B),
supports the notion that TATA motif-dependent, differential
induction is an inherent property of IE62 and not a general property of
viral transactivators and a region other than the activation domain of
IE62 dictates this unique phenomenon.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6.
A chimeric IE62 with a heterologous
activation domain retains the TATA motif-dependent,
differential activation of minimal promoters. The effector plasmid
IE62/16AD contains the HSV VP16 activation domain (aa 411-453 of VP16)
fused in-frame 5' to the IE62 coding region extending from codon 96 through 1310. The target plasmid panel is the same as described in the
legend to Fig. 2. For cotransfection experiments, 10 µg of IE62/16AD
and 10 µg of reporter DNA were used. Asterisk (*)
indicates a 10-fold dilution of the cell extract was used in the assay.
The -fold inductions given for each target in the presence of IE62/16AD
represent the mean value of three independent experiments ± standard error: for pIFNTATA, 44 ± 3.5; for pTATATATAA, 238 ± 31.7; for pTTTTTAA, 20 ± 1.6; for pTATTAAA, 27 ± 2.6;
for pTATAAAA, 286 ± 8.8; for pTATTTAAATT, 3 ± 0.7; and for
pTATATAA, 104 ± 4.7, respectively.
|
|
A Region of IE62 That Interacts with TBP and TFIIB in Vitro Maps
Outside of the Activation Domain--
Given the clear involvement of
TATA element in IE62-mediated transcriptional activation, we assessed
whether IE62 physically interacts with the essential components of the
basal transcriptional machinery that assemble on the TATA element. The
results of protein-protein affinity binding studies, shown in Fig.
7, indicate that it does interact with
both TBP and TFIIB. When various in vitro translated, 35S-labeled, VZV IE62 polypeptide segments were incubated
with purified, bacterially expressed TBP or TFIIB immobilized on beads,
the IE62 protein bound to TFIIB (lanes 2) and to
the evolutionarily conserved C-terminal segment (lanes
4) of TBP (GST/TBP-C) but not to its N-terminal segment
(lanes 3) (GST/TBP-N). The region of IE62 that interacted most strongly with the basal transcription factors mapped
between aa 234 and 734, well downstream from the only defined activation domain, between aa 9 and 120. A weaker interaction also
occurred with the aa 734-1310 region, suggesting that IE62 possesses
multiple domains that contact basal transcription factors. This
situation contrasts with the results for several other well defined
viral transactivators such as HSV VP16, Ad2 E1A, and EBV Zta, which
bind strongly to the C-terminal basic repeat domain of TBP in
vitro directly through their activation domains (34-37). The HCMV
IE2, however, resembles VZV IE62 in that it binds to TBP strongly
through a region that is independent of its acidic activator domain
(22, 38).

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 7.
An internal VZV IE62 segment that is distinct
from the N-terminal acidic activation domain interacts in
vitro with the basal transcription factors TBP and
TFIIB. Three segments (amino acids 9-410, 234-734, and
734-1310) spanning nearly the full length of IE62 were cloned into an
in vitro transcription/translation vector to generate
[35S]Met-labeled segments of IE62 polypeptide in a rabbit
reticulocyte lysate system. In vitro generated polypeptides
were then incubated with beads coupled to either purified intact human
TFIIB synthesized in E. coli (lanes
2), TBP-N (lanes 3), and TBP-C
(lanes 4) GST fusion proteins. In each case, lane
1 contains one-tenth of the 35S-labeled input protein used
in the binding assay. Position of protein size markers are shown on the
left.
|
|
Nonetheless, the activation domain is critical for transcriptional
activity of the full-length, 1310-amino acid IE62 protein, since the
deletion of 85 amino acids extending from codon 10 to 95 (IE62 AD)
resulted in complete ablation of the transcriptional activity (Fig.
8). Moreover, consistent with the notion
that high affinity binding to both TBP and TFIIB are integral to
transcriptional activity of IE62, an 80-amino acid deletion (aa
416-506) within this region (IE62 416-506) resulted in loss of
transcriptional activity. The expression and intracellular distribution
profiles of both mutants IE62 AD and IE6262 416-506 were identical
to that of full-length, wild-type IE62 (data not shown), and both
mutants competitively inhibited the transcriptional activity of
full-length IE62 as shown in Fig. 8. When 10 µg of IE62 plasmid was
cotransfected with either 5 or 15 µg of IE62 AD, the induction of
the reporter gene was reduced by 70% or 90%, respectively. Similarly,
cotransfection of IE62 plasmid with 5 or 15 µg of IE62 416-506
resulted in 60% or 85% reduction in wild-type IE62-mediated
inducibility, suggesting that the transcriptional-deficient mutants are
still capable of efficiently sequestering cellular components involved
in IE62-mediated transcription. Alternate possibility that the
competitive inhibition may operate at the DNA binding step rather than
at the level of transcription is unlikely since the target construct
pIFNTATA lacks any IE62 binding ATCGTC sites.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 8.
