HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Naltner, A. Articles by Yan, C. Search for Related Content PubMed PubMed Citation Articles by Naltner, A. Articles by Yan, C. Social Bookmarking                      What's this?

J Biol Chem, Vol. 275, Issue 1, 56-62, January 7, 2000

Retinoic Acid Stimulation of the Human Surfactant Protein B Promoter Is Thyroid Transcription Factor 1 Site-dependent^*

Angela Naltner, Manely Ghaffari, Jeffrey A. Whitsett, and Cong Yan^§

From the Division of Pulmonary Biology, Children's Hospital Medical Center, Cincinnati, Ohio 45229-3039

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Surfactant B (SP-B) is a 79-amino acid peptide critical to postnatal respiratory adaptation. Expression of SP-B by respiratory epithelial cells is regulated by developmental and hormonal influences at the level of gene transcription. Previous studies supported the role of retinoic acids (RA) and their receptors (RARs) in SP-B gene transcription. In the present study, RAR was detected in mouse alveolar type II epithelial cells where SP-B is synthesized and processed. Deletion and site-specific mutagenesis analysis identified clustered retinoic acid-responsive element sites in the 5'-flanking enhancer region of the hSP-B gene that bound RAR proteins. RAR coactivators ACTR, SRC-1, and transcriptional intermediary factor 2 (TIF2) stimulated human (h) SP-B promoter activity in a dose-dependent fashion in pulmonary adenocarcinoma H441 cells. In addition, an RAR-associated protein, CREB-binding protein (CBP), potentiated the effects of RAR on hSP-B promoter activity in H441 cells. Importantly, RA stimulation of the hSP-B promoter depends on tissue-specific thyroid transcription factor (TTF-1) DNA-binding sites. TTF-1 protein synergistically stimulated the hSP-B promoter with RAR, CBP, and nuclear receptor coactivators in H441 cells. In addition, TTF-1 interacted directly with RAR and TIF2 in the mammalian two-hybrid system. These findings support a model in which RAR/retinoid X receptor, TTF-1, coactivators, and CBP form a transcription activation complex in the upstream enhancer region of the hSP-B gene.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Pulmonary surfactant is synthesized and secreted primarily by type II epithelial cells in the alveoli of the lung preventing atelectasis during the respiratory cycle. Deficiency or disruption of pulmonary surfactant causes respiratory distress syndrome. Surfactant consists not only of phospholipid, but it also contains several surfactant proteins including SP-A,¹ -B, -C, and -D that contribute to surfactant function and/or homeostasis. Surfactant proteins facilitate the spreading and enhance the stability of phospholipids in the alveoli and play an important role in host defense. SP-B is a 79-amino acid peptide that is derived by proteolytic processing of pro-SP-B in type II epithelial cells in the lung. SP-B plays a critical role in lamellar body and tubular myelin organization (1-4) and is essential for postnatal respiratory adaptation after birth. Mutation of the SP-B gene in the human (h) and mouse causes respiratory failure at birth (5-7). Even partial deficiency of SP-B in SP-B+/ mice causes lung dysfunction and susceptibility to oxygen toxicity (8).

Immunohistochemical staining and in situ hybridization studies indicate that SP-B mRNA and protein are restricted to type II cells and nonciliated bronchiolar epithelial cells in the lung (9-11). In vitro, the expression of SP-B is also restricted to cells of respiratory epithelial origins. The specificity of SP-B gene expression in pulmonary epithelial cells is primarily modulated at the level of gene transcription. Activities of multiple transcription factors on the SP-B promoter region contribute to the precise temporal-spatial distribution of SP-B gene expression in the lung. An enhancer region has been identified in the 5'-flanking region of the hSP-B gene (12). Deletion of the enhancer dramatically reduced the hSP-B transcription activity in H441 cells. Three clustered DNA-binding sites of homeodomain-containing thyroid transcription factor 1 (TTF-1) have been identified in the enhancer region. Site-specific mutagenesis of the TTF-1 sites abolished enhancer activity completely (12). TTF-1 is expressed in the lung, thyroid, and forebrain (13). TTF-1 was originally identified in the thyroid where it controls the transcription of thyroperoxidase and thyroglobulin genes (14, 15). In the lung, TTF-1 mRNA and protein were detected at the earliest stages of differentiation and were restricted to bronchial and alveolar epithelium in the postnatal lung (13).

The hSP-B gene is also regulated by retinoic acids (RA) and their receptors (RAR). RA increased SP-B mRNA and pro-SP-B protein in H441 cells (16-18) and lung explants in vitro (19, 20). The responsiveness of RA stimulatory effect was identified within the enhancer region of the hSP-B promoter (16). Furthermore, a dominant negative RAR403 mutant inhibited the hSP-B promoter in H441 cells, indicating an essential role of RAR in hSP-B promoter activity in respiratory epithelial cells (21). The importance of the RA/RAR axis pathway in lung development is highlighted by the RAR/ double knock-out mouse which exhibited hypoplastic lungs (22). In addition, RA altered branching morphogenesis of the lung in vitro (19, 20, 23) and may play a critical role in postnatal alveolarization in vivo (23, 24). Supplementation of vitamin A from the early postnatal period reduced bronchopulmonary dysplasia-associated morbidity in preterm infants (25-27). Whereas the mechanisms by which RA affects lung development have not been fully clarified, expression of all three forms of RAR mRNAs was observed in the lung (28, 29). RAR protein was detected in the epithelium of the fetal mouse lung in day 14.5 gestation (21). RAR and - and retinoic X receptor RXR were also detected in the Clara cell-like H441 cell line (16).

