|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 275, Issue 1, 514-520, January 7, 2000
From ICOS Corp., Bothell, Washington 98021 and
§ Gryphon Sciences,
South San Francisco, California 94080
Mammalian chitinase, a chitinolytic enzyme
expressed by macrophages, has been detected in atherosclerotic plaques
and is elevated in blood and tissues of guinea pigs infected with
Aspergillus. Its normal physiological function is unknown.
To understand how the enzyme interacts with its substrate, we have
characterized the chitin-binding domain. The C-terminal 49 amino acids
make up the minimal sequence required for chitin binding activity. The
absence of this domain does not affect the ability of the enzyme to
hydrolyze the soluble substrate, triacetylchitotriose, but abolishes
hydrolysis of insoluble chitin. Within the minimal chitin-binding
domain are six cysteines; mutation of any one of these to serine
results in complete loss of chitin binding activity. Analysis of
purified recombinant chitin-binding domain revealed the presence of
three disulfide linkages. The recombinant domain binds specifically to
chitin but does not bind chitosan, cellulose, xylan, Chitin, a The physiological purpose for a mammalian chitinase remains unproven.
Because chitin is an integral component of fungal cell walls, a
defensive function has been suggested for the enzyme (9, 12). This has
been supported by the observations that chitinase levels are strikingly
elevated in both serum and tissues of guinea pigs infected with
Aspergillus fumigatus (13, 14). Another possibility is
suggested by the observation that a distinct subset of lipid-laden
macrophages in atherosclerotic lesions expresses chitinase (15). The
authors speculate that the enzyme, along with other macrophage gene
products, may modulate the extracellular matrix in the vessel wall and
thus affect the downstream tissue remodeling events associated with atherogenesis.
Our laboratory has a long-standing interest in macrophage biology. As
part of an effort to analyze gene expression patterns in macrophages,
we determined the nucleotide sequences of nearly 3500 random cDNAs
from monocyte-derived macrophages (16). Interestingly, the chitinase
cDNA was the sixth most common transcript found, appearing at a
frequency of 0.5%. The only transcripts appearing more frequently were
those of the ferritin heavy and light chains, collagenase, The possibility of distinct autonomous domains in human chitinase
provides an opportunity to dissect out the functional constraints that
define the enzyme. In this report, we focus on the chitin-binding domain, describing structural features required for activity and the
interaction of the domain with the fungal cell wall.
Generation of Expression Plasmids--
A full-length chitinase
clone was isolated from a human macrophage cDNA plasmid library
(16). This clone was used as a template for generation of all other
expression constructs. A truncated form in which the region encoding
the C-terminal 72 amino acids is deleted was generated by the
polymerase chain reaction
(PCR)1 using primers anchored
on the translation initiation codon
(5'-CGCAAGCTTGAGAGCTCCGTTCCGCCACATGGTGCGGTCTGTGGCCTGGG) and
terminating on the codon encoding Thr-394
(5'-GACTCTAGACTAGGTGCCTGAAGGCAAGTATGG). This PCR product was
digested with HindIII and XbaI and cloned into
the corresponding sites of the mammalian expression plasmid, pcDNA3
(Invitrogen, Carlsbad, CA).
To generate secreted alkaline phosphatase (SEAP)-chitin-binding domain
fusion proteins, PCR was used to obtain both the SEAP and the
chitin-binding domain components. The SEAP component was amplified from
the pSEAP2-Control plasmid (CLONTECH, Palo Alto, CA) using primers that introduced a HindIII site to the 5'
end (5'-GCTTAAGCTTGCTGCAGCCTGCCGCTGAGCTGCATCATGCTACTACTACTGCTGCTGCTGGGCCTG) and a multiple cloning region to the 3' end
(5'-AACAGGGCCCTTAATTAATTAGGTACCTGCGCGGCCGCAGCATCGATTGCTCTAGAAGCGATATCAGCGAATTCTGTCTGCTCGAAGCGGCCGGCCGCCCCGACTCGAGAGTAAC). This PCR-generated cDNA was cloned into the HindIII and
ApaI sites of pcDNA3 to generate a vector called
pcDNA-SEAP. A series of chitin-binding domain truncates was also
generated by PCR, and they were cloned into the EcoRI and
XbaI sites of the multiple cloning region of pcDNA-SEAP,
thus generating constructs encoding SEAP with chitin-binding domain
derivatives fused to its C terminus. The following PCR primers were
used to generate the chitin-binding domain truncates. 395-466: sense,
5'-TATAGAATTCCCAGAGCTTGAAGTTCCAAAACCAG; antisense,
5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG. 368-452: sense, 5'-TATAGAATTCTTCTCCTGCAACCAGGGCCGATAC; antisense,
5'-CACATCTAGATTATGTCGGGCAGCTTTGCTGGAACAG. 395-452: sense,
5'-TATAGAATTCCCAGAGCTTGAAGTTCCAAAACCAG; antisense, 5'-CACATCTAGATTATGTCGGGCAGCTTTGCTGGAACAG. 413-452: sense,
5'-TATAGAATTCAGCCCTGGACAAGACACGTTCTGCC; antisense,
5'-CACATCTAGATTATGTCGGGCAGCTTTGCTGGAACAG. 413-464: sense,
5'-TATAGAATTCAGCCCTGGACAAGACACGTTCTGCC; antisense,
5'-AACATCTAGATTAGGTGCAGCATTTGCAGGAGTTGCTGAAC. 368-466: sense,
5'-TATAGAATTCTTCTCCTGCAACCAGGGCCGATAC; antisense, 5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG. 416-466: sense,
5'-CTCTGAATTCCAAGACACGTTCTGCCAGGGCAAAGCT; antisense,
5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG. 416-466: sense, 5'-CTCTGAATTCCAAGACACGTTCTGCCAGGGCAAAGCT; antisense,
5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG. 418-466: sense,
5'-ATATGAATTCACGTTCTGCCAGGGCAAAGCTGATG; antisense, 5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG. 421-466: sense,
5'-AGAGGAATTCCAGGGCAAAGCTGATGGGCTCTATC; antisense,
5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG. 430-466: sense, 5'-ACAGGAATTCAATCCTCGGGAACGGTCCAGCTTCTAC; antisense,
5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG.