Deletion of the activation domain or part of
the TBP/TFIIB binding region eliminates transcriptional activity of
IE62. An IE62 mutant lacking the activation domain (IE62 AD;
Ref. 19) or an IE62 mutant carrying a deletion in the TBP/TFIIB binding
region (IE62 416-506) were cotransfected with the minimal promoter
pIFNTATA alone or in combination with the full-length IE62 to determine
the importance of these regions for transcriptional activity of IE62 as
well as whether the mutant protein interferes with the transcriptional
activity of native IE62.
|
|
TATA Motifs That Confer Widely Differing Responsiveness to IE62
Display Comparable Levels of Binding to TBP in Vitro--
TFIID is a
high molecular weight, multiprotein complex consisting of TBP, which
specifically recognizes and binds to the TATA boxes of class II gene
promoters (39, 40), and a number of associated factors (TAFs). While
both consensus (TATAAA or TATATAA) and non-consensus TATA elements bind
TFIID (41), it has been suggested that the strength of the interaction
between TFIID and the TATA element correlates with the basal promoter
activity (42). Certain transcriptional activators such as Zta and ICP4
of EBV and HSV, respectively, induce transcription by enhancing or
stabilizing TBP binding to the TATA box. Promoters with TATA elements
that bind TBP suboptimally are usually responsive to these activators but not the promoters with TATA elements that avidly bind TBP (35, 43).
It should be noted, however, that the promoters that responded to IE62
most vigorously, in contrast, possessed apparently consensus or near
consensus TATA motifs, for example TATATATAA, TATATAA, or TATAAAA.
Although only limited information exists in literature as to the
binding affinities of TBP to various TATA motifs (41, 43), two of the
motifs i.e., TATAAAA and TATATATAA, that conferred high
activity in the presence of IE62 have previously been shown to display
apparent dissociation constants (Kd) of 2 × 10 9 M, a value that is among the highest
reported for any TATA motif (41). Since no information exists in the
literature with regard to TBP binding efficiency to other TATA motifs
evaluated in our study, we assessed the ability of each of the motifs
to bind purified recombinant human TBP in an in vitro
electrophoretic mobility shift assay to examine any possible link
between TBP binding to a particular TATA motif and the level of its
responsiveness to IE62. The synthetic oligonucleotides representing
different TATA motifs used as probes in the EMSA are listed in Table I.
An additional probe with TACAAA motif of adenovirus EIIa promoter,
which was originally used by Huang et al. (42) to
demonstrate minimal TBP binding by DNase foot printing assay, was
included in our TBP EMSA to validate our assay conditions. First, the
amount of TBP added to the binding reaction was titrated (20, 8, and 4 ng of TBP) against a fixed amount of each probe (100 fmol) and the fraction of probe that complexed with the added TBP was quantitated. As
shown in Fig. 9 (panel
A), at high concentrations of TBP (20 ng), all TATA motifs
used in the present study displayed significant TBP-binding profiles,
with a difference less than 3-fold between the highest (TATATAA) and
the lowest (TATTTAA). A similar trend was evident at low TBP (4 ng)
concentration as well. The apparent reduction in binding to TATTAAA
probe in Fig. 9 at low TBP concentrations, however, was not
reproducible. In contrast, the probe with a deletion in the TATA motif
( TATA) failed to elicit any TBP binding at all. Having failed to
detect any gross differences in direct binding of TBP to our panel of
TATA motifs, we sought to confirm this observation by a competition
binding assay in which TBP binding to the consensus TATATAA motif was
competed with a 100-fold excess of unlabeled competitor sequence.
Again, as seen in Fig. 9 (panel B), no
significant differences were noted. Thus, no definitive correlation
between the binding of TBP to specific motifs and the extent of
IE62-mediated activation could be discerned. For example, the TTTTTAA
motif from the IE62 promoter and the TATTTAAATT motif from the
glycoprotein C promoter bound TBP strongly, yet the IFN-CAT reporter
genes containing these elements responded weakly to IE62 (13- and
3-fold, respectively). The fact that the most vigorous IE62-mediated
activation was achieved with TATA motifs that display the highest
affinities toward TBP, taken together with the observation that the
motifs that were relatively refractory to IE62 induction still bound
TBP efficiently, therefore, argue in the case of IE62, for a mechanism
that is fundamentally different from what has been proposed for ICP4
and Zta transcriptional activators.