It is well established that RA and RAR play important roles in differentiation, growth, and homeostasis of epithelial cells in various tissues (30-31). RAR belongs to a large steroid/nonsteroid nuclear hormone receptor superfamily that consists of three receptor isotypes , , , each encoded by distinct genes. RAR forms a heterodimer with (RXR) to bind to the retinoic acid-responsive element (RARE) on the target genes. Whereas RAR has weak DNA binding activity, RXR greatly enhanced RAR DNA binding activity through dimerization of RAR/RXR (33). RAR consists of a DNA-binding domain that contains Zn²⁺ finger motifs, a ligand-binding/dimerization domain, a ligand-independent AF-1 transcription activation domain, and a ligand-dependent AF-2 transcription activation domain. Through these various functional domains, RAR interacts with other transcription factors, including CBP/p300 and nuclear receptor coactivators. The first nuclear receptor coactivator identified was SRC-1 (34). Several other coactivators were subsequently identified, including ACTR, TIF2, p/CIP, and p300/CBP-associated factor (35-40). The interactions between RAR and coactivators are mediated by a well conserved amphipathic -helix in the AF-2 domain of RAR (41, 42). Many of these nuclear receptor coactivators contain two types of important functional domains. The receptor interaction domains contain NR box LXXL motifs that are required for direct interaction with nuclear receptors. Histone acetyltransferase (HAT) domains possess intrinsic histone acetylation activity (35, 43-45). In addition to nuclear receptors, coactivators with HATs interact with each other to form a large transcription activation complex. Recruitment of multiple HATs leads to chromatin remodeling and target gene activation. In the absence of hormone ligands, nuclear receptors interact with corepressors, such as SMRT/TRAC and N-CoR/RIP13 to repress gene activation (46, 47). These corepressors possess histone deacetylase activity (48). Therefore, histone acetylation/deacetylation is critical to nuclear receptor signaling in epithelial cells.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Plasmids-- The hSP-B-500 construct was made previously (12). The hSP-B 470 and hSP-B 417 constructs were generated by polymerase chain reaction (PCR) using Taq DNA polymerase (Life Technologies, Inc.), synthetic oligonucleotide primers, and the hSP-B 500 construct as a template.

The upstream primers with the MluI site for the hSP-B constructs were as follows: hSP-B 470 5'-CGCACGCGTAGGTGGTGAGAGTGTCCTGG and hSP-B 417 5'-CGCACGCGTGCCAGGCAGGAAGCTCT. The downstream primer with the XhoI site was 5'-GCGCTCGAGCCACTGCAGCAGGTGTGACTC.

The PCR products were digested with MluI and XhoI restriction enzymes (Life Technologies, Inc.) and ligated with MluI/XhoI-digested pGL2-B luciferase reporter plasmid (Promega). To generate the site-specific mutants of the hSP-B-500 construct at the RARE/S1, S2, S3, and S1/S3 sites, two steps of PCR were conducted. For the first PCR, mutant PCR oligonucleotides were synthesized with mutations at the positions identical to the EMSA studies. The mutant primers were mixed with hSP-B 500 and primer GLprimer 1/GLprimer 2 (Promega) to make two sets of PCR products that were subsequently purified by low melting point agarose gel electrophoresis and the QIAquick gel extraction kit. The purified two sets of PCR products were then mixed together along with GLprimer 1 and GLprimer 2 primers for the second PCR. The second PCR products were digested with MluI/XhoI restriction enzymes. The DNA fragments with MluI- and XhoI-flanking sites at each end were purified by low melting point gel electrophoresis as described above and ligated into the MluI/XhoI-digested pGL2-B plasmid. Mutant constructs at TTF-1 sites were made previously (12).

To make SV40/hSP-B(331 to 500), the upstream primer 5'-CGCACGCGTCAGAAGATTTTTCCAGGGGA with the MluI site and the downstream primer 5'-GCGCTCGAGGCCTGGGTGTTCCCCTCCCAT with the XhoI site were used to amplify the wild type hSP-B 500 as a template by PCR. The PCR product was purified, digested, and ligated into pGL-2 P (Promega) MluI/XhoI site. The correctness of all plasmid constructs was confirmed by DNA sequencing.

The ACTR expression vector (35), the SRC-1 expression vector (34), RAR, RXR, and TIF-2 expression vectors (40), and the CBP expression vector (49) were from the original authors.

Cell Culture-- Human pulmonary adenocarcinoma cells (H441) were cultured in RPMI supplemented with 10% fetal calf serum, glutamine, and penicillin/streptomycin. Cells were maintained at 37 °C in 5% CO₂/air and passaged weekly.

Transfection and Reporter Gene Assays-- For hSP-B promoter deletion and mutation studies, transient transfection and luciferase reporter assays were performed as described previously (12, 50) with minor modification. Briefly, H441 cells were seeded at densities of 2 × 10⁵ cells per well in 6-well plates. The hSP-B reporter constructs (0.25 µg) hSP-B500, hSP-B470, hSP-B417, and mutation constructs hSP-B500/S1, hSP-B500/S2, hSP-B500/S3, and hSP-B500/S1/S3 were transfected with 0.5 µg of pCMV-gal plasmid into H441 cells by Fugene6 (Roche Molecular Biochemicals). After 2 days of incubation with and without all-trans-RA (10⁵ M), cells were lysed, and luciferase activities were performed using the luciferase assay system (Promega). The light units were assayed by luminometry (Monolight 3010, Analytical Luminescence Laboratory, San Diego, CA). In each transfection, -galactosidase activities were determined for normalization of transfection efficiency. For the SV40/hSP-B(500/331) luciferase reporter gene studies, transient transfection and luciferase reporter assays were performed as outlined above, except the SV40 and SV40/hSP-B(500/331) luciferase constructs were used. To determine the stimulatory effects of RAR/RXR, nuclear receptor coactivators, CBP, and TTF-1, various expression constructs were cotransfected with the hSP-B 500 luciferase reporter construct as specified in the figure legends and 0.5 µg of pCMV-gal plasmid included for normalization of transfection efficiency. Carrier DNA plasmids were utilized to keep the total DNA concentrations constant for all points.