Point mutations to convert cysteine residues to serine were
generated with the PCR using primers that extended from the sequence encoding residue 413 at the 5' end through the targeted cysteine (for
Cys-420 and Cys-440) or the sequence encoding the stop codon at the 3'
end through the targeted cysteine (for Cys-450, Cys-460, Cys-462, and
Cys-463). The following PCR primers were used. C420S: sense,
5'-AGAGGAATTCAGCCCTGGACAAGACACGTTCAGCC; antisense,
5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG. C440S: sense,
5'-AGAGGAATTCAGCCCTGGACAAGACACGTTCTGCCAGGGCAAAGCTGATGGGCTCTATCCCAATCCTCGGGAACGGTCCAGCTTCTACAGCAGTGCA; antisense, 5'-AGAGTCTAGATCAATTCCAGGTGCAGCATTTGCAGG. C450S: sense, 5'-TATAGAATTCAGCCCTGGACAAGACACGTTCTGCC; antisense,
5'-TGCTTCTAGATTAATTCCAGGTGCAGCATTTGCAGGAGTTGCTGAACACCAGGCCTGTCGGGCTGCT. C460S: sense, 5'-TATAGAATTCAGCCCTGGACAAGACACGTTCTGCC; antisense, 5'-TGCTTCTAGATTAATTCCAGGTGCAGCATTTGCTGG. C462S: sense,
5'-TATAGAATTCAGCCCTGGACAAGACACGTTCTGCC; antisense,
5'-TGCTTCTAGATTAATTCCAGGTGCAGCTTTTGCAGG. C463S: sense, 5'-TATAGAATTCAGCCCTGGACAAGACACGTTCTGCC; antisense,
5'-TGCTTCTAGATTAATTCCAGGTGCTGCATTTGCAGG. The resulting PCR
products were digested with EcoRI and XbaI and cloned into the corresponding sites of the multiple cloning region of
pcDNA-SEAP to generate fusion expression constructs. All PCRs contained 100 ng of template cDNA, 1 µg of each primer, 0.125 mM of each dNTP, 10 mM Tris-HCl, pH 8.4, 50 mM MgCl2, and 2.5 units of Taq
polymerase. An initial denaturation step of 94 °C for 4 min was
followed by 30 cycles of amplification as follows: 1 min at 94 °C, 1 min at 60 °C, and 2 min at 72 °C. Nucleotide sequences of all
PCR-generated constructs were determined by dideoxy nucleotide
sequencing to ensure the lack of errors.
Mammalian Expression--
Expression plasmids were introduced
into COS-7 cells grown to 50% confluency in 60-mm tissue culture
dishes by incubation in Dulbecco's modified Eagle's medium (Life
Technologies, Inc.) containing 0.5 mg/ml DEAE dextran, 0.1 mM chloroquine, and 10 µg of plasmid DNA for 1.5 h.
The cells then were treated with 10% dimethyl sulfoxide in
phosphate-buffered saline (PBS) for 45 s, washed with serum-free
medium, and incubated in Dulbecco's modified Eagle's medium
supplemented with 1 mM L-glutamine, 100 units/ml penicillin, 100 µg/ml streptomycin, and 10% fetal calf serum. After 4 days, culture media were harvested, and nonadherent cells were removed by centrifugation.
Yeast Expression--
To produce recombinant chitin-binding
domain, an expression construct was designed in which the nucleotides
encoding the C-terminal 54 amino acids of the chitinase were fused to
the 3' terminus of sequence encoding the Saccharomyces
cerevisiae
A selected clone was grown overnight at 30 °C in 10 ml of synthetic
complete (BioWhittaker)-leu-ura medium containing 2% glucose. One ml
of this culture was seeded into 100 ml of the same medium and incubated
at 30 °C with shaking. After 19 h, 65 ml of the culture was
seeded into 1.2 liters of medium in a 3-liter fermentor. The
fermentation was carried out at 30 °C, pH 5.5, with 1200 rpm agitation and an airflow rate of 3 liters/min. After 93 h, cells were harvested by centrifugation. The supernatant was filtered through
a prefilter and a 0.2 µm filter and stored at Purification of Recombinant Chitin-binding Domain--
The
recombinant chitin-binding domain was purified by passing filtered
culture medium through a chitin bead column. A 25-ml bed volume of
chitin beads (New England Biolabs, Beverly, MA) was prepared in a 50-ml
column (Amicon, Beverly, MA), prewashed with 250 ml of 1% SDS and
equilibrated with 250 ml of Buffer A (20 mM Tris, pH 8, 500 mM NaCl) at a flow rate of 2 ml/min. Clarified medium was
passed through the chitin bead column at a rate of 1 ml/min. Following
a 250-ml wash with Buffer A, protein was eluted from the beads with
50% acetonitrile, 0.1% trifluoroactetate and collected into 4-ml
fractions. Acetonitrile was evaporated from the eluate by vacuum
centrifugation. Analysis of the purified protein by matrix-assisted
laser desorption ionization time-of-flight mass spectrometry showed a
single peak with molecular mass of 5911.9 Da, a value that corresponds
favorably to the predicted mass of 5909.6 Da. Chitin binding activity
was confirmed by readsorbing the purified protein to chitin beads and
eluting with 1% SDS.
Antibodies--
Monoclonal antibodies were generated using
standard protocols (20). Hybridomas generated from BALB/c mice
immunized with recombinant full-length chitinase were screened for
chitinase-specific antibodies by enzyme-linked immunosorbent assay.
Antibody preparations from positive clones were further tested for
specificity using Western analysis of complex tissue culture media from
cells expressing recombinant chitinase. Binding sites of specific
antibodies were mapped to either the N-terminal three-fourths of the
molecule or the chitin-binding domain by Western blotting of
recombinant truncated chitinase or chitin-binding domain.
Alkaline Phosphatase Activity Assay--
Tissue culture media
from cells transfected with the SEAP-chitin-binding domain fusion
expression constructs were assayed for alkaline phosphatase activity as
described previously (21, 22). Briefly, samples were incubated at
65 °C for 10 min to inactivate serum-derived phosphatases. Serial
10-fold dilutions were mixed with an equal volume of a 2× solution
containing 2 M diethanolamine, pH 9.8, 1 mM
MgCl2, 1 mg/ml bovine serum albumin, 20 mM
L-homoarginine, and 24 mM
p-nitrophenylphosphate. After a 30-min incubation at
37 °C, substrate metabolism was assessed by determination of the
A410.