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 9.
Both TATA motifs that are highly responsive
to IE62 as well as TATA motifs that are refractory to IE62 show similar
TBP-binding profiles by EMSA with purified recombinant human TBP.
A, 32P-labeled, double-stranded oligonucleotide
probes representing various TATA motifs evaluated in this study were
used to measure any quantitative differences in TBP binding. TACAAA
motif of adenovirus EIIa promoter which has been previously reported to
be deficient in TBP binding (42) was included as a control. The binding
reactions contained a fixed amount of probe (100 fmol) and 1 µg of
poly(dG-dC) as nonspecific DNA. For each probe, three different amounts
of TBP (20, 8, and 4 ng) were tested along with a control reaction
without any added TBP ( ). The amount of probe that complexed with TBP
was determined by PhosphorImager scanning and is given as a percentage
below the corresponding amount of TBP in the reaction. B,
binding of TBP to consensus TATATAA motif was competed with 100-fold
excess of unlabeled competing DNA sequences. In the competition
experiments, 100 fmol of 32P-labeled TATATAA probe was used
with 5 ng of TBP.
|
|
 |
DISCUSSION |
The VZV IE62 transcriptional regulatory protein possesses an
unusual, TATA motif-dependent mechanism by which it
mediates activation of simple, minimal eukaryotic promoter targets.
Large variations in the levels of activation of various promoters
tested were evident according to which particular TATA sequence was
present in them. The one other viral transactivator known to activate minimal promoters via a TATA-dependent mechanism is the
adenovirus E1A protein. E1A, however, exhibits an absolute requirement
for one specific motif, namely TATAA, for transactivation to occur (44,
45). Similarly, the muscle-specific enhancer of the myoglobin gene has
been shown to function in the presence of its cognate TATAAAA motif,
but not with the TATTTAT element from the SV40 promoter (46). The
activity of cellular transcription factor ATF has also been shown to be
sensitive to TATA motif changes (47).
The results presented here argue that VZV IE62 acts primarily by a
mechanism that does not involve or require upstream targeting sites or
factors and that it is unusually sensitive to the nature of the
specific TATA motifs present. Such a mechanism differs significantly
from the strong and relatively specific requirements for upstream
targeting by other well studied viral and eukaryotic transactivators.
For example, HSV VP16, Ad2 E1A, and EBV Zta interact in
vitro with TBP and TFIIB (and TAFs) through their activation domains, whereas VZV IE62 interacts with TBP and TFIIB through a
region(s) that is distinct from its activation domain. VP16 and E1A
principally target upstream sites through indirect protein:protein interactions with Oct-1, and Rb:E2F or ATF-2, respectively, whereas Zta
binds directly to upstream ZRE motifs and acts as a bridge between
these sites and TFIID, resulting in TFIIA-dependent
stabilization of TBP binding to weak TATA motifs such as GATAAA (35,
48). The HCMV IE1/IE2 transactivators are also clearly different from IE62 in that they target promoters lacking TATA motifs. Both HCMV IE2
and HSV ICP4 also interact with TBP and TFIIB in vitro
through regions that are distinct from their activation domains (22, 49). Although ICP4 represses upstream activator-mediated transcription including that of Sp-I, presumably through formation of a tripartite complex consisting of TBP, TFIIB, and ICP4 itself, the activation induced by ICP4 correlates with its interaction with TFIID perhaps via
TAF250 requiring the C terminus of ICP4 (49-51). IE62 also differs
from ICP4 in possessing a powerful N-terminal activator domain that
functions effectively in a GAL4 fusion protein in comparison to a weak,
promoter-specific modular activation domain recently reported in ICP4
(19, 52). In addition, our previous work (13) showing that the IE62
promoter positively responds to both ICP4 and IE62 indicates that
the promoter elements required for activation by VZV IE62 and HSV ICP4
are different, a finding that was confirmed in the present study by the
absence of activation of pIFNTATA by ICP4 (Fig. 1). While the TATA box
is dispensable for ICP4-mediated activation of promoters, it does
appear to influence the magnitude of activation such that it activates
promoters with TATA boxes with low affinity for TBP more efficiently
than those with high affinity for TBP (43). The related pseudorabies
virus IE180 protein also has been shown to activate suboptimally
utilized promoters and contains an N-terminal activator domain (53), but VZV IE62 differs from it in that the TATA motif alone is a sufficient cis-acting element to mediate transactivation by
IE62, but not by IE180 (54).