Mammalian Two-hybrid System Assay-- The plasmid constructs of pVP16/TTF-1 AD, pM/RAR BD, and pM/TIF2 BD were made by subcloning the PCR products of TTF-1, RAR, and TIF2 molecules into pM and pV16 vectors (CLONTECH, Palo Alto, CA 94304) at the EcoRI/XbaI sites. The reporter construct PG5LUC was generated by subcloning of GAL4-binding sites (UAS_{G 17-mer(×5)}) and an adenovirus E1b minimal promoter into the pGL2-B luciferase reporter gene at the MluI/XhoI sites. Two hybrid cotransfections of above plasmid constructs in H441 cells were performed as recommended by the manufacturer (CLONTECH).

EMSA-- Wild type and mutant double-stranded Oligo1 (438 to 470) and Oligo2 (410 to 439) of the hSP-B enhancer region were synthesized, annealed, and purified as follows: wild type Oligo1, 5'AGGTGGTGAGAGTGTCCTGGGTCTGCCCTTCCA3'; mutant Oligo1, 5'AGGTGGTGAGAGacgataGGGTCTcgattTTCCA3'; wild type Oligo2, 5'CAGGGCTTGCCCTGGGTTAAGAGCCAGGCA3'; and mutant Oligo2, 5'CAGGGCTTGgatgGGGTTAAGAGCCAGGCA3'.

The underlined sequences represent the wild type or mutant RAREs. The oligonucleotides were radiolabeled by [-³²P]ATP and kinase and incubated with 100 ng of the purified RAR-GST fusion protein as suggested by the manufacturer (Santa Cruz Biotechnology). EMSA was performed by following the procedures described previously (12). In the absence of RXR, relatively higher concentrations of RAR proteins were required due to low DNA binding affinity of RAR. Polyclonal antibody against RAR (1 µg) (Santa Cruz Biotechnology) was used in the supershift assays.

Immunocytochemistry-- Alveolar type II epithelial cells were isolated from adult mice following the procedure described previously (51). Cells were seeded onto Permanox chamber slides (Fisher) at densities ranging from 10⁴ to 10⁵ cells per chamber (two chambers per slide) by cytospin. For immunocytostaining of RAR proteins, the procedure followed the previous publication using RAR, -, and - antibodies (Santa Cruz Biotechnology) (16).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

RAR Expression in Alveolar Type II Epithelial Cells-- SP-B mRNA and protein are present in non-ciliated bronchiolar cells and in alveolar type II epithelial cells in the lung parenchyma (52). All three RAR, -, and - isotypes stimulated hSP-B promoter activity and RAR and - expression were detected in the bronchiolar Clara cell-like H441 adenocarcinoma cell line (16). Immunocytochemical staining of primary isolates of mouse alveolar type II cells with antibodies specifically against RAR, -, and - demonstrated that only the RAR isotype was expressed in primary isolates of mouse alveolar type II epithelial cells (Fig. 1). Therefore, RAR but not RAR plays a role in regulating hSP-B gene expression in distal respiratory epithelial cells.

View larger version (97K): [in this window] [in a new window]   Fig. 1.   Immunohistochemical staining of RARs in mouse type II epithelial cells. Type II cells were immunostained with rabbit polyclonal antibodies against RAR, -, and -. C, represents a negative control without a primary polyclonal antibody. Only RAR antibody showed detectable staining.

RAR Stimulates the hSP-B Promoter in H441 Cells-- Since RAR was detected in both type II epithelial cells and H441 cells, its effect on the activity of the hSP-B promoter was assessed in vitro. RAR was cotransfected with equal concentrations of RXR and 0.25 µg of the hSP-B 500 luciferase reporter construct into H441 cells. RAR/RXR stimulated the hSP-B 500 luciferase reporter construct in H441 cells (Fig. 2). Stimulatory effects were dose-dependent and further enhanced by all-trans-RA (10⁵ M), indicating that hSP-B 500 contains RAREs.

View larger version (14K): [in this window] [in a new window]   Fig. 2.   hRAR stimulates the hSP-B 500 promoter. H441 cells were cotransfected with various concentrations of hRAR/RXR and 0.25 µg of the hSP-B 500 luciferase reporter construct. The next day, one group of cells was treated with 105 M all-trans-RA and one group of cells remained untreated. Luciferase activity was measured 48 h later. The activity of hSP-B 500 without hRAR/RXR cotransfection and all-trans-RA treatment was defined as 1. Values are means ± S.D., n = 3. ANOVA showed a significant stimulatory effect of all-trans-RA and RAR/RXR on hSP-B 500, p < 0.05.

Interactions between RAR Protein and RAREs of the hSP-B Promoter-- Homology search revealed that the hSP-B 417 to 470 region contains three potential RARE sites (RARE/S1, RARE/S2, and RARE/S3) that resemble the core motifs of RAREs (TGCCCG or TGTCCT) in the 5'-flanking region of the retinol-binding protein gene (53) (Fig. 4A). To assess whether these sites bind RAR proteins, two synthetic double-stranded oligonucleotides (Oligo1 and Oligo2) containing these sites were synthesized and radiolabeled for EMSA analysis. Oligo1 (438 to 470 bp) contains both RARE/S1 and RARE/S2 sites. Oligo2 (410 to 439 bp) contains the RARE/S3 site. As demonstrated in Fig. 3, both Oligo1 and Oligo2 formed DNA-protein complexes with the purified RAR protein in the EMSA study. The DNA-RAR complexes were specific and supershifted by a polyclonal antibody recognizing RAR. The antibody alone did not form complexes with the oligonucleotides (data not shown). When mutations were introduced into the potential RARE sites in Oligo1 and Oligo2, only a nonspecific band was observed, indicating these sites are required for RAR DNA binding.