Substrate Binding Activity Assays--
To determine chitin
binding activity of COS-7 cell-produced fusion proteins, crab shell
chitin (Sigma) was ground to a fine powder using a mortar and pestle,
washed three times with Buffer A, and resuspended to 100 mg/ml. One
hundred µl of the chitin suspension was added to 1 ml of transfected
COS-7 cell medium, and the mixture was incubated 4 h at 4 °C
with continuous end-over-end mixing. Following incubation, the chitin
was pelleted by centrifugation (5 min at 12,000 × g).
Supernatants were either assayed for SEAP activity (in the case of SEAP
fusion proteins) or evaluated by polyacrylamide gel electrophoresis
followed by Western blotting. For Western blotting, equivalent volumes
of supernatant were supplemented with Laemmli buffer and 50 mM dithiothreitol, boiled, and electrophoresed through a
12% polyacrylamide gel (Novex, San Diego, CA). Contents of the gel
were subsequently transferred to polyvinylidene difluoride membrane
(Novex) and detected using a monoclonal antibody specific for the
N-terminal portion of chitinase.
Binding specificity of the chitin-binding domain was determined by
incubating the purified, recombinant material with the following
insoluble polysaccharides: chitin beads (New England Biolabs), crab
shell chitin, chitosan, carboxymethyl cellulose, curdlan, lichenan,
mannan, and xylan (all from Sigma). Five hundred µl of recombinant
chitin-binding domain at 200 µg/ml in Buffer A was added to 100 µg
of washed matrix. After incubation at 23 °C for 30 min on a rocking
platform, the insoluble material was removed by centrifugation.
Chitin-binding domain remaining in solution was detected by
electrophoresing equivalent volumes of the supernatants through a
4-20% gradient polyacrylamide gel (Novex) and staining the gel with
Coomassie Blue stain (Gelcode, Pierce). Pelleted polysaccharides were
washed twice with Buffer A and boiled in Laemmli buffer with 50 mM dithiothreitol. The resulting material in solution was
electrophoresed and stained in parallel to the supernatants described above.
Chitinase Activity Assays--
Chitotriosidase activity was
assayed as described (10) using
4-methylumbelliferyl- Synthesis of Rhodamine-labeled Chitin-binding Domain--
The
chitin-binding domain (C-terminal 54 amino acids of human chitinase)
was synthesized using in situ neutralization/HBTU activation
protocols for Boc chemistry (23). After synthesis, the final Boc group
on the N terminus was removed, and 6-carboxytetramethylrhodamine, succinimidyl ester (Molecular Probes, Eugene, OR) was coupled selectively to the N-terminal amine group. Removal of side chain protecting groups and cleavage of polypeptide from resin was achieved by treatment with hydrogen fluoride. The labeled polypeptide was purified and analyzed by reverse phase high pressure liquid
chromatography and electrospray mass spectrometry. The protein was
folded and then purified again by reverse phase high pressure liquid chromatography.
Detection of Fungal Chitin--
A colony of S. cerevisiae (ATCC catalog no. 9763) was inoculated into 3 ml of
YEPD medium containing 2% glucose and grown at 37 °C for 16 h.
Twenty µl of an overnight culture derived from a single colony of
Candida albicans (strain 32033) was used to innoculate 3 ml
of YEPD medium containing 2% glucose and 10% fetal bovine serum
(BioWhittaker) and was incubated at 37 °C for 16 h. Mucor
rouxii (ATCC catalog no. 44260) was grown as yeast by inoculating
spores into YPG medium (24) and incubating with stirring at 23 °C
for 3 days under continuous CO2 flow. Neurospora crassa hyphal walls were generously provided by Dr. Claude
Selitrennikoff (University of Colorado). Cells of all four organisms
were pelleted by centrifugation, washed with PBS, and resuspended to
high turbidity in PBS. To detect chitin, 30 µl of washed cells was
mixed with either no fluorophore or with calcofluor white (BactiDrop,
Remel, Lenexa, KS), 2 µg/ml of wheat germ agglutinin-FITC (Sigma), or 2 µg/ml of synthetic chitin-binding domain-rhodamine. Final volume was adjusted to 50 µl with PBS. To demonstrate that any labeling seen
with chitin-binding domain-rhodamine was due to the chitin-binding domain, we included control tubes in which only the rhodamine component
was added to cells at 20 µg/ml. For staining with calcofluor white,
30 µl of washed cells was pelleted in a microcentrifuge tube then
resuspended in 30 µl of BactiDrop. All reactions were incubated on a
rocking platform at 23 °C for 2 h in the dark. Following
incubation, cells were pelleted, washed twice with PBS, and resuspended
in ProLong mounting medium (Molecular Probes). A drop of suspended
cells was applied to a glass slide and overlaid with a coverslip, and
staining patterns were observed with fluorescence microscopy.
Autofluorescence was negligible in control cells incubated in the
absence of fluorescent reagents.
Functional Definition of the Chitin-binding Domain--
Fig.
1 illustrates the proposed domain
structure of human chitinase and presents the sequence of the
C-terminal 72 amino acids. To assess the functional importance of the
C-terminal portion of the enzyme, full-length chitinase and a truncated
form lacking the C-terminal 72 amino acids were expressed in COS-7
cells. Chitin was incubated with media from the transfected cells then
removed by centrifugation. As shown in Fig.
2, full-length chitinase was removed from
solution by chitin, but the truncate was not. This is consistent with
the prior observation that the C terminus is required for binding of
the enzyme to native chitin (17).
The enzymatic activities of the two forms of chitinase were also
compared. Using equivalent molar quantities of each form, we found
equivalent substrate turnover when the soluble substrate, 4-methylumbelliferyl- Definition of the Minimal Chitin-binding Domain--
The above
experiments demonstrate that the C-terminal 72 amino acids of chitinase
are sufficient to mediate all of its binding to native chitin. To
determine the minimal number of residues necessary to accomplish this
binding, we designed a series of expression constructs in which
chitin-binding domain derivatives were fused to the C terminus of the
human placental SEAP (21). Media from COS-7 cells transfected with the
constructs were assayed for SEAP activity both before and after
incubation with crab shell chitin. Depletion of SEAP activity from the
media after incubation with chitin indicates a chitin-binding
domain-mediated precipitation of the fusion protein. As presented in
Fig. 4, 80% of the fusion protein
containing the full 72-residue chitin-binding domain (construct 395-466) was depleted from the medium by chitin. This level of depletion was retained with the removal of up to 23 amino acids from
the N terminus of the domain (construct 418-466). Removal of three
additional residues, however, completely abolished the ability of
chitin to precipitate the fusion protein from the medium (construct
421-466). Interestingly, the C terminus of the domain is critical;
deletion of as few as two amino acids completely abolished binding
activity (construct 413-464). Thus, the minimal chitin-binding domain
is composed of the most C-terminal 49 amino acids of chitinase.