Simon et al. (44) showed that, despite similar binding to
TFIID and in vitro functionality for the Ad MLP TATAAAA
motif and the SV40 TATTTAT motif, only the former responds to E1A
transactivation. In this regard, VZV IE62 resembles E1A, except that a
much broader pattern of TATA motifs are recognized (i.e.
weak or non-responsive for TTTTTAA and TATTTAAATT; moderately
responsive for TATTTAA and TATTAAA; highly responsive for TATAAAA,
TATATAA, and TATATATAA).
The yeast GCN4 and GAL4 proteins (both acidic transactivators) also
differ from IE62 in their ability to interact functionally with certain
TATA motifs. In fact, this finding was originally used to invoke models
for either two different TATA proteins or two types of acidic activator
domains with different selectivities (55). All evidence at present
however, points to there being only one universal TBP species.
X-ray crystallographic and biochemical analyses indicate that TBP binds
directionally to DNA as a monomer, but it exists in unbound form in
solution as a stable homodimer (56-59). Unlike most DNA-binding
transcription factors, TBP binds DNA in the minor groove in a two-step
process (60) with relatively low discrimination of specific base pairs.
In so doing TBP bends and conformationally distorts the helix, while
undergoing conformational changes itself (56, 60, 61). Dissociation of
unbound dimers and of DNA-bound monomers of TBP are relatively slow
processes compared with the rate of association of monomeric TBP with
DNA (62). Stabilization of TBP binding to either TATA elements by TFIIA
(and TFIIB) (48, 63, 64), or to nonspecific DNA sequences by SP-1 and
other upstream or Inr protein interactions in the case of TATA less promoters, are thought to be key rate-limiting steps in the formation and processing of initiation complexes. Indeed, binding between TBP and
TFIIA has been found recently to be an essential step in
transactivation by yeast acidic activator protein domains (9). TFIIA
binding also appears to alter the conformation of bound TBP.
Our EMSA results (Fig. 9) indicate that all of the TATA like motifs
studied here (both consensus and non-consensus alike) exhibit similar
affinity for TBP. These results closely resemble those obtained by Hahn
et al. (41) for purified yeast holo-TFIID on larger DNA
fragments by DNase I footprinting of a number of consensus and
non-consensus TATA motifs. It seems, therefore, unlikely that either
TBP or TBP-TAF complexes directly discriminate between different types
of TATA motifs examined in this study. The highly uniform levels of
transactivation of both our GAL4-responsive and VP16-responsive
promoter panels containing different TATA motifs also suggest that
neither basal levels (as supported by CAT activity and RNase protection
data) nor upstream-element-mediated activation are influenced by
particular TATA motifs in the panel tested. However, it could also be
argued that the TATA motifs themselves become irrelevant when multiple
upstream response elements are present so as to offset TATA box
requirement for transcription by compensatory effects of other
transcription factors binding to these upstream elements.
Considering the inability of the TBP protein to discriminate
significantly among the different TATA motif oligonucleotides used in
our in vitro EMSA binding studies, it appears unlikely that
TBP interactions with the TATA motif alone can directly account for the
specificity of IE62 transactivation. Similarly, neither the GAL4 fusion
proteins containing the IE62 N-terminal acidic activation domain, nor
Oct-1/TAATGARAT-targeted intact VP16, could discriminate functionally
between the different TATA motifs. It also appears unlikely that TATA
specificity is attained directly through the properties of any
particular subclass of general factors or acidic activator domains.
Instead, these properties reside within the core non-activator domain
segment of IE62 itself as indicated by our domain-swap experiment (Fig.
6). Although IE62 is also a sequence-specific DNA-binding protein, it
preferentially recognizes consensus motifs containing ATCGTC elements,
and it neither bound to the TATATAA oligonucleotide probes by EMSA in our work nor protected TATA motif regions in previous foot printing analyses (65). The homologous HSV ICP4 protein has also been shown
previously by EMSA and DNA footprinting assays to form a cooperative
tripartite DNA-bound complex with TFIIB and TBP (or holo-TFIID), but
only on a target DNA probe containing both a TATA motif and an ICP4
binding site (49). Therefore, we are left to conclude that a direct
interaction between IE62 with TBP, most likely as a complex with TFIIA
or TFIIB or with a specific TAF or co-activator (66), can recognize
subtle conformational or stability differences (at either the DNA or
protein level) that are imparted by particular base pair arrangements
within the TATA motifs, and that these altered interactions manifest themselves as different levels of transactivation.