View larger version (38K): [in this window] [in a new window]   Fig. 3.   RAR binds to RAREs of the hSP-B 5'-flanking enhancer region. Radiolabeled wild type (wt) and mutant (mt) Oligo1 and Oligo2 probes were incubated with the purified RAR-GST fusion protein (100 µg). Oligo1 represents hSP-B(438/470). Oligo2 represents hSP-B(410/439). Free probes and DNA-protein complexes were separated on 4% nondenaturing polyacrylamide gels. RAR antibody (Ab) (1 µg) was included to supershift DNA-protein complexes. Arrows indicate RAR-DNA complex formations and supershifts.

Deletion and Mutation Analysis of RAREs on the hSP-B Promoter-- To assess whether RARE sites in the enhancer region mediate the stimulatory effect of all-trans-RA on the hSP-B promoter, hSP-B 470 that contains all three putative RARE sites, and hSP-B 417 that lacks RARE sites was cotransfected into H441 cells in the presence or absence of all-trans-RA (10⁵ M). Whereas hSP-B 470 was still stimulated by all-trans-RA in H441 cells, deletion of the region 417 to 470 (hSP-B 417) caused complete loss of all-trans-RA stimulation (Fig. 4A). Single mutations RARE/S1, RARE/S2, and RARE/S3 partially inhibited the stimulatory effects of RA on hSP-B 500, whereas double mutations RARES1/S3 completely abolished RA stimulation of the hSP-B 500 promoter (Fig. 4B), demonstrating that these RARE clustered sites are essential for RA stimulation of the hSP-B promoter.

View larger version (15K): [in this window] [in a new window]   Fig. 4.   RARE sites are required for all-trans-RA stimulatory activity of the hSP-B enhancer. A, deletion analysis of the hSP-B 5'-flanking region. H441 cells were transfected with 0.25 µg of B 500, B 470, and B 417 luciferase reporter constructs. The next day, cells were treated with 105 M all-trans-RA. Controls were untreated. Luciferase activity was measured 48 h later. Luciferase activities of hSP-B 500, hSP-B 470, and hSP-B 417 without all-trans-RA treatment were defined as 1. Values are means ± S.D., n = 3. ANOVA showed a significant stimulatory effect of all-trans-RA on hSP-B 500 and hSP-B 470, p < 0.05; B, mutagenesis of RARE sites in hSP-B 500. Mutations at RARE/S1, S2, S3, S1/S3 were introduced into hSP-B 500 (see "Materials and Methods"). Mutant and wild type hSP-B 500 constructs were transfected into H441 cells and treated with all-trans-RA.

RAR Coactivator Stimulation of hSP-B 500-- Several nuclear receptor coactivators interact with RAR and form the transcription activation complex that stimulates target gene expression. Since RA and RAR stimulate the hSP-B promoter, we reasoned that these coactivators may interact with RAR to stimulate the hSP-B promoter. In cotransfection and luciferase assay, three such coactivators, ACTR, SRC-1, and TIF-2, significantly stimulated the hSP-B 500 promoter in H441 cells (Fig. 5). Stimulation of hSP-B promoter activity by each coactivator was dose-dependent.

View larger version (14K): [in this window] [in a new window]   Fig. 5.   Nuclear receptor coactivators enhance hSP-B 500 activity. H441 cells were transfected with various concentrations of ACTR, SRC-1, and TIF2 expression vectors and 0.25 µg of the hSP-B 500 luciferase reporter construct. Luciferase activity was measured 72 h later. Luciferase activities of hSP-B 500 without coactivators were defined as 1. Values are means ± S.D., n = 3. ANOVA showed a significant stimulatory effect of coactivators on hSP-B 500, p < 0.05.

Synergistic Stimulation of the hSP-B Gene in H441 Cells by CBP and RAR-- In addition to interaction with nuclear receptor coactivators, RAR interacts with CBP, a common and rate-limiting mediator in many signaling pathways (38). CBP also interacts with nuclear receptor coactivators (35, 38-40). Whereas CBP itself only modestly stimulated hSP-B 500 (2-3-fold) (Fig. 6A), cotransfection of hRAR/hRXR and CBP markedly stimulated hSP-B 500 (13-fold) in H441 cells (Fig. 6B). hRAR/hRXR alone increased activity of the hSP-B 500 promoter 4-fold. The combinatorial effect of CPB and hRAR/hRXR was greater than additive (13- versus 6-fold).

View larger version (22K): [in this window] [in a new window]   Fig. 6.   CPB enhances activity of hSP-B 500. A, CBP stimulation of hSP-B 500. H441 cells were cotransfected with various concentrations of the CBP expression vector and 0.25 µg of the hSP-B 500 luciferase reporter construct. Luciferase activity was measured 72 h later. Luciferase activity of hSP-B 500 without CBP was defined as 1. Values are means ± S.D., n = 3. ANOVA showed a significant stimulatory effect of CBP on hSP-B 500, p < 0.05; B, synergistic stimulation of hSP-B 500 by RAR/RXR and CBP. H441 cells were transfected with 0.5 µg of expression vectors of CBP, RAR/RXR, or both, and 0.25 µg of the hSP-B 500 luciferase reporter construct. Luciferase activity was measured 72 h later. Luciferase activity without cotransfection with RAR/RXR and CBP was defined as 1. Values are means ± S.D., n = 3. ANOVA showed a significant stimulatory effect of CBP and RAR/RXR on hSP-B 500, p < 0.05.