Production and Activity of Recombinant Chitin-binding
Domain--
In order to generate pure chitin-binding domain for
further characterization, we constructed a S. cerevisiae
expression plasmid that encodes the C-terminal 54 amino acids of
chitinase fused to the yeast
Once removed from the eluting agent, the purified chitin-binding domain
retained its chitin binding activity. To determine whether the domain
is specific for chitin, we incubated various insoluble polysaccharides
with the recombinant material. After chitin-binding
domain-polysaccharide complexes were removed by centrifugation,
supernatants, as well as precipitated protein, were electrophoresed and
stained (Fig. 5). The chitin-binding domain was largely specific for chitin, binding both chitin beads and
raw crab shell chitin. Little or no precipitation of the binding domain
was affected by chitosan, cellulose, mannan, xylan, or the Role of Cysteines in Chitin Binding Activity--
Many
substrate-binding domains of proteins that metabolize polysaccharides
are rich in cysteine residues (25). Interestingly, the 49-residue
minimal chitin-binding domain of human chitinase contains all six of
the cysteine residues present in the C-terminal half of the protein
(Fig. 1). To test whether these residues are required for chitin
binding activity, we constructed six additional SEAP-chitin-binding
domain fusion constructs in which each cysteine was individually
mutated to a serine. Fig. 6 shows that,
unlike the control fusion, none of the mutants could be precipitated from transfected COS-7 media with crab shell chitin. Therefore, each
cysteine is critical for the chitin binding activity of the domain.
The indispensability of each cysteine suggests that each may be engaged
in disulfide bond formation. In support of this, the average mass of
the recombinant chitin-binding domain observed by electrospray
ionization mass spectroscopy was 5908.2 ± 1 Da. This is
consistent with the predicted mass of 5909.6 Da for the unreduced
polypeptide. Furthermore, chemical analysis of the recombinant polypeptide using DTNB revealed that there are no free sulfhydryl groups. Preliminary characterization of disulfide linkages using proteolytic cleavage of the domain followed by purification, mass determination, and sequencing of the fragments revealed that Cys-420 and Cys-440 are linked to each other (not shown). However, because of
their close proximity, exact assignment of linkages to the remaining
cysteines has not been possible.
Binding of Chitin-binding Domain to Fungal Cells--
To test
whether the chitin-binding domain is able to bind chitin in the context
of the fungal cell wall, we compared fungal labeling patterns of
chemically synthesized, rhodamine-tagged chitin-binding domain with two
other chitin-binding molecules, calcofluor white and FITC-tagged wheat
germ agglutinin. Fig. 7 shows labeling of
C. albicans and M. rouxii by the three reagents. In general, all three reagents detected the same structures, although there were subtle differences. In C. albicans, the bud scars
and chitin rings of budding yeast were readily detected. These
structures were also labeled in S. cerevisiae yeast,
although a diffuse background staining of the entire cell by
chitin-binding domain-rhodamine tended to obscure the chitin-rich
structures (not shown). In C. albicans hyphae,
chitin-binding domain-rhodamine brightly labeled both hyphal tips and
septa. Calcofluor white produced a similar labeling pattern, but wheat
germ agglutinin-FITC labeled few if any hyphal tips or septa. Similar
labeling patterns were observed with another hyphal fungus, N. crassa (not shown). M. rouxii normally grows as
branched, nonseptate hyphae, but when incubated under CO2,
the yeast form predominates (24). Chitin-binding domain-rhodamine brightly labeled a thick layer surrounding the yeast cell. This layer
was contiguous with a thinner labeled layer on the occasional hyphae
emanating from a yeast cell. Incubation of these cells with calcofluor
resulted in bright labeling of the entire cell with a slight preference
for the outer cell wall structure. Wheat germ agglutinin-FITC labeling
of the cell was similar to that of the chitin-binding domain except
that it also labeled bud scars. These results demonstrate that in
general, the chitin-binding domain binds fungal cell wall chitin in
patterns that are consistent with those exhibited by other
chitin-binding molecules. That the binding is chitin-specific is also
supported by a complete lack of labeling of non-chitin-containing COS-7
and E. coli cells (not shown).
Human chitinase, one of the most abundant proteins produced by
monocyte-derived macrophages, was identified as a protein highly elevated in the serum of patients with Gaucher disease (10). The
protein is composed of two discrete domains. The N-terminal three-fourths is homologous to a variety of well defined chitinases and
has chitotriosidase activity (11). The remainder of the protein was
proposed to mediate chitin binding activity because its absence
rendered the protein impervious to precipitation by chitin (17).
However, despite the elegant investigative efforts applied to
chitinase, its physiological function remains unknown.
In order to understand more fully the interaction of the human
chitinase with its substrate, we set out to define the chitin-binding domain. Using both a positive and a negative approach, we have confirmed that the C-terminal portion of human chitinase mediates binding to chitin. A recombinant truncate lacking the C-terminal 72 amino acids does not bind chitin. The same C-terminal 72 residue fragment, expressed as a recombinant protein, does bind chitin. By
creating a series of nested deletions, we found that the C-terminal 49 amino acids are necessary and sufficient for binding. The idea that the
chitinase is composed of two discrete domains is supported by the
observation that the C-terminal region is not required for hydrolysis
of a soluble substrate (Ref. 17 and this report). This is also true of
a number of cellulases in which enzymatic activity is not compromised
by the removal of the cellulose-binding domain (reviewed in Ref. 26).
The substrate-binding domain does appear to be more critical for
hydrolysis of insoluble substrates, however. For example, removal of
the chitin-binding domain from a rye seed chitinase reduces its
activity against colloidal chitin (27). This is also the case for the
human chitinase; the C-terminal truncate showed no hydrolytic activity
against insoluble chitin in an agar diffusion assay. In
vivo, the chitin-binding domain is likely to be critical for
targeting the enzyme to its substrate, whether it be chitin in the
fungal cell wall or some as yet undefined polysaccharide associated
with the mammalian cell membrane or interstitium.