Emerging evidence from in vivo studies in yeast with
yTAFII145 implicate distinctions among different core
promoters (67). Our work reinforces this notion that there is a level
of discrimination between different types of TATA motifs (particularly
for transactivation) that is not currently understood. The VZV IE62
protein is particularly intriguing in this regard, because the effect
occurs in the absence of upstream targeting motifs, and certain
non-consensus TATA motifs, particularly TATTAAA, are sufficient to
mediate activation. In addition, the ability of VZV IE62 to bind to TBP
in vitro through an additional internal non-activator domain
suggests that it combines the properties expected of both a
transactivator and an adapter or co-activating factor.
 |
ACKNOWLEDGEMENTS |
I thank Thomas Waldmann for support and
encouragement and John Hay, Stephen Straus, Gary Hayward, Joseph Mosca,
and Pin-Yu Perera for stimulating discussions, helpful suggestions, and
for critical assessment of the manuscript.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health NIAID Intramural Project AI 00687, of which L. P. P was the principal investigator.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Bldg. 10, Rm. 4B40,
Metabolism Branch, Division of Clinical Sciences, 10 Center Dr., MSC
1374, NCI, National Institutes of Health, Bethesda, MD 20892-1374. Tel.: 301-435-7518; Fax: 301-496-9956; E-mail:
lperera@niaid.nih.gov.
 |
ABBREVIATIONS |
The abbreviations used are:
VZV, varicella
zoster virus;
HSV, herpes simplex virus;
EBV, Epstein-Barr virus;
CMV, cytomegalovirus;
HCMV, human cytomegalovirus;
TBP, TATA box-binding
protein;
TF, transcription factor;
TAF, TATA-associated factor;
IFN, interferon;
aa, amino acid(s);
bp, base pair(s);
nt, nucleotide(s);
GST, glutathione S-transferase;
CAT, chloramphenicol
acetyltransferase;
TK, thymidine kinase;
PIPES, 1,4-piperazinediethanesulfonic acid;
Inr, initiator;
MIE, major
immediate-early.
 |
REFERENCES |
| 1.
|
Davison, A. J,
and Scott, J. E.
(1986)
J. Gen. Virol.
67,
2279-2286[Abstract/Free Full Text]
|
| 2.
|
Inchauspe, G.,
Nagpal, S.,
and Ostrove, J. M.
(1989)
Virology
173,
700-709[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Perera, L. P.,
Mosca, J. D.,
Ruyechan, W. T.,
and Hay, J.
(1992)
J. Virol.
66,
5298-5304[Abstract/Free Full Text]
|
| 4.
|
Buratowski, S.
(1994)
Cell
77,
1-3[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Goodrich, I. A.,
Cutler, G.,
and Tjian, R.
(1996)
Cell
84,
825-830[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Hernandez, N.
(1993)
Genes Dev.
7,
1291-1308[Free Full Text]
|
| 7.
|
Pugh, B. F.,
and Tjian, R.
(1992)
J. Biol. Chem.
267,
679-682[Free Full Text]
|
| 8.
|
Sharp, P. A.
(1992)
Cell
68,
819-821[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Stargell, L. A.,
and Struhl, K.
(1995)
Science
269,
75-78[Abstract/Free Full Text]
|
| 10.
|
Tjian, R.,
and Maniatis, T.
(1994)
Cell
77,
5-8[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Zaman, Z.,
Ansari, A. Z.,
Gaudrea, L.,
Nevado, J.,
and Ptashne, M.
(1998)
Cold Spring Harbor Symp. Quant Biol.
63,
167-171[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Berk, A. J.
(1999)
Curr. Opin. Cell Biol.
11,
330-335[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Perera, L. P.,
Mosca, J. D.,
Sadeghi-Zadeh, M.,
Ruyechan, W. T.,
and Hay, J.
(1992)
Virology
191,
346-354[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Kelley, K. A.,
and Pitha, P. M.
(1985)
Nucleic Acids Res.
13,
825-839[Abstract/Free Full Text]
|
| 15.
|
Lillie, J. W.,
and Green, M. R.
(1989)
Nature
338,
39-44[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Yoshimura, M.,
and Oka, T.
(1989)
Gene (Amst.)