RA Stimulation of the hSP-B Promoter Is TTF-1 Site-dependent-- There are three previously identified TTF-1 sites in the hSP-B enhancer region (12). These TTF-1 sites are required for enhancer stimulatory activity. Interestingly, the clustered TTF-1 sites are located in close juxtaposition to the clustered RARE sites in the enhancer region of the hSP-B promoter. To test if the clustered TTF-1 sites are required for RA stimulatory activity on the hSP-B promoter, the wild type and three TTF-1 site mutants of hSP-B500 were transfected into H441 cells and treated with all-trans-RA (10⁵ M), respectively. As demonstrated in Fig. 7, mutations at two TTF-1 sites (B^am and B^bm) completely abolished the RA stimulation of the hSP-B promoter, whereas mutation at B^cm only partially reduced RA stimulation. Therefore, RA stimulation of the hSP-B promoter is dependent on TTF-1 DNA binding to the B^a and B^b sites of the hSP-B enhancer region.

View larger version (24K): [in this window] [in a new window]   Fig. 7.   TTF-1 sites are required for all-trans-RA stimulatory activity of the hSP-B enhancer. H441 cells were transfected with 0.25 µg of the wild type and mutant B-500 luciferase reporter constructs at the TTF-1 site (Bam, 434 bp; Bbm, 399 bp; Bcm, 386 bp, respectively, see Ref. 12). The next day, cells were treated with 105 M of all-trans-RA. Controls were untreated. Luciferase activity was measured 48 h later. Luciferase activities without all-trans-RA treatment were defined as 1. Values are means ± S.D.; n = 3. ANOVA showed a significant stimulatory effect of all-trans-RA on wild type hSP-B 500 and hSP-B 500 Bcm, p < 0.05.

Synergistic Stimulation of hSP-B500 by TTF-1, RAR, and Nuclear Receptor Coactivators-- Since TTF-1-binding sites in the enhancer region are required for RA stimulation of hSP-B500, combinatorial stimulatory effects between TTF-1 and RAR, CBP or coactivators were characterized in cotransfection studies (Table I). The effect of TTF-1 and RAR stimulation of hSP-B 500 were synergistic rather than additive increasing activity (11.8 versus 5.1-fold) in the luciferase reporter assay. The synergistic effect was strongest between TTF-1 and TIF2 (15.0- versus 5.3-fold). Strong synergy was noted between TTF-1 and SRC-1 or ACTR (10.2 versus 4.4-fold and 8.6 versus 5.1-fold, respectively), whereas synergy between TTF-1 and CBP was modest (5.8- versus 4.2-fold).

View this table: [in this window] [in a new window]   Table I Synergistic stimulation between TTF-1, RAR, and coactivators H441 cells were cotransfected into 6-well plates with 2.0 µg/well total DNA containing 0.5 µg of hSP-B500-luciferase reporter vector and 0.5 µg of TTF-1, or RAR, or coactivators or combination. The CMV--galactosidase expression vector (0.5 µg) was also contransfected for normalizing transfection efficiency. Luciferase activity was measured 72 h later and in light units/absorbance of -galactosidase. Activity of hSP-B500 with the empty expression vector PCR3 was defined as 1. Values represent the mean ± S.D. (n = 3).

Interactions between TTF-1 and RAR/TIF2 in the Mammalian Two-hybrid System-- To prove further that TTF-1 interacts with RAR and coactivators, TTF-1 was subcloned into the pVP16 vector containing the VP16 activation domain (AD), and RAR and TIF2 were subcloned into the pM vector containing the GAL4-binding domain (BD). The pVP16/TTF-1 AD, pM/RAR BD, and pM/TIF2 BD constructs were transfected alone or cotransfected into H441 cells. The luciferase reporter construct pG5LUC containing five GAL4-binding sites was also cotransfected into H441 cells to monitor the protein-protein interactions. When compared with transfection of pVP16/TTF-1 AD, pM/RAR BD, or pM/TIF2 BD alone, luciferase activities were markedly increased in cotransfection with the pair of pVP16/TTF-1 AD and pM/RAR BD, and with the pair of pVP16/TTF-1 AD and pM/TIF2 BD, respectively (Fig. 8). These findings identified direct protein-protein interactions between TTF-1 and RAR/TIF2 in H441 cells.

View larger version (22K): [in this window] [in a new window]   Fig. 8.   Interactions between TTF-1 and RAR/TIF2 in H441 cells using the mammalian two-hybrid system. The luciferase reporter construct pG5LUC (0.5 µg) containing five GAL4-binding sites were cotransfected with pVP16/TTF-1 AD (0.5 µg) and pM/RAR BD or pM/TIF2 BD (0.5 µg), respectively, into H441 cells to monitor protein-protein interactions. pVP16/TTF-1 AD (0.5 µg), pM/RAR BD (0.5 µg), and pM/TIF2 BD (0.5 µg) transfection alone were controls. Luciferase activity was measured 72 h later. Values are means ± S.D., n = 3.

The Clustered RARE Region Confers RA and RAR Stimulation on the SV40 Promoter in the Absence of Downstream TTF-1 Sites of the hSP-B Promoter-- In addition to the clustered TTF-1 sites located in the enhancer region, two more TTF-1 sites were identified downstream the enhancer region, located between 73 and 111 bp of the hSP-B promoter (54). To test if these TTF-1 sites are required for RA stimulation of the hSP-B promoter, a hSP-B(331 to 500) fragment lacking the downstream TTF-1 sites was subcloned upstream of an SV40 promoter luciferase reporter gene. The SV40/hSP-B(331 to 500) luciferase construct and the SV40 basic promoter luciferase construct (control) were transfected into H441 cells to study RA and RAR/RXR stimulatory effects (Fig. 9). The luciferase activity of SV40/hSP-B(331 to 500) was induced 3-4-fold by all-trans-RA (10⁵ M), whereas the SV40 promoter alone was not affected by all-trans-RA. Even though hRAR/hRXR stimulated the activity of the SV40 promoter, the enhanced activity was not RA-dependent and was reduced by all-trans-RA. It has been reported that RAR contains ligand-independent transactivation domains (30, 32,). On the other hand, all-trans-RA dramatically stimulated the SV40/hSP B(331 to 500) activity (31-fold) when cotransfected with hRAR/hRXR. Therefore, the downstream TTF-1 sites of the hSP-B promoter are not required for RA stimulation mediated by the hSP-B enhancer. Of interest, the clustered RARE and TTF-1 sites of the hSP-B enhancer had much stronger RA stimulatory effect on the SV40 promoter than that of the hSP-B promoter (31- versus 8-fold).