Minimally 49 amino acids in length, the chitin-binding domain depends
upon the structural stability imparted by three internal disulfide
linkages for function. In fact, the N-terminal boundary of the domain
is likely defined by Cys-420, because deletions N-terminal to it are
tolerated, but any deletions in which it is removed are crippling.
Furthermore, we found that mutation of Cys-420 or any of the other five
cysteines within the binding domain to serine renders it inactive. The
cysteine-rich character of this region is reminiscent of the
substrate-binding domains of the invertebrate and plant families of
chitin-binding proteins (25). These domains have six or eight
cysteines, respectively, all of which are linked by disulfide bonds.
Apart from the structural constraints imposed by the disulfides, there
are no other secondary structural features. Preliminary circular
dichroism analysis of the chitinase chitin-binding domain produced a
spectrum consistent with a similar lack of secondary structure. At the
C terminus of the domain, it was surprising to find that deletion of
just two amino acids completely abolished binding activity. Because this deletion does not remove any of the cysteines, little effect on
the structural integrity of the domain would be expected. It is
possible that the penultimate residue, a tryptophan, is required for
interaction with the substrate. Aromatic residues are highly conserved
in polysaccharide-binding proteins of a wide variety of invertebrates
(25, 26). Conserved tryptophans are also found in the starch-binding
domains of a microbial family of enzymes that degrade starch. At least
two of these conserved residues are required for binding activity and
are predicted to participate in binding to glucosyl units through
hydrophobic or hydrogen bonding (28).
We found that once bound, the chitin-binding domain requires harsh
conditions such as 1% SDS or 50% acetonitrile to elute it from
chitin. The kinetics of this interaction are likely to be complex, as
suggested by the fact that we found it virtually impossible to achieve
saturable binding of the domain to chitin beads (not shown). Others
have reported similar binding properties of a chitin-binding domain
from an Alteromonas species (29). Efforts to more fully
define the mechanisms and kinetics of binding to chitin are ongoing. In
addition to its strong affinity for chitin, the chitin-binding domain
also appears to be highly specific. We could precipitate it from
solution only with chitin, not with the deacetylated form of chitin,
chitosan, or with two other polysaccharides with Alternatively, an exogenous substrate may be the main target of human
chitinase. Because the macrophage serves as one of the primary defense
mechanisms against invading fungal pathogens (30), it is reasonable to
conclude that chitinase, copiously produced by macrophages, contributes
to the defensive activity of macrophages by degrading fungal chitin (9,
12). Consistent with this is the high affinity and specificity of the
chitin-binding domain for insoluble chitin. To test whether the domain
is able to bind chitin enmeshed within the complex milieu of the fungal
cell wall (31-33), we compared fungal labeling patterns of
fluorescently tagged chitin-binding domain with those of calcofluor and
wheat germ agglutinin. In all four organisms tested, the chitin-binding domain labeled the same chitin-rich structures detected by the two
chitin-staining control reagents. Because we have demonstrated that the
chitin-binding domain is required for hydrolysis of insoluble chitin,
it follows that binding to substrate is a prerequisite for its
degradation. These labeling experiments demonstrate that the binding
requirement is met, thus supporting the hypothesis that the enzyme
hydrolyzes fungal chitin. Whether this would ultimately result in
fungistasis or fungal death remains to be tested. However, as a general
observation, defense mechanisms against fungal pathogens or competitors
in plant, fungal, and bacterial models often invoke combinations of
effectors. For example, in the pea, Pisum sativum, a
chitinase and a We thank Dina Leviten, Marsalina Quiggle, and
Aaron Smith for oligonucleotide synthesis and DNA sequencing; Ashok
Kumar for assistance with mass spectroscopy; Greg Miller for yeast
fermentation; Solomon Bartnicki-Garcia for advice on growing M. rouxii; Claude Selitrennikoff for helpful advice and the gift of
N. crassa cell walls; John Hill for preliminary binding
analyses; Kevin Shaw and Dave Meyer for helpful advice; and Janine
Harrison for photography.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The abbreviations used are:
PCR, polymerase
chain reaction;
SEAP, secreted alkaline phosphatase;
PBS, phosphate-buffered saline;
FITC, fluorescein isothiocyanate.
Structural and Functional Definition of the Human Chitinase
Chitin-binding Domain*
,
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-1,3-glucan,
-1,3-1,4-glucan, or mannan. Fluorescently tagged chitin-binding
domain was used to demonstrate chitin-specific binding to
Saccharomyces cerevisiae, Candida albicans, Mucor rouxii, and
Neurospora crassa. These experiments define structural features of the minimal domain of human chitinase required for both specifically binding to and hydrolyzing insoluble chitin and demonstrate relevant binding within the context of the fungal cell wall.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-1,4-linked polymer of
N-acetylglucosamine, is one of the most abundant biopolymers
in nature. It serves a structural role in arthropods, including
crustaceans and insects, as well as mollusks, nematodes, and worms. It
is also found in fungi, making up from less than 1% to more than 40%
of the cell wall, depending on the organism. Chitin has not been found,
however, in mammals. Nevertheless, several mammalian proteins with
homology to fungal, bacterial, or plant chitinases have been identified (1-7). The only one of these proteins with demonstrated chitinolytic activity was identified as a tetra-N-acetylchitotetraoside
hydrolase that is specific for the -1,4-linked
N-acetylglucosamines of chitin (8, 9). The enzyme was
subsequently identified as a chitotriosidase that is dramatically
elevated in serum from patients with Gaucher disease (10). Cloning of
the cognate cDNA revealed several regions with high sequence
homology to the catalytic domains of family 18 glycosyl hydrolases,
including conservation of the putative active site (11).
-actin,
and annexin II, all serving either housekeeping or tissue remodeling
and repair functions. Comparison of the predicted protein sequence of
the chitinase open reading frame with chitinases from other species
revealed that the protein is likely composed of two distinct domains.