78,
267-275[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
ApRhys, C. M.,
Ciufo, D. M.,
O'Neill, E. A.,
Kelly, T. J.,
and Hayward, G. S.
(1989)
J. Virol.
63,
2798-2812[Abstract/Free Full Text]
|
| 18.
|
Pizzorno, M. C.,
O'Hare, P.,
Sha, L.,
LaFemina, R. L.,
and Hayward, G. S.
(1988)
J. Virol.
62,
1167-1179[Abstract/Free Full Text]
|
| 19.
|
Perera, L. P.,
Mosca, J. D.,
Ruyechan, W. T.,
Hayward, G. S.,
Straus, S. E.,
and Hay, J.
(1993)
J. Virol.
67,
4474-4483[Abstract/Free Full Text]
|
| 20.
|
Nabel, G. J.,
Rice, S. A.,
Knipe, D. M.,
and Baltimore, D.
(1988)
Science
239,
1299-1302[Abstract/Free Full Text]
|
| 21.
|
Chang, Y. N.,
Dong, D.,
Hayward, G. S.,
and Hayward, S. D.
(1990)
J. Virol.
64,
3358-3369[Abstract/Free Full Text]
|
| 22.
|
Caswell, R.,
Hagemeier, C.,
Chiou, C. J.,
Hayward, G. S.,
Kouzarides, T.,
and Sinclair, J.
(1993)
J. Gen. Virol.
74,
2691-2698[Abstract/Free Full Text]
|
| 23.
|
Lai, J. S.,
and Herr, W.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
6958-6962[Abstract/Free Full Text]
|
| 24.
|
Moffat, J. F.,
Stein, M. D.,
Kaneshima, H.,
and Arvin, A. M.
(1995)
J. Virol.
69,
5236-53442[Abstract]
|
| 25.
|
Hagemeier, C.,
Walker, S.,
Caswell, R.,
Kouzarides, T.,
and Sinclair, J.
(1992)
J. Virol.
66,
4452-4456[Abstract/Free Full Text]
|
| 26.
|
Starr, B. D.,
Hoopes, B. C.,
and Hawley, D. K.
(1995)
J. Mol. Biol.
250,
434-446[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Wobbe, C. R.,
and Struhl, K.
(1990)
Mol. Cell. Biol.
10,
3859-3867[Abstract/Free Full Text]
|
| 28.
|
Ge, H.,
and Roeder, R. G.
(1994)
Cell
78,
513-523[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Kretzschmar, M.,
Kaiser, K.,
Lottspeich, F.,
and Meisterernst, M.
(1994)
Cell
78,
525-534[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Cohen, J. I.,
Heffel, D.,
and Seidel, K.
(1993)
J. Virol.
67,
4246-4251[Abstract/Free Full Text]
|
| 31.
|
Sadowski, I.,
Ma, J.,
Triezenberg, S.,
and Ptashne, M.
(1988)
Nature
335,
563-564[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
O'Hare, P.,
and Goding, C. R.
(1988)
Cell
52,
435-445[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Stern, S.,
Tanaka, M.,
and Herr, W.
(1989)
Nature
341,
624-630[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Ingles, C. J.,
Shales, M.,
Cress, W. D.,
Triezenberg, S. J.,
and Greenblatt, J.
(1991)
Nature
351,
588-590[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Lieberman, P. M.,
and Berk, A. J.
(1991)
Genes Dev.
5,
2441-2454[Abstract/Free Full Text]
|
| 36.
|
Lin, Y. S.,
and Green, M. R.
(1991)
Cell
64,
971-981[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Lin, Y. S.,
Carey, M.,
Ptashne, M.,
and Green, M. R.
(1991)
Nature
353,
569-571[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Pizzorno, M. C.,
Mullen, M. A.,
Chang, Y. N.,
and Hayward, G. S.
(1991)
J. Virol.
65,
3839-3852[Abstract/Free Full Text]
|
| 39.
|
Hoffman, A.,
Sinn, R.,
Yamamoto, T.,
Wang, J.,
Roy, A.,
Horikoshi, M.,
and Roeder, R. G.
(1990)
Nature
346,
387-390[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Peterson, M. G.,
Tanese, N.,
Pugh, B. F.,
and Tjian, R.
(1990)
Science
248,
1625-1630[Abstract/Free Full Text]
|
| 41.
|
Hahn, S.,
Buratowski, S.,
Sharp, P. A.,
and Guarente, L.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
5718-5722[Abstract/Free Full Text]
|
| 42.
|
Huang, D. H.,
Horikoshi, M.,
and Roeder, R. G.