View larger version (17K): [in this window] [in a new window]   Fig. 9.   RARE sites within the hSP-B enhancer confer RA and RAR responsiveness to the SV40 promoter. The hSP-B(331/500) enhancer region containing RARE sites was subcloned upstream of the SV40 promoter luciferase reporter construct. H441 cells were cotransfected with 0.5 µg of hRAR, hRXR, and 0.25 µg of SV40 or SV40/hSP-B(331/500) luciferase reporter vectors. The next day, cells were treated with 105 M all-trans-RA. Controls were left untreated. Luciferase activity was measured 48 h later. Luciferase activities of SV40 and SV40/hSP-B(331/500) without hRAR/RXR in the absence of all-trans-RA were defined as 1. Values are means ± S.D., n = 3. ANOVA showed a significant stimulatory effect of all-trans-RA and RAR on SV40/hSP-B(331/500), p < 0.05.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Multiple signaling pathways regulate hSP-B gene transcription or mRNA stability in respiratory epithelial cells (12, 54-58). In previous studies, RA stimulated hSP-B gene expression (16, 17, 19, 20). It is generally believed that the DNA consensus sequences located in the promoter and enhancer regions of target genes mediate cellular signaling pathways through binding sequence-specific transcription factors. Previous studies identified an enhancer region located between 331 to 500 bp of the hSP-B gene, which strongly regulates SP-B gene transcription (12). This enhancer region is well conserved among species, with human and murine genes sharing 95% homology in this region. Further characterization demonstrated that the enhancer region of the hSP-B promoter contains three TTF-1 sites (12). In the present study, three clustered RARE sites were identified in the enhancer region located immediately upstream of the TTF-1 sites to regulate the response of the hSP-B promoter to RA.

A direct repetition of two core motifs ((A/G)G(G/T)TCA) was identified as essential for RAR and RXR binding (classical RARE). The spacing (DR1, DR3, DR4, and DR5) and orientation of the repeated core motifs are thought to determine the DNA binding specificity of some nuclear receptors (59). This rule seems not very restrictive since inverted and reverted repeats with different DRs in several natural promoters are able to bind to RAR (60). The polarity of the RAR/RXR dimer in DNA binding appears to be an important factor in determining gene specificity (61-63). A sequence in the hSP-B enhancer region shares some degree of homology to the direct repetition of the classic RARE (16). However, mutagenesis in the core motifs of the direct repetition in the sequence still retained RAR binding activity (data not shown). RARE sequences other than the classic (A/G)G(G/T)TCA are able to bind to the RAR/RXR dimer and mediate RA function. One example is the retinol-binding protein gene. In its promoter region, sequences TGTCCT and TGCCCG bound to and determined RAR/RXR stimulation (53). Three such identical consensus sequences were identified in the hSP-B enhancer region (Fig. 4). Although RAREs (S1, S2, and S3) were bound to RAR, single mutations in the RARE clustered sites partially impaired RA stimulatory activity in the hSP-B promoter, whereas deletion of all three RARE sites or mutations of two RARE sites (S1/S3) resulted in complete loss of RA stimulation (Fig. 4).

There are three isotypes (, , and ) of RAR mediating RA function in cells. Immunohistochemistry study demonstrated that only RAR was detected in mouse type II epithelial cells where SP-B is synthesized and processed (Fig. 1). This finding is in agreement with our previous findings that RAR was detected in the epithelium of the fetal mouse lung (21) and in H441 cells that share characteristics of non-ciliated bronchiolar cells (16). Therefore, RAR may play a role in mediating RA signaling in the distal airways. In contrast, RAR is expressed in the tracheal epithelium and mesenchyme early in fetal development and continues to be expressed in the newly formed proximal airways but is excluded from the distal respiratory epithelium (28). RAR gene expression may represent an early marker of mucosecretory differentiation of normal human bronchial epithelial cells (64).

In addition to interacting directly with basal transcription factors, RAR has another important function, recruiting nuclear receptor coactivators in the presence of RA. These nuclear receptor coactivators physically interact with the AF-2 domain of RAR in a ligand-dependent fashion and are expressed in the lung (34, 35, 39, 40). The present study demonstrates that nuclear receptor coactivators SRC-1, TIF2, and ACTR significantly stimulated the hSP-B promoter (Fig. 5). Many of these coactivators have intrinsic histone acetyltransferase activity that is involved in remodeling chromatin structure during gene activation. CBP physically interacts with RAR/RXR and their coactivators (35, 38-40). Although CBP had a modest stimulatory effect on the hSP-B promoter in H441 cells, cotransfection of CBP and RAR/RXR synergistically stimulated hSP-B luciferase reporter activity (Fig. 6), indicating interactions between CBP, RAR/RXR, and coactivators in pulmonary epithelial cells. Like nuclear receptor coactivators, CBP has intrinsic histone acetyltransferase activity (43, 44).