The putative catalytic domain, predicted on the basis of its extensive
homology with the catalytic domains of the other chitinases (11), is
contained within the N-terminal 75% of the protein. The remaining
one-quarter of the protein has limited homology with the chitin-binding
domains of the Manduca sexta and Brugia malayi
chitinases (11). Consistent with the possibility that this C terminus
is a chitin-binding domain, Renkema et al. (17) describe a
C-terminally truncated form of the human chitinase that can hydrolyze
chitotriose but is unable to bind chitin.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-factor pre-pro sequence (18). The PCR was used to
generate a chitin-binding domain-encoding fragment (sense primer,
5'-AAGAGGTACCTTTGGATAAAAGAAGCCCTGGACAAGACACGTTCTGCC; antisense
primer, 5'-GAGAGCGGCCGCGACTTAATTCCAGGTGCAGCATTTGCAGG), which was
digested with Asp718 I and NotI, ligated into an
expression cassette, and cloned into pSAC/VEC, a modified version of
the disintegration vector pSAC35 (19). This shuttle vector is composed of a complete two micron plasmid with a LEU2d selectable marker and two
repeated sequences flanking the pUC-derived E. coli origin of replication and -lactamase resistance marker. The resulting pSAC2/AF/chitin-binding domain plasmid was transformed into the S. cerevisiae host strain IE41 (19) (ciro
leu2 pep4::URA3 L261) and selected by growth on
leucine-deficient media.
20 °C until purification of the recombinant protein.
-D-N,N',N"-triacetylchitotriose
(Sigma) as the substrate. To assay for hydrolytic activity on insoluble chitin, ground and washed crab shell chitin (see above) was suspended to 0.4% in 1.5% molten agarose, 20 mM sodium phosphate,
pH 6. The mixture was poured to a thickness of 2 mm in a 10-cm Petri dish and allowed to solidify. Wells 3 mm in diameter were cut into the
agarose/chitin matrix. Prior to loading wells, the recombinant proteins
in media from transfected COS-7 cells were concentrated 70-fold over a
30,000 molecular weight cutoff filter device (Amicon). Equivalent
quantities of full-length and C-terminally truncated recombinant
proteins were loaded into adjacent wells. A third well was loaded with
concentrated medium from mock-transfected COS-7 cells. Plates were
incubated for 48 h at 37 °C in a humidified chamber. After
incubation, zones of clearing around the well indicate hydrolysis of
the chitin.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (24K):
[in a new window]
Fig. 1.
Proposed domain structure of human
chitinase. The sequence of the C-terminal 72 amino acids is
presented.
View larger version (72K):
[in a new window]
Fig. 2.
The C terminus is essential for binding of
chitinase to chitin. Recombinant full-length chitinase
(lanes 1 and 2) and chitinase with the C-terminal
72 amino acids deleted (lanes 3 and 4) (see Fig.
1) were expressed in COS-7 cells. Culture media from transfected COS-7
cells were incubated without (lanes 1 and 3) or
with (lanes 2 and 4) crab shell chitin and
centrifuged, and then supernatants were submitted to SDS-polyacrylamide
gel electrophoresis. Protein bands were detected by Western blotting.
The absence of a band in lane 2 but not in lane 4 demonstrates that the full-length but not the truncated chitinase is
precipitated by chitin. M designates lane containing
molecular weight makers.
-D-N,N',N"-triacetylchitotriose
was used (Fig. 3A). This was
not the case, however, with native chitin as substrate. In an agar
diffusion assay in which particulate crab shell chitin was incorporated
into agarose, the full-length chitinase generated a zone of clearing
around the well of origin (Fig. 3B). In contrast, no
clearing of the substrate could be detected around the well containing
the truncated enzyme. These observations suggest that although the
chitin-binding domain does not appear to affect the catalytic site of
the enzyme, its presence is essential for the enzyme to act upon
insoluble chitin.
View larger version (49K):
[in a new window]
Fig. 3.
The chitin-binding domain is required for
hydrolysis of chitin but not of triacetylchitotriose. Full-length
and truncated chitinase produced in COS-7 cells were assayed for
chitotriosidase (A) and chitinase (B) activities.
The substrate 4-MU triacetylchitotriose was used to compare
chitotriosidase activity of the two forms (A). To compare
chitinase activity (B), wells cut into agarose-containing
crab shell chitin were loaded with equimolar concentrations of either
the full-length or truncated enzyme. A darkened zone around
a well indicates hydrolysis of the white chitin particles. Control
wells were loaded with an equal volume of mock-transfected COS-7 cell
culture medium. Data shown for both A and B are
representative of three independent experiments.
View larger version (20K):
[in a new window]
Fig. 4.
Definition of the minimal chitin-binding
domain of chitinase. Fusion proteins consisting of SEAP fused to
various subfragments of the C terminus of chitinase were produced in
COS-7 cells. Culture media from transfected cells were incubated with
or without crab shell chitin, centrifuged, and then assayed for SEAP
activity. SEAP activity remaining in culture media after incubation
with and subsequent removal of chitin is expressed as a percentage of
the total activity in the same medium without precipitation with
chitin.
-factor pre-pro sequence (18). Cells
transfected with this construct routinely produced 0.85-1.0 mg/ml of
mature chitin-binding domain. The recombinant material was purified to >95% homogeneity from culture medium with a single passage over chitin beads. Interestingly, elution from the beads required harsh conditions, such as 1% SDS or 50% acetonitrile (Table
I). This indicates a strong interaction
between the peptide and chitin.
Elution of recombinant chitin-binding domain from chitin beads
-glucans
curdlan and lichenan.
View larger version (43K):
[in a new window]
Fig. 5.
Substrate specificity of the chitin-binding
domain. Purified recombinant chitin-binding domain was incubated
with the indicated insoluble polysaccharides. Following incubation, the
insoluble material was pelleted, and the supernatant was
electrophoresed through a 4-20% gradient polyacrylamide gel
(upper panel). The pelleted polysaccharides were boiled in
Laemmli buffer, and the resulting supernatants were also
electrophoresed (lower panel). Both gels were stained with
Coomassie Blue dye. CBD designates lanes containing an
equivalent amount of recombinant chitin-binding domain for a mobility
and quantity standard, and M designates lanes containing
molecular weight standards.
View larger version (15K):
[in a new window]
Fig. 6.
Each of the six cysteines within the
chitin-binding domain is essential for binding activity. Each
cysteine (see Fig. 1) was independently mutated to a serine, and the
resulting modified chitin-binding domains (413-466) were expressed as
fusions with SEAP and assayed for chitin binding activity (see Fig. 4
legend). Cysteines are numbered according to position within the
full-length chitinase polypeptide.