(1988)
J. Biol. Chem.
263,
12596-12601[Abstract/Free Full Text]
|
| 43.
|
Cook, W. J.,
Gu, B.,
DeLuca, N. A.,
Moynihan, E. B.,
and Coen, D. M.
(1995)
Mol. Cell. Biol.
15,
4998-5006[Abstract]
|
| 44.
|
Simon, M. C.,
Fisch, T. M.,
Benecke, B. J.,
Nevins, J. R.,
and Heintz, N.
(1988)
Cell
52,
723-729[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Wu, L., D.,
Rosser, S.,
Schmidt, M. C.,
and Berk, A.
(1987)
Nature
326,
512-515[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Wefald, F. C.,
Devlin, B. H.,
and Williams, R. A.
(1990)
Nature
344,
260-262[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Taylor, I. C. A.,
and Kingston, R. E.
(1990)
Mol. Cell. Biol.
10,
165-175[Abstract/Free Full Text]
|
| 48.
|
Lieberman, P. M.,
and Berk, A. J.
(1994)
Genes Dev.
8,
995-1006[Abstract/Free Full Text]
|
| 49.
|
Smith, C. A.,
Bates, P.,
Rivera-Gonzalez, R.,
Gu, B.,
and DeLuca, N. A.
(1993)
J. Virol.
67,
4676-4687[Abstract/Free Full Text]
|
| 50.
|
Carrozza, M. J.,
and DeLuca, N. A.
(1996)
Mol. Cell. Biol.
16,
3085-3093[Abstract]
|
| 51.
|
Gu, B.,
Kuddus, R.,
and DeLuca, N. A.
(1995)
Mol. Cell. Biol.
15,
3618-3626[Abstract]
|
| 52.
|
Xiao, W.,
Pizer, L. I.,
and Wilcox, K. W.
(1997)
J. Virol.
71,
1757-1765[Abstract]
|
| 53.
|
Martin, K. J.,
Lillie, J. W.,
and Green, M. R.
(1991)
Genes Dev.
4,
2376-2382[Abstract/Free Full Text]
|
| 54.
|
Rusconi, T. M.,
and Schaffner, W.
(1990)
J. Mol. Biol.
215,
301-311[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Harbury, P. A.,
and Struhl, K.
(1989)
Mol. Cell. Biol.
9,
5298-5304[Abstract/Free Full Text]
|
| 56.
|
Kim, J. L.,
and Burley, S. K.
(1994)
Nat. Struct. Biol.
1,
638-653[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Burley, S. K.
(1998)
Cold Spring Harbor Symp. Quant. Biol.
63,
33-40[CrossRef][Medline]
[Order article via Infotrieve]
|
| 58.
|
Arndt, K. M.,
Wobbe, C. R.,
Ricupero-Hovasse, S.,
Struhl, K.,
and Winston, F.
(1994)
Mol. Cell. Biol.
14,
3719-3728[Abstract/Free Full Text]
|
| 59.
|
Coleman, R. A.,
Taggart, A. K.,
Benjamin, L. R.,
and Pugh, B. F.
(1995)
J. Biol. Chem.
270,
13842-13849[Abstract/Free Full Text]
|
| 60.
|
Hoopes, B. C.,
LeBlanc, J. F.,
and Hawley, D. K.
(1992)
J. Biol. Chem.
267,
11539-11547[Abstract/Free Full Text]
|
| 61.
|
Giese, K.,
Cox, J.,
and Grosschedl, R.
(1992)
Cell
69,
185-195[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Coleman, R. A.,
and Pugh, B. F.
(1995)
J. Biol. Chem.
270,
13850-13859[Abstract/Free Full Text]
|
| 63.
|
Choy, B.,
and Green, M. R.
(1993)
Nature
366,
531-536[CrossRef][Medline]
[Order article via Infotrieve]
|
| 64.
|
Lee, D. K.,
DeJong, J.,
Hashimoto, S.,
Horikoshi, M.,
and Roeder, R. G.
(1992)
Mol. Cell. Biol.
12,
5189-5196[Abstract/Free Full Text]
|
| 65.
|
Tyler, J. K.,
and Everett, R. D.
(1993)
Nucleic Acids Res.
21,
513-522[Abstract/Free Full Text]
|
| 66.
|
Boyer, T. G.,
and Berk, A. J.
(1993)
Genes Dev.
7,
1810-1823[Abstract/Free Full Text]
|
| 67.
|
Shen, W.-C.,
Apone, L. M.,
Virbasuis, C.-M. A.,
Li, X.-Y.,
Monslave, M.,
and Green, M. R.