Although the RA/RAR signaling pathway is well known to be critical to epithelial cell differentiation and proliferation in a variety of tissues, little is known about how this pathway interacts with and is determined by tissue-specific factors in a particular organ system. The present study demonstrated that in the pulmonary epithelial system, RA stimulation of the hSP-B promoter through RARE sites is dependent on the juxtaposed clustered TTF-1 sites in the enhancer region of the hSP-B promoter because mutations at these sites reduced or abolished RA stimulation (Fig. 7). In addition, TTF-1 interacts with RAR and TIF2 in the mammalian two-hybrid system (Fig. 8). TTF-1 also synergistically stimulated hSP-B500 with RAR, SRC-1, TIF2, ACTR, and CBP (Table I), strongly suggesting the involvement and requirement of TTF-1 in the formation of the RAR·CBP·coactivators complex in the enhancer region of the hSP-B promoter. The downstream TTF-1 sites (73 to 111 bp) of the hSP-B promoter seem not to be required for RA stimulation. After separation from the downstream TTF-1 sites, the clustered RARE sites in the enhancer region still rendered the SV40 promoter responsive to stimulation by RA (Fig. 9). Therefore, the upstream enhancer works as an independent unit in which the tissue-specific factor TTF-1 determines RA/RAR signaling activity in pulmonary epithelial cells. The RAR·RXR·TTF-1·CBP·coactivator complex in the enhancer region of the SP-B gene may play an important role in the temporal and spatial expression of SP-B during lung development.

	ACKNOWLEDGEMENTS

We thank Dr. R. Evans for providing the ACTR expression vector; Dr. B. O'Malley for providing the SRC-1 expression vector; Drs. P. Chambon and H. Gronemeyer for providing the RAR, RXR, and TIF-2 expression vectors; and Dr. R. Goodman for providing the CBP expression vector. We thank Dana Fiedeldey and Dr. Ward Rice for assisting with the isolation of type II epithelial cells.

	FOOTNOTES

^* This work was supported by an American Lung Association grant (to C. Y.), NHLBI Grant HL-61803 from the National Institutes of Health (to C. Y.), and Specialized Center of Research Grants HL-56387 (to J. A. W. and C. Y.) and HL38859 (to J. A. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The first two authors contributed equally to this work.

^§ To whom correspondence should be addressed: Children's Hospital Medical Center, Division of Pulmonary Biology, TCHRF, 3333 Burnet Ave., Cincinnati, OH 45229-3039. Tel.: 513-636-7990; Fax: 513-636-7868; E-mail: Cong.Yan@chmcc.org.

	ABBREVIATIONS

The abbreviations used are: SP-A, surfactant protein A; SP-B, surfactant protein B; SP-C, surfactant protein C; SP-D, surfactant protein D; h, human; RA, retinoic acid; RAR, retinoid nuclear receptor; RXR, retinoid X receptor; RARE, retinoic acid responsive element; CBP, CREB-binding protein; CREB, cAMP-response element binding protein; ACTR, activator of thyroid and retinoic acid receptor; SRC-1, steroid receptor coactivator-1; TIF2, transcriptional intermediary factor 2; HAT, histone acetyltransferase; TTF-1, thyroid transcription factor 1; PCR, polymerase chain reaction; AD, activation domain; EMSA, electrophoretic mobility shift assay; BD, binding domain; ANOVA, analysis of variance; bp, base pair; DR, direct repeat.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				T. Tomita, T. Kido, R. Kurotani, S.-i. Iemura, E. Sterneck, T. Natsume, C. Vinson, and S. Kimura CAATT/Enhancer-binding Proteins {alpha} and {delta} Interact with NKX2-1 to Synergistically Activate Mouse Secretoglobin 3A2 Gene Expression J. Biol. Chem., September 12, 2008; 283(37): 25617 - 25627. [Abstract] [Full Text] [PDF]

				Y. Maeda, V. Dave, and J. A. Whitsett Transcriptional Control of Lung Morphogenesis Physiol Rev, January 1, 2007; 87(1): 219 - 244. [Abstract] [Full Text] [PDF]

				K. H. Thomas, P. Meyn, and N. Suttorp Single nucleotide polymorphism in 5'-flanking region reduces transcription of surfactant protein B gene in H441 cells Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L386 - L390. [Abstract] [Full Text] [PDF]

				S. Lin, A.-K. T. Perl, and J. M. Shannon Erm/Thyroid Transcription Factor 1 Interactions Modulate Surfactant Protein C Transcription J. Biol. Chem., June 16, 2006; 281(24): 16716 - 16726. [Abstract] [Full Text] [PDF]

				Y. Maeda, T. C. Hunter, D. E. Loudy, V. Dave, V. Schreiber, and J. A. Whitsett PARP-2 Interacts with TTF-1 and Regulates Expression of Surfactant Protein-B J. Biol. Chem., April 7, 2006; 281(14): 9600 - 9606. [Abstract] [Full Text] [PDF]

				J. Xu, J. Tian, and S. D. Shapiro Normal Lung Development in RAIG1-Deficient Mice Despite Unique Lung Epithelium-Specific Expression Am. J. Respir. Cell Mol. Biol., May 1, 2005; 32(5): 381 - 387. [Abstract] [Full Text] [PDF]

				C. Yan and H. Du Alveolus formation: what have we learned from genetic studies? J Appl Physiol, October 1, 2004; 97(4): 1543 - 1548. [Abstract] [Full Text] [PDF]

				J. A. Whitsett, C. J. Bachurski, K. C. Barnes, P. A. Bunn Jr., L. M. Case, D. N. Cook, D. Crooks, M. W. Duncan, L. Dwyer-Nield, R. C. Elston, et al. Functional Genomics of Lung Disease Am. J. Respir. Cell Mol. Biol., August 1, 2004; 31(2/S1): S1 - S81. [Full Text] [PDF]

				L. Yang, X. Lian, A. Cowen, H. Xu, H. Du, and C. Yan Synergy between Signal Transducer and Activator of Transcription 3 and Retinoic Acid Receptor-{alpha} in Regulation of the Surfactant Protein B Gene in the Lung Mol. Endocrinol., June 1, 2004; 18(6): 1520 - 1532. [Abstract] [Full Text] [PDF]

				K.-S. Park, J. A. Whitsett, T. Di Palma, J.-H. Hong, M. B. Yaffe, and M. Zannini TAZ Interacts with TTF-1 and Regulates Expression of Surfactant Protein-C J. Biol. Chem., April 23, 2004; 279(17): 17384 - 17390. [Abstract] [Full Text] [PDF]

				M. Hind and M. Maden Retinoic acid induces alveolar regeneration in the adult mouse lung Eur. Respir. J., January 1, 2004; 23(1): 20 - 27. [Abstract] [Full Text] [PDF]

				C. J. Bachurski, G. H. Yang, T. A. Currier, R. M. Gronostajski, and D. Hong Nuclear Factor I/Thyroid Transcription Factor 1 Interactions Modulate Surfactant Protein C Transcription Mol. Cell. Biol., December 15, 2003; 23(24): 9014 - 9024. [Abstract] [Full Text] [PDF]

				L. Yang, D. Yan, C. Yan, and H. Du Peroxisome Proliferator-activated Receptor {gamma} and Ligands Inhibit Surfactant Protein B Gene Expression in the Lung J. Biol. Chem., September 19, 2003; 278(38): 36841 - 36847. [Abstract] [Full Text] [PDF]

				L. Yang, A. Naltner, and C. Yan Overexpression of Dominant Negative Retinoic Acid Receptor {alpha} Causes Alveolar Abnormality in Transgenic Neonatal Lungs Endocrinology, July 1, 2003; 144(7): 3004 - 3011. [Abstract] [Full Text] [PDF]

				L. Yang, A. Naltner, A. Kreiner, D. Yan, A. Cowen, H. Du, and C. Yan An enhancer region determines hSP-B gene expression in bronchiolar and ATII epithelial cells in transgenic mice Am J Physiol Lung Cell Mol Physiol, March 1, 2003; 284(3): L481 - L488. [Abstract] [Full Text] [PDF]

				L. W. Gonzales, S. H. Guttentag, K. C. Wade, A. D. Postle, and P. L. Ballard Differentiation of human pulmonary type II cells in vitro by glucocorticoid plus cAMP Am J Physiol Lung Cell Mol Physiol, November 1, 2002; 283(5): L940 - L951. [Abstract] [Full Text] [PDF]

				C. Li, N.-L. Zhu, R. C. Tan, P. L. Ballard, R. Derynck, and P. Minoo Transforming Growth Factor-beta Inhibits Pulmonary Surfactant Protein B Gene Transcription through SMAD3 Interactions with NKX2.1 and HNF-3 Transcription Factors J. Biol. Chem., October 4, 2002; 277(41): 38399 - 38408. [Abstract] [Full Text] [PDF]

				S. Miccadei, R. De Leo, E. Zammarchi, P. G. Natali, and D. Civitareale The Synergistic Activity of Thyroid Transcription Factor 1 and Pax 8 Relies on the Promoter/Enhancer Interplay Mol. Endocrinol., April 1, 2002; 16(4): 837 - 846. [Abstract] [Full Text] [PDF]

				C. Yan, A. Naltner, M. Martin, M. Naltner, J. M. Fangman, and O. Gurel Transcriptional Stimulation of the Surfactant Protein B Gene by STAT3 in Respiratory Epithelial Cells J. Biol. Chem., March 22, 2002; 277(13): 10967 - 10972. [Abstract] [Full Text] [PDF]

				T. Murate, M. Suzuki, M. Hattori, A. Takagi, T. Kojima, T. Tanizawa, H. Asano, T. Hotta, H. Saito, S. Yoshida, et al. Up-regulation of Acid Sphingomyelinase during Retinoic Acid-induced Myeloid Differentiation of NB4, a Human Acute Promyelocytic Leukemia Cell Line J. Biol. Chem., March 15, 2002; 277(12): 9936 - 9943. [Abstract] [Full Text] [PDF]

				M. Strayer, R. C. Savani, L. W. Gonzales, A. Zaman, Z. Cui, E. Veszelovszky, E. Wood, Y.-S. Ho, and P. L. Ballard Pre- and Postnatal Lung Development, Maturation, and Plasticity: Human surfactant protein B promoter in transgenic mice: temporal, spatial, and stimulus-responsive regulation Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L394 - L404. [Abstract] [Full Text] [PDF]

				C. Liu, S. W. Glasser, H. Wan, and J. A. Whitsett GATA-6 and Thyroid Transcription Factor-1 Directly Interact and Regulate Surfactant Protein-C Gene Expression J. Biol. Chem., February 1, 2002; 277(6): 4519 - 4525. [Abstract] [Full Text] [PDF]

				R. Lonigro, D. Donnini, E. Zappia, G. Damante, M. E. Bianchi, and S. Guazzi Nestin Is a Neuroepithelial Target Gene of Thyroid Transcription Factor-1, a Homeoprotein Required for Forebrain Organogenesis J. Biol. Chem., December 14, 2001; 276(51): 47807 - 47813. [Abstract] [Full Text] [PDF]

				A. Naltner, S. Wert, J. A. Whitsett, and C. Yan Temporal/spatial expression of nuclear receptor coactivators in the mouse lung Am J Physiol Lung Cell Mol Physiol, December 1, 2000; 279(6): L1066 - L1074. [Abstract] [Full Text] [PDF]

				R. A. Pierce and J. Michael Shipley Retinoid-Enhanced Alveolization . Identifying Relevant Downstream Targets Am. J. Respir. Cell Mol. Biol., August 1, 2000; 23(2): 137 - 141. [Full Text]

				C. Yan, A. Naltner, J. Conkright, and M. Ghaffari Protein-Protein Interaction of Retinoic Acid Receptor alpha and Thyroid Transcription Factor-1 in Respiratory Epithelial Cells J. Biol. Chem., June 8, 2001; 276(24): 21686 - 21691. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Naltner, A. Articles by Yan, C. Search for Related Content PubMed PubMed Citation Articles by Naltner, A. Articles by Yan, C. Social Bookmarking                      What's this?