View larger version (132K):
[in a new window]
Fig. 7.
Localization of C. albicans
and M. rouxii cell wall chitin with labeled
chitin-binding domain. Cells incubated with calcofluor white
(A), FITC-labeled wheat germ agglutinin (B), or
rhodamine-labeled chitin-binding domain (C) were washed and
then examined by fluorescence microscopy. Differential interference
contrast images are also shown. C. albicans is shown at a
magnification of × 60, and M. rouxii is shown at × 40.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-1,4-glycosidic
bonds, cellulose and xylan. Additionally, neither the -1,3- nor
-1,3-1,4-glucans nor mannan was able to substantially precipitate
the binding domain. This suggests that the binding domain is tightly
constrained to a specific ligand composition and conformation. Assuming
that the natural ligand is an insoluble polysaccharide, such strict
ligand specificity is relevant to the ongoing discussion regarding the
physiological function of the human chitinase. If, as has been
suggested (15), the enzyme participates in tissue remodeling during
embryogenesis or certain pathophysiological states, it is probable that
the substrate is chitin or is very similar to chitin. The
chitin-binding domain may be a useful probe for identifying such a
polysaccharide in vertebrate tissue.
-1,3-glucanase synergize in fungicidal activity (34). Similarly, the yeast lytic system of Arthrobacter sp. relies upon both protease and glucanase activities, neither of which
has lytic activity alone (35, 36). Therefore, it is reasonable to
consider the macrophage chitinase an important component of a defense
system that may include other enzymes and/or immunoglobulin, complement, and reactive oxygen species. Another intriguing possibility to consider is a potential fungistatic activity of the chitin-binding portion of the enzyme independent of any enzymatic activity. It has
been reported that the stinging nettle lectin, Urtica dioica aglutinin, is capable of inhibiting phytopathogenic fungal growth, possibly by cross-linking chitin at the hyphal apex (37). A homologous
chitin-binding domain from the chestnut seed endochitinase, Ch3,
appears to interfere with hyphal growth independent of the chitinase
activity of the enzyme (38). On the other hand, a chitin-binding lectin
from Streptomyces olivaceoviridis, CHB1, bound to fungal
hyphae but exhibited no antifungal activity (39). Additional
structure-function analyses are needed to determine whether the human
chitin-binding domain may exert antifungal activity independent of the
catalytic activity of the enzyme.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: ICOS Corp., 22021 20th
Ave. S.E., Bothell, WA 98021. Tel.: 206-485-1900; Fax: 206-486-0300;
E-mail: ltjoelker@icos.com.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Rejman, J. J.,
and Hurley, W. L.
(1988)
Biochem. Biophys. Res. Commun.
150,
329-334[CrossRef][Medline]
[Order article via Infotrieve]
2.
Hakala, B. E.,
White, C.,
and Recklies, A. D.
(1993)
J. Biol. Chem.
268,
25803-23810 3.
Morrison, B. W.,
and Leder, P.
(1994)
Oncogene
9,
3417-3426[Medline]
[Order article via Infotrieve]
4.
Johansen, J. S.,
Cintin, C.,
Jorgensen, M.,
Kamby, C.,
and Price, P. A.
(1995)
Eur. J. Cancer
31A,
1437-1442
5.
Malette, B.,
Paquette, Y.,
Merlen, Y.,
and Bleau, G.
(1995)
Mol. Reprod. Dev.
41,
384-397[CrossRef][Medline]
[Order article via Infotrieve]
6.
Shackelton, L. M.,
Mann, D. M.,
and Millis, A. J.
(1995)
J. Biol. Chem.
270,
13076-13083 7.
Hu, B.,
Trinh, K.,
Figueira, W. F.,
and Price, P. A.
(1996)
J. Biol. Chem.
271,
19415-19420 8.
Den Tandt, W. R.,
Inaba, T.,
Verhamme, I.,
Overdyk, B.,
Brouwer, J.,
and Prieur, D.
(1988)
Int. J. Biochem.
20,
713-719[CrossRef][Medline]
[Order article via Infotrieve]
9.
Overdijk, B.,
and Van Steijn, G. J.
(1994)
Glycobiology
4,
797-803 10.
Hollak, C. E.,
van Weely, S.,
van Oers, M. H.,
and Aerts, J. M.
(1994)
J. Clin. Invest.
93,
1288-1292
11.
Boot, R. G.,
Renkema, G. H.,
Strijland, A.,
van Zonneveld, A. J.,
and Aerts, J. M.
(1995)
J. Biol. Chem.
270,
26252-26256 12.
Renkema, G. H.,
Boot, R. G.,
Muijsers, A. O.,
Donker-Koopman, W. E.,
and Aerts, J. M.
(1995)
J. Biol. Chem.
270,
2198-2202 13.
Overdijk, B.,
Van Steijn, G. J.,
and Odds, F. C.
(1996)
Glycobiology
6,
627-634 14.
Overdijk, B.,
Van Steijn, G. J.,
and Odds, F. C.
(1999)
Microbiology
145,
259-269 15.
Boot, R. G.,
van Achterberg, T. A.,
van Aken, B. E.,
Renkema, G. H.,
Jacobs, M. J.,
Aerts, J. M.,
and de Vries, C. J.
(1999)
Arterioscler. Thromb. Vasc. Biol.
19,
687-694 16.
Chantry, D.,
DeMaggio, A. J.,
Brammer, H.,
Raport, C. J.,
Wood, C. L.,
Schweickart, V. L.,
Epp, A.,
Smith, A.,
Stine, J. T.,
Walton, K.,
Tjoelker, L.,
Godiska, R.,
and Gray, P. W.
(1998)
J. Leukocyte Biol.
64,
49-54[Abstract]
17.
Renkema, G. H.,
Boot, R. G.,
Strijland, A.,
Donker-Koopman, W. E.,
van den Berg, M.,
Muijsers, A. O.,
and Aerts, J. M.
(1997)
Eur. J. Biochem.
244,
279-285[Medline]
[Order article via Infotrieve]
18.
Brake, A. J.,
Merryweather, J. P.,
Coit, D. G.,
Heberlein, U. A.,
Masiarz, F. R.,
Mullenbach, G. T.,
Urdea, M. S.,
Valenzuela, P.,
and Barr, P. J.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
4642-4646 19.