(1998)
Cold Spring Harbor Symp. Quant Biol.
63,
219-227[CrossRef][Medline]
[Order article via Infotrieve]
|
| 68.
|
Marmorstein, R.,
Carey, M.,
Ptashne, M.,
and Harrison, S. C.
(1992)
Nature
356,
408-414[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Wang, M. Sommer, J. Rajamani, and A. M. Arvin
Regulation of the ORF61 Promoter and ORF61 Functions in Varicella-Zoster Virus Replication and Pathogenesis
J. Virol.,
August 1, 2009;
83(15):
7560 - 7572.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yang, J. Hay, and W. T. Ruyechan
Varicella-Zoster Virus IE62 Protein Utilizes the Human Mediator Complex in Promoter Activation
J. Virol.,
December 15, 2008;
82(24):
12154 - 12163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Kobayashi, Y. Watanabe, K. Akasaka, and T. Kokubo
Real-time monitoring of functional interactions between upstream and core promoter sequences in living cells of sea urchin embryos
Nucleic Acids Res.,
July 10, 2007;
(2007)
gkm519v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Narayanan, W. T. Ruyechan, and T. M. Kristie
The coactivator host cell factor-1 mediates Set1 and MLL1 H3K4 trimethylation at herpesvirus immediate early promoters for initiation of infection
PNAS,
June 26, 2007;
104(26):
10835 - 10840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Che, B. Berarducci, M. Sommer, W. T. Ruyechan, and A. M. Arvin
The Ubiquitous Cellular Transcriptional Factor USF Targets the Varicella-Zoster Virus Open Reading Frame 10 Promoter and Determines Virulence in Human Skin Xenografts in SCIDhu Mice In Vivo
J. Virol.,
April 1, 2007;
81(7):
3229 - 3239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kiran, S. A. Ansari, R. Srivastava, N. Lodhi, C. P. Chaturvedi, S. V. Sawant, and R. Tuli
The TATA-Box Sequence in the Basal Promoter Contributes to Determining Light-Dependent Gene Expression in Plants
Plant Physiology,
September 1, 2006;
142(1):
364 - 376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yang, H. Peng, J. Hay, and W. T. Ruyechan
Promoter Activation by the Varicella-Zoster Virus Major Transactivator IE62 and the Cellular Transcription Factor USF.
J. Virol.,
August 1, 2006;
80(15):
7339 - 7353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Narayanan, M. L. Nogueira, W. T. Ruyechan, and T. M. Kristie
Combinatorial Transcription of Herpes Simplex Virus and Varicella Zoster Virus Immediate Early Genes Is Strictly Determined by the Cellular Coactivator HCF-1
J. Biol. Chem.,
January 14, 2005;
280(2):
1369 - 1375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Rahaus, N. Desloges, M. Yang, W. T. Ruyechan, and M. H. Wolff
Transcription factor USF, expressed during the entire phase of varicella-zoster virus infection, interacts physically with the major viral transactivator IE62 and plays a significant role in virus replication
J. Gen. Virol.,
November 1, 2003;
84(11):
2957 - 2967.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Peng, H. He, J. Hay, and W. T. Ruyechan
Interaction between the Varicella Zoster Virus IE62 Major Transactivator and Cellular Transcription Factor Sp1
J. Biol. Chem.,
September 26, 2003;
278(39):
38068 - 38075.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Johannessen, P. A. Olsen, R. Sorensen, B. Johansen, O. M. Seternes, and U. Moens
A role of the TATA box and the general co-activator hTAFII130/135 in promoter-specific trans-activation by simian virus 40 small t antigen
J. Gen. Virol.,
July 1, 2003;
84(7):
1887 - 1897.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Gomi, H. Sunamachi, Y. Mori, K. Nagaike, M. Takahashi, and K. Yamanishi
Comparison of the Complete DNA Sequences of the Oka Varicella Vaccine and Its Parental Virus
J. Virol.,
October 11, 2002;
76(22):
11447 - 11459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Sommer, E. Zagha, O. K. Serrano, C. C. Ku, L. Zerboni, A. Baiker, R. Santos, M. Spengler, J. Lynch, C. Grose, et al.
Mutational Analysis of the Repeated Open Reading Frames, ORFs 63 and 70 and ORFs 64 and 69, of Varicella-Zoster Virus
J. Virol.,
September 1, 2001;
75(17):
8224 - 8239.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|