Sleep, D.,
Belfield, G. P.,
Balance, D. J.,
Steven, J.,
Jones, S.,
Evans, L. R.,
Moir, P. D.,
and Goodey, A. R.
(1991)
Bio/Technology
9,
183-187[CrossRef][Medline]
[Order article via Infotrieve]
20.
Harlow, E.,
and Lane, D.
(1988)
Antibodies: A Laboratory Manual
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
21.
Berger, J.,
Hauber, J.,
Hauber, R.,
Geiger, R.,
and Cullen, B. R.
(1988)
Gene
66,
1-10[CrossRef][Medline]
[Order article via Infotrieve]
22.
Flanagan, J. G.,
and Leder, P.
(1990)
Cell
63,
185-194[CrossRef][Medline]
[Order article via Infotrieve]
23.
Schnolzer, M.,
Alewood, P.,
Jones, A.,
Alewood, D.,
and Kent, S. B. D.
(1992)
Int. J. Peptide Res.
40,
180-193
24.
Bartnicki-Garcia, S.,
and Nickerson, W. J.
(1968)
Biochim. Biophys. Acta
58,
102-119[CrossRef]
25.
Shen, Z.,
and Jacobs-Lorena, M.
(1999)
J. Mol. Evol.
48,
341-347[CrossRef][Medline]
[Order article via Infotrieve]
26.
Gilkes, N. R.,
Henrissaat, B.,
Kilburn, D. G.,
Miller, R. C.,
and Warren, R. A. J.
(1991)
Microbiol. Rev.
55,
303-315 27.
Yamagami, T.,
and Funatsu, G.
(1996)
Biosci. Biotech. Biochem.
60,
1081-1086[Medline]
[Order article via Infotrieve]
28.
Svensson, B.,
Jespersen, H.,
Sierks, M. R.,
and MacGregor, E. A.
(1989)
Biochem. J.
264,
309-311[Medline]
[Order article via Infotrieve]
29.
Tsujibo, H.,
Orikoshi, H.,
Shiotani, K.,
Hayashi, M.,
Umeda, J.,
Miyamoto, K.,
Imada, C.,
Okami, Y.,
and Inamori, Y.
(1998)
Appl. Environ. Microbiol.
64,
472-478 30.
Vazquez-Torres, A.,
and Balish, E.
(1997)
Microbiol. Mol. Biol. Rev.
61,
170-192[Abstract]
31.
Cabib, E.,
Drgon, T.,
Drgonova, J.,
Ford, R. A.,
and Kollar, R.
(1997)
Biochem. Soc. Trans.
25,
200-204[Medline]
[Order article via Infotrieve]
32.
Lipke, P. N.,
and Ovalle, R.
(1998)
J. Bacteriol.
180,
3735-3740 33.
Selitrennikoff, C. P.,
and Ostroff, G. R.
(1999)
Emerging Therapeutic Targets
3,
53-72
34.
Mauch, F.,
Mauch-Mani, B.,
and Boller, T.
(1988)
Plant Physiol.
88,
936-942 35.
Vrsanska, M.,
Biely, P.,
and Kratky, Z.
(1977)
Z. Allg. Mikrobiol.
17,
465-480[Medline]
[Order article via Infotrieve]
36.
Kitamura, K.
(1982)
Agric. Biol. Chem.
46,
2093-2099
37.
Broekaert, W. F.,
Van Parijs, J.,
Leyns, F.,
Joos, H.,
and Peumans, W. J.
(1989)
Science
245,
1100-1102 38.
Garcia-Casado, G.,
Collada, C.,
Allona, I.,
Casado, R.,
Pacios, L. F.,
Aragoncillo, C.,
and Gomez, L.
(1998)
Glycobiology
8,
1021-1028 39.
Schnellmann, J.,
Zeltins, A.,
Blaak, H.,
and Schrempf, H.
(1994)
Mol. Microbiol.
13,
807-819[Medline]
[Order article via Infotrieve]
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Vandevenne, G. Gaspard, N. Yilmaz, F. Giannotta, J.M. Frere, M. Galleni, and P. Filee Rapid and easy development of versatile tools to study protein/ligand interactions Protein Eng. Des. Sel., July 1, 2008; 21(7): 443 - 451. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I Labadaridis, E Dimitriou, M Theodorakis, G Kafalidis, A Velegraki, and H Michelakakis Chitotriosidase in neonates with fungal and bacterial infections Arch. Dis. Child. Fetal Neonatal Ed., November 1, 2005; 90(6): F531 - F532. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. G. Boot, A. P. Bussink, M. Verhoek, P. A.J. de Boer, A. F.M. Moorman, and J. M.F.G. Aerts Marked Differences in Tissue-specific Expression of Chitinases in Mouse and Man J. Histochem. Cytochem., October 1, 2005; 53(10): 1283 - 1292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Siaens, V. G.H. Eijsink, R. Dierckx, and G. Slegers 123I-Labeled Chitinase as Specific Radioligand for In Vivo Detection of Fungal Infections in Mice J. Nucl. Med., July 1, 2004; 45(7): 1209 - 1216. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. A. van den Burg, N. Westerink, K.-J. Francoijs, R. Roth, E. Woestenenk, S. Boeren, P. J. G. M. de Wit, M. H. A. J. Joosten, and J. Vervoort Natural Disulfide Bond-disrupted Mutants of AVR4 of the Tomato Pathogen Cladosporium fulvum Are Sensitive to Proteolysis, Circumvent Cf-4-mediated Resistance, but Retain Their Chitin Binding Ability J. Biol. Chem., July 18, 2003; 278(30): 27340 - 27346. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Chamoy, M. Nicolai, J. Ravaux, B. Quennedey, F. Gaill, and J. Delachambre A Novel Chitin-binding Protein from the Vestimentiferan Riftia pachyptila Interacts Specifically with beta -Chitin. CLONING, EXPRESSION, AND CHARACTERIZATION J. Biol. Chem., March 9, 2001; 276(11): 8051 - 8058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G. Boot, E. F. C. Blommaart, E. Swart, K. Ghauharali-van der Vlugt, N. Bijl, C. Moe, A. Place, and J. M. F. G. Aerts Identification of a Novel Acidic Mammalian Chitinase Distinct from Chitotriosidase J. Biol. Chem., February 23, 2001; 276(9): 6770 - 6778. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |