HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gerlach, A. C. Articles by Devor, D. C. Search for Related Content PubMed PubMed Citation Articles by Gerlach, A. C. Articles by Devor, D. C. Social Bookmarking                      What's this?

J Biol Chem, Vol. 275, Issue 1, 585-598, January 7, 2000

Kinase-dependent Regulation of the Intermediate Conductance, Calcium-dependent Potassium Channel, hIK1^*

Aaron C. Gerlach, Nupur N. Gangopadhyay, and Daniel C. Devor

From the Department of Cell Biology and Physiology, University of Pittsburgh, Pittsburgh, Pennsylvania 15261

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

We determined the effect of nucleotides and protein kinase A (PKA) on the Ca²⁺-dependent gating of the cloned intermediate conductance, Ca²⁺-dependent K⁺ channel, hIK1. In Xenopus oocytes, during two-electrode voltage-clamp, forskolin plus isobutylmethylxanthine induced a Ca²⁺-dependent increase in hIK1 activity. In excised inside-out patches, addition of ATP induced a Ca²⁺-dependent increase in hIK1 activity (NP_o). In contrast, neither nonhydrolyzable (AMP-PNP, AMP-PCP) nor hydrolyzable ATP analogs (GTP, CTP, UTP, and ITP) activated hIK1. The ATP-dependent activation of hIK1 required Mg²⁺ and was reversed by either exogenous alkaline phosphatase or the PKA inhibitor PKI_5-24. The Ca²⁺ dependence of hIK1 activation was best fit with a stimulatory constant (K_s) of 350 nM and a Hill coefficient (n) of 2.3. ATP increased NP_o at [Ca²⁺] >100 nM while having no effect on K_s or n. Mutation of the single PKA consensus phosphorylation site at serine 334 to alanine (S334A) had no effect on the PKA-dependent activation during either two-electrode voltage-clamp or in excised inside-out patches. When expressed in HEK293 cells, ATP activated hIK1 in a Mg²⁺-dependent fashion, being reversed by alkaline phosphatase. Neither PKI_5-24 nor CaMKII_281-309 or PKC_19-31 affected the ATP-dependent activation. Northern blot analysis revealed hIK1 expression in the T84 colonic cell line. Endogenous hIK1 was activated by ATP in a Mg²⁺- and PKI_5-24-dependent fashion and was reversed by alkaline phosphatase, whereas CaMKII_281-309 and PKC_19-31 had no effect on the ATP-dependent activation. The Ca²⁺-dependent activation (K_s and n) was unaffected by ATP. In conclusion, hIK1 is activated by a membrane delimited PKA when endogenously expressed. Although the oocyte expression system recapitulates this regulation, expression in HEK293 cells does not. The effect of PKA on hIK1 gating is Ca²⁺-dependent and occurs via an increase in NP_o without an effect on either Ca²⁺ affinity or apparent cooperativity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Ca²⁺-dependent K⁺ channels (K_Ca) participate in a multitude of physiological processes by coupling intracellular Ca²⁺ signaling to membrane voltage in both excitable and nonexcitable cells. Traditionally, K_Ca channels have been classified as large (BK_Ca), small (SK_Ca), and intermediate (IK_Ca) conductance based on their single channel conductance in symmetric K⁺ solutions (1, 2). BK_Ca and SK_Ca channels have been studied extensively in neurons where these channels contribute to action potential repolarization and hyperpolarization. In contrast, the IK_Ca channels have been shown to function primarily in a variety of peripheral nonexcitable cells including secretory epithelia (3-6), erythrocytes (7, 8), and lymphocytes (9, 10). Although Ca²⁺ is the primary regulator of K_Ca channel gating, phosphorylation has been reported to modulate each of these K_Ca channels (11). Because Ca²⁺ and cAMP act in concert to modulate a diverse array of physiological processes, an understanding of the integration between phosphorylation and Ca²⁺ at the level of these K⁺ channels is critical in fully appreciating their role in these processes. This synergism between Ca²⁺ and cAMP has been most extensively studied on the BK_Ca channels; PKA-mediated phosphorylation alters both the Ca²⁺ and voltage sensitivity of these channels (12-14). Indeed, the PKA phosphorylation site underlying this response has recently been identified (15).

We previously characterized an IK_Ca channel in both colonic and airway epithelia that was activated by Ca²⁺-mediated agonists (3, 4). These channels were blocked with high affinity by both charybdotoxin (16) and clotrimazole (17, 18). Activation of these channels is critical to maintaining the electrochemical driving force for transepithelial Cl secretion. This is especially true in colonic epithelia, where it was originally proposed that Ca²⁺-mediated agonists stimulate Cl secretion solely via the activation of basolateral membrane K⁺ channels, relying on constitutively active apical membrane Cl channels to carry current across the apical membrane (19). Ca²⁺- and cAMP-mediated agonists produce synergistic effects on Cl secretion across colonic epithelia (20). Although it is generally thought that this effect is due to cAMP-dependent kinase (PKA)¹ activation of apical membrane CFTR, thereby removing apical chloride conductance from being rate-limiting, the synergistic effects of these two agonists on IK_Ca has been little studied. Indeed, in airway epithelia, norepinephrine functions as a dual agonist, simultaneously raising both Ca²⁺ and cAMP, resulting in the activation of IK_Ca (21). Thus, IK_Ca channels are likely under a dual modulatory role in secretory epithelia being activated by Ca²⁺ as well as PKA. However, in contrast to the BK_Ca channels, a detailed understanding of the mechanism by which PKA-dependent phosphorylation modulates the Ca²⁺-dependent gating of IK_Ca channels has not been reported.

Ishii et al. (22) and Joiner et al. (23) recently reported the cloning of an IK_Ca channel. This cloned channel exhibits an identical biophysical and pharmacological profile to that which we previously reported for the IK_Ca channel expressed in the colonic cell line, T84. We took advantage of the recent cloning of hIK1 to further define the mechanism by which PKA-dependent phosphorylation modulates the Ca²⁺-dependent gating of hIK1. We demonstrate that hIK1 is activated via a membrane-associated PKA and that the stimulatory effect of PKA is Ca²⁺-dependent, resulting in an increase in total current flow (NP_o) while having no effect on either the affinity or apparent cooperativity of hIK1 for Ca²⁺. However, the stimulatory effect of PKA-mediated phosphorylation on hIK1 activity is independent of the only PKA consensus site, serine 334. These results suggest that the Ca²⁺- and cAMP-dependent signaling pathways intersect at the level of hIK1 to modulate transepithelial ion transport.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Oocyte Preparation-- Xenopus laevis care and handling procedures were in accordance with University of Pittsburgh guidelines. X. laevis were obtained from either Xenopus 1 (Dexter, MI) or Nasco (Fort Atkinson, WI). Frogs were anesthetized with 3-aminobenzoic acid ethyl ester, the ovaries were surgically removed, and the oocytes were dissected in modified Barth's solution containing 88 mM NaCl, 2.4 mM NaHCO₃, 1 mM KCl, 0.82 mM MgSO₄, 0.33 mM Ca(NO₃), 0.41 mM CaCl₂, 10 mM HEPES, and 1% penicillin-streptomycin. The oocyte follicular cells were removed by incubation in 5 mg/ml collagenase (Life Technologies, Inc.) plus 0.5 mg/ml trypsin inhibitor in Ca²⁺-free ND-96 (96 mM NaCl, 1 mM KCl, 1 mM MgCl₂, 5 mM HEPES; pH adjusted to 7.5 with NaOH) at room temperature for ~60 min. The oocytes were then incubated in 100 mM K₂HPO₄ (pH adjusted to 6.5 with HCl) containing 1 mg/ml bovine serum albumin for 30 min to remove any remaining follicular cells. Stage 5 and 6 oocytes were presorted and allowed to incubate overnight in modified Barth's solution at 20 °C prior to injection of cRNA.

RNA Synthesis, Quantitation, and Injection-- Dr. John Adelman (Vollum Institute, Oregon Health Sciences University) generously provided hIK1 cDNA in the oocyte expression vector pBF containing both 5'- and 3'-untranslated regions of the Xenopus -globin gene flanking the multi-cloning site. The plasmid was linearized using PvuI (Roche Molecular Biochemicals), and 5' capped cRNAs were generated using SP6 polymerase (mMESSAGE mMACHINE^TM In Vitro Transcription Kit, Ambion). cRNAs were evaluated both spectrophotometrically and by agarose gel electrophoresis with ethidium bromide staining. Oocytes were injected with 5-50 ng of cRNA 2-7 days prior to recording.

Two-electrode Voltage-Clamp-- Oocytes were mounted in a recording chamber maintained at room temperature. Macroscopic currents were measured with the two-electrode voltage-clamp method using a GeneClamp 500B amplifier (Axon Instruments). Data were sampled at 100 Hz using Axoscope software (Axon Instruments). Electrodes were fabricated from borosilicate glass (Kimax-51, Kimble) and pulled on a vertical puller (Narishige) having a resistance of 0.3-5 M when filled with 3 M KCl. Oocytes were continuously superfused with high K⁺-ND96 containing 96 mM KCl, 1 mM MgCl₂, 1.8 mM CaCl₂, and 5 mM HEPES (pH adjusted to 7.5 with KOH) at room temperature and held at a holding voltage of 60 mV such that activation of a K⁺ current resulted in an inward current flow.

Expression of hIK1 in HEK293 Cells-- hIK1 was subcloned from pBF into the mammalian expression vector pcDNA3.1 (Invitrogen) and transfected into HEK293 cells using LipofectAMINE (Life Technologies, Inc.) according to the manufacturers instruction's. Cells were grown in Dulbecco's modified Eagle's medium plus 10% fetal bovine serum and maintained under continuous selection using G418 (1 mg/ml).

Patch-Clamp Recording-- The oocyte vitelline membrane was mechanically dissected prior to patch-clamping in a hypertonic solution containing 200 mM potassium gluconate, 20 mM KCl, 1 mM MgCl₂, 10 mM EGTA, and 10 mM HEPES (pH adjusted to 7.4 with NaOH). Single-channel currents were recorded in the inside-out patch configuration using an Axon 200B amplifier (Axon Instruments) and stored on videotape for later analysis. Pipettes were fabricated from number 8161 glass (World Precision Instruments) and heat polished to resistances of 3-6 M. The pipette solution contained 145 mM potassium gluconate, 5 mM KCl, 2.5 mM MgCl₂, 10 mM HEPES, and 1 mM EGTA (pH adjusted to 7.4 with KOH). The bath contained 145 mM potassium gluconate, 5 mM KCl, 2.5 mM MgCl₂, 10 mM HEPES, and 1 mM EGTA (pH adjusted to 7.2 with KOH). Sufficient CaCl₂ was added to obtain the desired free [Ca²⁺] (program kindly provided by Dr. Dave Dawson, University of Michigan). For experiments with no added Ca²⁺, Ca²⁺ was excluded from the bath, and EGTA was maintained at 1 mM (estimated free Ca²⁺ <10 nM). For Mg²⁺ free experiments, 1 mM N-(2-hydroxyethyl)-ethylenediamine-triacetic acid (HEDTA) was added to the bath solution in the absence of added MgCl₂. Ca²⁺ was clamped at a free concentration of 10 µM in all conditions with the Ca²⁺ and Mg²⁺ chelating properties of HEDTA, EGTA, and ATP taken into account using Maxchelator, version 1.7 (24). All recordings were done at a holding potential of 100 mV. The voltage is referenced to the extracellular compartment, as is the standard method for membrane potentials. Inward currents are defined as the movement of positive charge from the extracellular compartment to the intracellular compartment and are presented as downward deflections from the base line in all recording configurations.

Single-channel analysis was performed on records sampled after low pass filtering at 400 Hz. The NP_o (the product of the number of channels and the channel open probability) of the channels was determined using Biopatch software (version 3.3, Bio-Logic). NP_o was calculated from the mean total current (I) divided by the single channel current amplitude (i), such that NP_o = I/i. The single channel current amplitude was determined from the best gaussian fit of the amplitude histogram. Changes in [Ca²⁺] or [ATP] were not found to alter the i of hIK1 in low activity patches. Therefore, to determine NP_o for high activity patches, Ca²⁺ was titrated at the end of an experiment until i could accurately be determined by amplitude histogram analysis. Diary plots were constructed by averaging NP_o over a range of 30-120-s intervals of the experimental record.

Site-directed Mutagenesis-- Ser³³⁴ was mutated to alanine (S334A) using the QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. Polymerase chain reactions were carried out using a CGCAGGAAGGAGGCTCATGCTGCCCG primer coupled with a complimentary primer, where the bold letter indicates the change from wild type hIK1. Point mutations were confirmed by sequencing (ABI PRISM 377 automated sequencer, University of Pittsburgh) and sequence alignment (NCBI Blast 2.0) with hIK1 (accession number AF022150).

mRNA Isolation and Northern Blot Analysis-- Poly(A)⁺ mRNA was isolated from confluent T84 and Calu-3 monolayers using the Fast track 2.0 kit (Invitrogen). 3 µg of mRNA was run in a 1% agarose gel and transferred to nitrocellulose. The blot was probed in Expresshyb solution (CLONTECH) at 68 °C with [³²P]dCTP-labeled DNA fragments made by random priming of a cDNA template corresponding to amino acid residues 319-427 of hIK1 and including 100 base pairs of 3'-untranslated sequence, stringently washed at 65 °C with 0.1× SSPE, 0.1% SDS and exposed to film for 24 h at 80 °C with two intensifying screens.

T84 and Calu-3 Cell Culture-- T84 cells were grown in Dulbecco's modified Eagle's medium and Ham's F-12 (1:1) supplemented with 14 mM NaHCO₃, 10% newborn calf serum, and 1% penicillin-streptomycin. Calu-3 cells were grown Dulbecco's modified Eagle's medium/Ham's F-12 (1:1) supplemented with 14 mM NaHCO₃, 15% fetal bovine serum, 2 mM glutamine, and 1% penicillin-streptomycin. All cells were incubated in a humidified atmosphere containing 5% CO₂ at 37 °C, and the medium was replaced every 2 days. For patch-clamp experiments, cells were plated onto glass coverslips 6-48 h prior to experimentation.

Chemicals-- Ionomycin, forskolin, AMP-PNP, AMP-PCP, GTP, PKI_5-24, CaMKII_281-309, PKC_19-31, and H-89 were purchased from Calbiochem. CTP, UTP, ITP, ADP, IBMX, and alkaline and acid phosphatase were obtained from Sigma. ATP was obtained from Roche Molecular Biochemicals. Charybdotoxin was obtained from Accurate Chemical and Scientific and was made as a 10 µM stock solution in water. Ionomycin was made as a 5,000-fold stock solution in Me₂SO, forskolin as a 1,000-fold stock solution in ethanol, H-89 as a 1,000-fold stock solution in Me₂SO, CaMKII_281-309 and PKC_19-31 as a 1000-fold stock solution in water, and PKI_5-24 as 10,000-fold stock solution in water.

Data Analysis-- All data are presented as the means ± S.E., where n indicates the number of experiments. Statistical analysis was performed using a Student's t test. A value of p < 0.05 was considered statistically significant and reported. Nonlinear curve fitting of the concentration-response data were iteratively fitted with a Michaelis-Menten-Hill equation using SigmaPlot (version 3.0; Jandel Scientific, San Rafael, CA).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Effect of Ionomycin and Forskolin/IBMX on TEVC Oocyte Currents-- Initially we determined whether hIK1 heterologously expressed in Xenopus oocytes could be activated by the cAMP elevating agents forskolin (10 µM) and IBMX (1 mM) using the TEVC technique. As shown in Fig. 1, addition of forskolin and IBMX alone had no effect on current flow across the oocyte membrane. In 14 experiments the control current averaged 0.13 ± 0.03 µA, and this was not increased by forskolin/IBMX (0.14 ± 0.01 µA). Following washout of the forskolin/IBMX mixture, addition of the Ca²⁺ ionophore, ionomycin (1 µM) resulted in an increase in inward current, consistent with activation of hIK1 in our recording conditions (see "Materials and Methods"). Following establishment of a stable current, the reapplication of forskolin/IBMX in the continued presence of ionomycin resulted in a potentiated current that was sensitive to inhibition by the known hIK1 inhibitor, charybdotoxin (CTX, 50 nM). In 14 experiments, ionomycin increased current to 1.33 ± 0.36 µA, and this was further increased 2-fold by the addition of forskolin/IBMX to 2.51 ± 0.42 µA (p < 0.001). Addition of CTX reduced current to 0.44 ± 0.14 µA. Noninjected oocytes responded to neither ionomycin nor forskolin/IBMX (n = 6; data not shown). These data demonstrate that although elevated cAMP alone does not activate hIK1, it produces a synergistic activation in the presence of elevated intracellular Ca²⁺.

View larger version (16K): [in this window] [in a new window]   Fig. 1.   Calcium-dependent activation of hIK1 by cAMP-mediated agonists. hIK1 heterologously expressed in Xenopus oocytes was studied using the two-electrode voltage-clamp technique in high K+ ND96 at a holding potential of 60 mV. Intracellular Ca2+ was elevated with ionomycin (1 µM), whereas cAMP was elevated by forskolin (10 µM) plus IBMX (1 mM). In the absence of elevated intracellular Ca2+, forskolin plus IBMX failed to activate hIK1. However, subsequent to raising intracellular Ca2+ with ionomycin, increasing cAMP stimulated an increase in inward K+ current, which was blocked by CTX (50 nM).

Effect of ATP on hIK1 Activity in Excised Inside-out Xenopus Oocyte Patches-- Our TEVC results suggest that PKA-mediated phosphorylation of hIK1 results in activation of the channel in a Ca²⁺-dependent manner. To define this mechanism of activation we utilized the excised inside-out patch-clamp technique on Xenopus oocytes heterologously expressing hIK1. Initially, we confirmed expression of hIK1 based on its current-voltage (I-V) relationship, Ca²⁺ dependence and inhibition by clotrimazole (data not shown). Based on the Ca²⁺ dependence of hIK1, we utilized 400 nM free Ca²⁺ in our studies, because either an increase or decrease in hIK1 NP_o could readily be resolved. Similar to what has been reported for a wide range of ion channels, following patch excision, hIK1 activity (NP_o) slowly declined until a new steady-state level was achieved (Fig. 2B). Following this "rundown" in activity, channels could easily be resolved as shown for one patch in Fig. 2A. To begin to elucidate the mechanism by which phosphorylation activates hIK1, we perfused ATP (1 mM) into the bath to provide substrate for exogenously added PKA. However, as shown in Fig. 2, addition of ATP alone resulted in the activation of hIK1. Indeed, upon perfusion of ATP, hIK1 activity slowly and steadily increased to levels greater than or equal to the activity first seen upon patch excision. Following the establishment of a new steady-state NP_o, activity remained stable until the end of the experiment (Fig. 2B). Removal of Ca²⁺, in the continued presence of ATP, resulted in a complete inhibition of channel activity, demonstrating an absolute requirement for Ca²⁺ in the gating of hIK1. In 44 experiments ATP increased NP_o from 2.16 ± 0.50 to 5.79 ± 1.28 (p < 0.001). Removal of bath Ca²⁺ resulted in a decrease in NP_o to 0.018 ± 0.006. The single channel current amplitude was unaffected by ATP (control, i = 3.15 ± 0.12; ATP, i = 3.18 ± 0.05) as determined by the best gaussian fit to the single channel current amplitude distribution. These data suggest a role for nucleotide binding, hydrolysis, and or phosphorylation in the regulation of hIK1.

View larger version (25K): [in this window] [in a new window]   Fig. 2.   Effect of ATP on hIK1 in an excised inside-out membrane patch. hIK1 heterologously expressed in Xenopus oocytes was studied using excised inside-out patches in symmetric K+ gluconate with 400 nM free Ca2+ in the bath at a holding potential of 100 mV. A, addition of ATP (1 mM) resulted in an increase in hIK1 activity (control, NPo = 0.04; ATP, NPo = 0.78). The arrows indicate the closed state of the channel. B, a representative diary plot sampled at 30-s intervals showing hIK1 activation in response to ATP.

The Effect of ATP Analogs on hIK1 Activity in Inside-out Patches from Xenopus Oocytes-- Our results demonstrate that ATP activates hIK1 in excised inside-out patches. This activation could be due to a direct effect of nucleotides on hIK1 or a secondary effect via an associated kinase. In an initial attempt to distinguish among these possibilities, we determined the effect of several additional nucleotides, both hydrolyzable and nonhydrolyzable. As shown in Fig. 3A, addition of the poorly hydrolyzable ATP analog, AMP-PCP (300 µM) had no effect on channel gating. However, subsequent addition of ATP (300 µM) resulted in a 6-fold increase in NP_o, as described above. Similarly, AMP-PNP (300 µM) failed to activate hIK1 (Fig. 3B). The average data for these nucleotides are shown in Fig. 3B. In the presence of 400 nM Ca²⁺, NP_o averaged 1.88 ± 0.64 (n = 7), which was not significantly affected by either AMP-PNP (1.88 ± 0.49) or AMP-PCP (1.99 ± 0.85), whereas the subsequent addition of ATP increased NP_o to 7.38 ± 2.48 (p < 0.01). These results suggest that the ATP-dependent activation of hIK1 is not directly nucleotide-dependent and further indicate the possible involvement of an associated kinase.

View larger version (33K): [in this window] [in a new window]   Fig. 3.   Effect of nucleotides on hIK1 channel activity. hIK1 was expressed in Xenopus oocytes, and channel activity was recorded from excised inside-out patches in symmetric K+ gluconate with 400 nM free Ca2+ in the bath at a holding potential of 100 mV. All nucleotides were tested at a concentration of 300 µM. A, addition of AMP-PCP had no effect on channel activity (control, NPo = 0.30; AMP-PCP, NPo = 0.31), whereas the subsequent addition of ATP resulted in an activation of hIK1 (NPo = 1.79) that was Ca2+ dependent (NPo = 0.00). B, summary data for all nucleotide experiments (all tested at 300 µM). Control NPo was defined as 1.0. All nucleotides tested failed to significantly affect hIK1 activity. However, subsequent perfusion of ATP resulted in an average 3.5-fold increase in activity compared with control (*, p < 0.001).

Based on our above results we evaluated the effects of additional nucleotides on hIK1 activity. The results of these experiments are summarized in Fig. 3B. In four experiments sequential addition of the hydrolyzable nucleotide triphosphates GTP, CTP, UTP, and ITP (all 300 µM) failed to induce an increase in channel activity. However, the subsequent perfusion of ATP (300 µM) resulted in a 2.5-fold increase in NP_o (control, NP_o = 0.91 ± 0.25; ATP, NP_o = 2.47 ± 0.44; p < 0.001). To determine whether the -phosphate of ATP is important for hIK1 activation, we evaluated the effect of ADP on hIK1 activity. Like the other nucleotides, ADP failed to activate hIK1 (control, NP_o = 1.16 ± 0.41; ADP, NP_o = 1.16 ± 0.35), whereas the addition of ATP increased NP_o to 2.28 ± 0.46 (n = 5). Finally, we determined whether cAMP could activate hIK1. However, as shown in Fig. 3B, cAMP failed to modulate hIK1 activity (n = 6). These results demonstrate an absolute requirement for both adenosine and a hydrolyzable -phosphate in the nucleotide-dependent activation of hIK1.

The Effect of Mg²⁺ on the ATP-dependent Activation of hIK1-- Our nucleotide results suggest that the ATP-dependent activation of hIK1 relies upon nucleotide hydrolysis and/or phosphorylation. To further evaluate this possibility, we determined whether the ATP-dependent stimulation of hIK1 requires Mg²⁺; Mg²⁺ is a necessary cofactor for ATP to serve as a substrate for ATPases and kinases. For these experiments free Ca²⁺ was maintained at 10 µM. As shown in Fig. 4, addition of ATP (1 mM) in the absence of Mg²⁺ failed to activate hIK1 in excised inside-out patches. However, the subsequent addition of Mg²⁺ (2.5 mM) in the continued presence of ATP resulted in activation of hIK1. This effect was reversible, because removal of Mg²⁺ resulted in a decrease in channel activity. The time course for one such experiment is illustrated as a diary plot in Fig. 4B. In seven experiments, control NP_o was 22.52 ± 6.69, and this was not affected by addition of ATP in the absence of Mg²⁺ (17.96 ± 5.85), whereas the readdition of Mg²⁺ resulted in an increase in NP_o to 28.68 ± 8.65 (p < 0.01). These results further suggest that the ATP-dependent activation of hIK1 is dependent upon hydrolysis and/or phosphorylation and is not due to direct nucleotide interaction.

View larger version (35K): [in this window] [in a new window]   Fig. 4.   ATP-induced stimulation of hIK1 is Mg2+-dependent. hIK1 was expressed in Xenopus oocytes, and channel activity recorded from excised inside-out patches in symmetric K+ gluconate at a holding potential of 100 mV. The patch was exposed to 10 µM free bath Ca2+ in an HEDTA (1 mM) Mg2+ chelating solution. In the absence of Mg2+, ATP failed to stimulate hIK1. However, subsequent inclusion of Mg2+ (2.5 mM) resulted in a 3-fold increase in hIK1 activity. After steady-state activation was achieved, the patch was perfused with the previous Mg2+-free ATP containing solution, which resulted in a decline in channel activity to base line. Removal of Ca2+ eliminated the K+ current confirming expression of hIK1. A, 20-s current tracings representing each experimental condition. Arrows denote the closed state of the channel. B, diary plot sampled at 30-s intervals of the experiment.

Effect of Alkaline Phosphatase on ATP-stimulated hIK1 Activity-- To discriminate between ATP hydrolysis and phosphorylation in the ATP-dependent activation of hIK1, we evaluated the effect of exogenously added alkaline phosphatase. Alkaline phosphatase would be expected to reverse only phosphorylation-dependent activation of hIK1. The results of one experiment are shown in Fig. 5. Following activation of hIK1 with ATP (1 mM), addition of alkaline phosphatase (5 units/ml) reduced channel activity (NP_o) to below control levels. Indeed, removal of ATP, in the continued presence of alkaline phosphatase resulted in a further decrease in channel activity, which was recoverable upon readdition of ATP. In six experiments ATP increased NP_o from 4.91 ± 2.38 to 13.88 ± 4.75 with the subsequent perfusion of alkaline phosphatase reducing NP_o to 5.10 32 ± 1.57 (p < 0.05). Following washout of ATP, alkaline phosphatase alone further reduced NP_o to 2.40 ± 0.84. The subsequent addition of ATP increased NP_o to 10.68 ± 3.59, and this was completely reversed by removal of Ca²⁺ (NP_o = 0.06 ± 0.05). Similar to our results with alkaline phosphatase, acid phosphatase (5 units/ml) reversed the ATP-dependent activation of hIK1 (control, NP_o = 1.86 ± 1.94; ATP, NP_o = 21.11 ± 7.68; ATP + acid phosphatase, NP_o = 4.88 ± 0.97; n = 5, p < 0.05). These data suggest that the ATP-induced activation of hIK1 is due to phosphorylation of hIK1 itself or of a closely associated protein.

View larger version (36K): [in this window] [in a new window]   Fig. 5.   The effect of alkaline phosphatase on ATP-stimulated hIK1 activity. hIK1 activity expressed in Xenopus oocytes was studied in excised inside-out membrane patches in symmetric K+ gluconate in the presence of 400 nM Ca2+ at a holding potential of 100 mV. A, addition of ATP (1 mM) resulted in activation of hIK1, which was reversed by the addition of alkaline phosphatase (alk. phos., 5 units/ml). Removal of ATP, in the continued presence of alkaline phosphatase caused a further decrease in channel activity that was recoverable upon readdition of ATP. Arrows denote the closed state of the channels. B, summary data for six experiments are shown. The NPo of hIK1 for each condition was: control = 4.91 ± 2.38, ATP = 13.88 ± 4.75, ATP + alkaline phosphatase = 5.10 ± 1.57 (*, p < 0.05), alkaline phosphatase alone = 2.40 ± 0.84, readdition of ATP = 10.68 ± 3.59.

Our results demonstrate that alkaline phosphatase reduced hIK1 activity to below control levels, suggesting that some base-line activity of hIK1 is due to the channel being in a phosphorylated state. This possibility was evaluated by determining the effect of alkaline phosphatase on hIK1 following patch excision prior to addition of ATP. As shown in Fig. 6 (A and B) addition of alkaline phosphatase (5 units/ml) resulted in a decrease in channel activity to below control levels that was not reversed upon washout; consistent with a portion of this base-line activity being due to phosphorylated channels. The subsequent addition of ATP (1 mM) resulted in a large increase in NP_o. As summarized in Fig. 6C, alkaline phosphatase reduced NP_o from 12.02 ± 3.18 to 5.59 ± 1.35 (n = 7, p < 0.05) with washout having no effect on NP_o (6.06 ± 1.53). The subsequent perfusion of ATP increased NP_o to 18.07 ± 5.06 (p < 0.01). These data further suggest that phosphorylation of hIK1 and/or a closely associated protein can modulate its activity.

View larger version (41K): [in this window] [in a new window]   Fig. 6.   Effect of alkaline phosphatase on basal hIK1 activity. A, hIK1 expressed in a Xenopus oocyte was studied in an excised inside-out membrane patch in the presence of 400 nM Ca2+ at a holding potential of 100 mV. Addition of alkaline phosphatase (5 units/ml) resulted in a decrease in channel activity compared with control, which did not recover upon washout of alkaline phosphatase. Addition of ATP (1 mM) activated the channel in a Ca2+-dependent manner. Arrows denote the closed state of the channels. B, diary plot for a different patch showing the time course for inhibition of channel activity by alkaline phosphatase (alk. phos.) and activation by ATP. C, summary data for seven experiments are shown. Alkaline phosphatase reduced hIK1 NPo from 12.02 ± 3.18 to 5.59 ± 1.35 (*, p < 0.05). Washout of alkaline phosphatase had no effect on channel activity, NPo = 6.06 ± 1.53. However, addition of ATP increased NPo to 18.07 ± 5.06 (p < 0.01).

Effect of PKA Inhibitors on ATP-dependent Activation of hIK1 in Xenopus Oocytes-- Our TEVC data suggest that a PKA-dependent pathway can activate hIK1 in the presence of elevated Ca²⁺. Also, our patch-clamp data suggest that PKA could be associated with the membrane. Based on these studies, we determined whether the PKA inhibitors PKI_5-24 and H-89 could inhibit the ATP-dependent activation of hIK1 in excised inside-out patches. As shown in Fig. 7, subsequent to activation of hIK1 by ATP, addition of PKI_5-24 (100 nM) reduced channel activity, which was recovered upon washout of PKI_5-24. The time course for this experiment is shown as a diary plot in Fig. 7B. In 10 experiments ATP (1 mM) increased NP_o from 1.94 ± 0.81 to 4.53 ± 1.68, and this was subsequently reduced to 3.39 ± 1.34 (p < 0.05) upon addition of PKI_5-24. Similarly, H-89 (2 µM) reduced NP_o from 8.27 ± 2.97 to 5.25 ± 3.17 (p < 0.01, n = 5). These results suggest that the ATP-dependent activation is via a PKA-mediated phosphorylation event.

View larger version (31K): [in this window] [in a new window]   Fig. 7.   Inhibition of ATP-dependent stimulation of hIK1 by the PKA pseudosubstrate, PKI5-24. hIK1 channels expressed in Xenopus oocytes were recorded from excised inside-out patches in symmetric K+ gluconate at a holding potential of 100 mV. hIK1 channel activity was stimulated by perfusion of ATP (1 mM) into the bath (not shown). Addition of PKI5-24 (100 nM), in the continued presence of ATP, reduced channel activity which was recoverable upon washout of the PKI5-24. A, 30-s current tracings from a representative experiment. Arrows denote the closed state of the channel. B, diary plot representation of the experiment shown in A. Data points were sampled at 30-s intervals.

Effect of Phosphorylation on the Calcium Dependence of hIK1-- Phosphorylation of BK channels has been shown to alter their Ca²⁺ dependence such that there is a parallel shift in the P_o versus voltage relationship (12-14). In contrast, the effect of phosphorylation on the Ca²⁺ dependence of hIK1 has previously not been reported. Thus, we determined the effect of ATP-dependent phosphorylation on the Ca²⁺ dependence of hIK1 in excised inside-out patches from Xenopus oocytes. For these experiments, the excised patch was initially incubated with alkaline phosphatase (5 units/ml) until a steady-state level of activity was achieved. Then, a Ca²⁺ concentration-response relationship was established in the presence of a lower amount of alkaline phosphatase (1 unit/ml). After reaching a saturating Ca²⁺ concentration (10 µM), alkaline phosphatase was washed out and ATP (1 mM) was perfused into the bath. Upon reaching a new steady-state level of activation, a complete Ca²⁺ concentration-response relationship was generated again on the same patch in the continued presence of ATP. The result of one such experiment is shown in Fig. 8A. ATP induced a large increase in NP_o at all concentrations of Ca²⁺ above 100 nM. For this single experiment there was no a shift in either Ca²⁺ affinity (alkaline phosphatase, K_s = 123 nM; ATP, K_s = 86 nM) or the Ca²⁺-dependent cooperativity associated with activation (alkaline phosphatase, Hill coefficient = 2.1; ATP, Hill coefficient = 2.3). Similar results were obtained in three experiments in which both concentration-response curves were generated on the same patch.

View larger version (11K): [in this window] [in a new window]   Fig. 8.   Effect of phosphorylation on the Ca2+ dependence of hIK1. hIK1 channels heterologously expressed in Xenopus oocytes were recorded from excised inside-out membrane patches in symmetric potassium gluconate at a holding potential of 100 mV using the indicated concentrations of Ca2+. Complete Ca2+ concentration response data were generated in either phosphorylating (ATP) or dephosphorylating (alkaline phosphatase, alk. phos., 1 unit/ml) conditions. A, Ca2+ concentration-response relationships are shown for a single experiment. A complete Ca2+ concentration-response curve was run in the continuous presence of ATP. Following maximal activation, alkaline phosphatase was added to the bath solution until a new steady-state level of activity was achieved. A second Ca2+ concentration response relationship was then generated on the same patch in the continued presence of alkaline phosphatase. ATP-dependent activation of hIK1 resulted in an increase in Vmax without a change in either the Ks (ATP, Ks = 86 nM; alkaline phosphatase, Ks =123 nM) or apparent cooperativity as determined by the Hill coefficient (ATP, Hill coefficient = 2.3; alkaline phosphatase, Hill coefficient = 2.1). B, histogram showing the effect of ATP and alkaline phosphatase on channel NPo at saturating (10 µM) concentrations of Ca2+. Alkaline phosphatase caused a significant decrease in NPo (*, p < 0.01).

In additional experiments, in which both concentration-response curves could not be generated on the same patch, we determined the effects of phosphorylation on the Ca²⁺ dependence of hIK1 following maximal activation with 10 µM Ca²⁺. That is, we either generated a complete Ca²⁺ concentration-response curve in the presence of alkaline phosphatase followed by the addition of ATP at 10 µM Ca²⁺ or generated a complete Ca²⁺ concentration-response curve in the presence of ATP followed by addition of alkaline phosphatase at 10 µM Ca²⁺. In this way we were able to determine affinities and Hill coefficients for Ca²⁺ in the presence/absence of phosphorylation while verifying the role of phosphorylation at a maximal concentration of Ca²⁺ in each patch. The results of seven experiments (three of which had both concentration-response curves carried out on the same patch as noted above) reveal that phosphorylation increases the NP_o of hIK1 at all permissive Ca²⁺ concentrations with no change in Ca²⁺ affinity (alkaline phosphatase, K_s = 350 ± 97 nM; ATP, K_s = 265 ± 53 nM). In addition, the cooperativity of Ca²⁺-dependent gating as determined by the Hill coefficient was unchanged (alkaline phosphatase, Hill coefficient = 2.30 ± 0.19; ATP, Hill coefficient = 2.61 ± 0.15). These average values for K_s and n are similar to the representative experiment illustrated in Fig. 8A. The average NP_o of hIK1 at 10 µM Ca²⁺ in the presence of ATP or alkaline phosphatase is shown in Fig. 8B. In six experiments, NP_o averaged 50.7 ± 16.2 in the presence of ATP compared with 13.9 ± 2.9 (p < 0.05) in the presence of alkaline phosphatase. These results indicate that ATP-dependent phosphorylation dramatically increases the P_o of hIK1 without changing either the Ca²⁺ affinity or cooperativity of the channel.

Effect of PKA-mediated Phosphorylation on S334A hIK1-- Our results indicate that hIK1 is activated via a PKA-mediated phosphorylation event. hIK1 contains a single dibasic PKA consensus phosphorylation site at Ser³³⁴. To determine whether phosphorylation of serine 334 is important in either the ATP- or PKA-dependent activation of hIK1, we mutated serine 334 to alanine (S334A). S334A hIK1 was evaluated using both TEVC and excised patch-clamp techniques (Fig. 9). As shown in Fig. 9A, despite mutating the only consensus PKA phosphorylation site on hIK1, ionomycin (1 µM) induced a small activation of S334A hIK1 that was dramatically potentiated by the cAMP-elevating agents forskolin (10 µM) plus IBMX (1 mM) in a CTX-dependent manner. In seven experiments, ionomycin increased K⁺ current from 0.35 ± 0.11 µA to 1.32 ± 0.47 µA with the subsequent addition of forskolin/IBMX further increasing current to 2.39 ± 0.59 µA (p < 0.01). Addition of CTX (50 nM) reduced current to 0.40 ± 0.09 µA. These results demonstrate that S334 is not critical to the activation of hIK1 by cAMP-elevating agonists.

View larger version (31K): [in this window] [in a new window]   Fig. 9.   Serine 334 does not contribute to PKA-dependent activation. Serine 334 was replaced with alanine (S334A) by site-directed mutagenesis. S334A hIK1 was heterologously expressed in Xenopus oocytes and recorded in either the TEVC (A) or inside-out patch-clamp (B) configuration. A, subsequent to ionomycin (1 µM), addition of forskolin (10 µM) plus IBMX (1 mM) resulted in a CTX (50 nM)-sensitive activation of S334A hIK1. Current was recorded at 60 mV in the TEVC configuration. B, addition of ATP (1 mM) resulted in an activation of S334A hIK1, which was reversed upon addition of PKI5-24 (100 nM). Channel activity was recorded at a holding potential of 100 mV in symmetric potassium gluconate. 30 s of data are shown for each condition. Arrows denote the closed state of the channel.

Based on our TEVC data we evaluated the effect of ATP on S334A hIK1 in excised inside-out patches. As shown in Fig. 9B, addition of ATP (1 mM) resulted in a large activation of S334A hIK1. Addition of PKI_5-24 resulted in a decrease in channel activity to control levels. In seven patches, ATP increased NP_o of S334A hIK1 from 5.67 ± 1.56 to 8.92 ± 2.86 with the subsequent addition of PKI_5-24 reducing NP_o to 5.60 ± 1.63 (p < 0.05). Expression of S334A hIK1 was confirmed based on its Ca²⁺ dependence (Ca²⁺-free, NP_o = 0.02 ± 0.01) as well as its sensitivity to the known hIK1 blocker clotrimazole (500 nM, NP_o = 0.20 ± 0.08). These data demonstrate that Ser³³⁴ is not the site of PKA-mediated phosphorylation.

Regulation of hIK1 Heterologously Expressed in HEK293 Cells-- During the course of our studies we stably expressed hIK1 in the HEK293 cell line in an attempt to expedite a molecular understanding of the regulation of hIK1 by ATP. As shown for one experiment in Fig. 10A, following patch excision in to 400 nM free Ca²⁺, and establishment of a stable base line, addition of ATP (1 mM) resulted in a large increase in channel activity similar to our results from Xenopus oocytes. In contrast to our results above, PKI_5-24 (100 nM) failed to inhibit this ATP-dependent activation. One possibility to explain these divergent results is that the kinase-dependent regulation of hIK1 is dependent upon the cell system in which it is being studied. It has recently been demonstrated that hIK1 directly associates with calmodulin (25, 26). Thus, a possible alternative to PKA-mediated regulation is regulation of hIK1 by calmodulin kinase. However, as shown in Fig. 10A, the CaMKII inhibitory peptide, CaMKII_281-309 (2 µM) also had no effect on channel activity. Removal of ATP resulted in a decrease in channel activity, as expected if a phosphatase is associated with the membrane patch. In a total of six experiments, the average NP_o in the presence of 400 nM Ca²⁺ was 12.45 ± 5.00, and this increased to 57.83 ± 19.01 in the presence of ATP (1 mM). The subsequent addition of CaMKII_281-309 (60.80 ± 19.41) followed by PKI_5-24 (59.19 ± 18.77) had no effect on NP_o, whereas the subsequent washout of ATP reduced NP_o to 36.43 ± 11.89 (p < 0.05). Removal of bath Ca²⁺ totally abolished channel activity as expected (0.14 ± 0.03). In an additional four experiments, we evaluated the effect of the PKC inhibitory peptide, PKC_19-31. Similar to our above results, PKC_19-31 (1 µM) had no effect on the ATP-dependent activation of hIK1 (control, NP_o = 1.67 ± 2.14; ATP, NP_o = 16.63 ± 5.34; PKC_19-31, NP_o = 18.46 ± 9.23).

View larger version (12K): [in this window] [in a new window]   Fig. 10.   ATP-dependent regulation of hIK1 heterologously expressed in HEK293 cells. A, diary plot of channel activity following patch excision in to 400 nM free Ca2+. ATP (1 mM) increased hIK1 NPo, which was insensitive to addition of CaMKII281-309 (2 µM) and PKI5-24 (100 nM), whereas removal of ATP and bath Ca2+ (0 Ca2+) resulted in a decrease in channel activity. B, diary plot of channel activity following patch excision in to 10 µM free Ca2+. In the absence of Mg2+, ATP (1 mM) failed to activate hIK1. The subsequent addition of Mg2+-ATP resulted in activation of hIK1, which was reversed by removal of bath Ca2+ (0 Ca2+). Channel activity was recorded in the excised inside-out patch configuration at a holding potential of 100 mV in symmetric potassium gluconate. Each data point represents the average NPo for 1 min of recording.

Our results suggest that, in contrast to our data from Xenopus oocytes, the ATP-dependent activation of hIK1 in HEK293 cells is not associated with PKA-dependent phosphorylation. Based on these observations, we determined whether the ATP-dependent gating was dependent upon Mg²⁺, whether nonhydrolyzable analogs of ATP would activate the channel, and whether alkaline phosphatase would reverse the ATP-dependent activation. The Mg²⁺ dependence of activation is shown in Fig. 10B. Following patch excision in to 10 µM free Ca²⁺, channel activity declined to a stable level. Addition of ATP (1 mM) in the absence of Mg²⁺ (1 mM HEDTA) failed to activate the channel, although the subsequent addition of Mg²⁺ in the continued presence of ATP resulted in channel activation. In five experiments, NP_o averaged 20.59 ± 8.91 in the presence of 10 µM Ca²⁺, and this was unchanged by ATP addition in the absence of Mg²⁺ (22.75 ± 10.06). The subsequent addition of Mg²⁺ resulted in activation of hIK1 (72.46 ± 29.31) that was completely reversed by removal of Ca²⁺ (0.08 ± 0.03).

In an additional three experiments we determined whether the nonhydrolyzable analog, AMP-PCP (1 mM) would activate hIK1. AMP-PCP failed to increase channel activity above control levels (400 nM Ca²⁺, NP_o = 7.35 ± 1.42; AMP-PCP, NP_o = 8.79 ± 1.35), whereas the subsequent addition of ATP (1 mM) increased NP_o to 33.25 ± 7.41. Finally, alkaline phosphatase (1 unit/ml) completely reversed the ATP-dependent activation of hIK1 expressed in HEK293 cells (400 nM Ca²⁺, NP_o = 2.94 ± 0.96; ATP, NP_o = 27.99 ± 8.02; alkaline phosphatase, NP_o = 5.21 ± 1.32; n = 5, p < 0.05). These results suggest that the ATP-dependent activation of hIK1 observed in HEK293 cells is via an associated kinase, although our data argue against a role for PKA, PKC, or CaMKII.

Endogenous Expression and PKA-dependent Modulation of hIK1-- Our divergent results on the kinase-dependent regulation of hIK1 obtained in Xenopus oocytes and HEK293 cells prompted us to evaluate the effect of ATP on endogenously expressed hIK1. Previously, we (3, 4) and others (5, 6, 27, 28) described an IK_Ca channel in colonic and airway epithelia with similar biophysical and pharmacological properties to those of hIK1. This channel provides the electrochemical driving force for Ca²⁺-mediated transepithelial ion transport (19). Initially, we performed Northern blot analysis on mRNA isolated from the human T84 colonic crypt and the Calu-3 airway serous cell lines to confirm that the endogenous channel was in fact hIK1. The results of this experiment are shown in Fig. 11. Our probe detected a single band of approximately 2.4 kilobases in both cell lines. This is identical to the main transcript size originally reported by both Ishii et al. (22) and Joiner et al. (23), thereby demonstrating expression of hIK1 in these epithelial cells.

View larger version (63K): [in this window] [in a new window]   Fig. 11.   Expression of hIK1 in secretory epithelia. Poly(A)+ mRNA was isolated from both T84 colonic crypt and Calu-3 airway serous cell lines, and 3 µg of each was run on a 1% agarose gel and transferred to nitrocellulose. The mRNA was hybridized with random primed [32P]dCTP-labeled fragments from a cDNA template corresponding to amino acids 319-427 of hIK1 and extending an additional 100 base pairs of the 3'-untranslated region. The blot was washed with 0.1- SSPE buffer and 0.1% SDS at 65 °C and exposed to film for 24 h at 80 °C. A single transcript of approximately 2.4 kilobases, corresponding to hIK1, was recognized in both cell lines.

We therefore determined whether endogenously expressed hIK1 could be activated by membrane-associated PKA, similar to our results in Xenopus oocytes, or whether the endogenous channel was regulated by a distinct kinase as with our HEK293 cell experiments. Initially, we determined whether nonhydrolyzable analogs of ATP would activate hIK1 in T84 cells. In three experiments NP_o averaged 4.96 ± 1.45 following patch excision in to 400 nM free Ca²⁺. Addition of either 300 µM ADP (5.04 ± 0.90) or AMP-PNP (3.72 ± 1.77) had no effect on channel NP_o, whereas the subsequent addition of ATP (300 µM) increased NP_o to 7.22 ± 1.45 (p < 0.05) in a Ca²⁺-dependent manner (0 Ca²⁺, NP_o = 0.01 ± 0.01). This ATP-dependent activation was also dependent upon Mg²⁺. In the absence of Mg²⁺, ATP failed to activate hIK1 (control NP_o = 4.25 ± 1.11; Mg²⁺-free ATP, NP_o = 3.99 ± 0.94), whereas the subsequent addition of Mg²⁺-ATP increased NP_o to 8.74 ± 1.84 (n = 5). Finally, addition of alkaline phosphatase (1 unit/ml) reversed the ATP-dependent activation of hIK1 expressed in T84 cells. In four experiments ATP increased NP_o from 4.70 ± 1.57 to 7.75 ± 1.64, and this was reduced to 1.98 ± 0.65 by alkaline phosphatase. Indeed, similar to what we observed in oocytes, alkaline phosphatase reduced channel activity to below control levels, suggesting that some of the activity observed following patch excision is due to phosphorylated channels.

Our initial results on endogenously expressed hIK1 in T84 cells are identical to what we observed in oocytes and HEK293 cells heterologously expressing hIK1. Therefore we determined whether we could attribute this ATP-dependent activation to PKA as in the oocyte model. The results of these experiments are shown in Fig. 12. Similar to what we previously described (3), excision of patches from T84 cells into 400 nM Ca²⁺ allowed us to resolve channels with little activity. Addition of ATP (1 mM) resulted in activation of endogenous hIK1 (Fig. 12A). The subsequent addition of CaMKII_281-309 (2 µM) had no effect on channel activity, whereas the addition of PKI_5-24 (100 nM) reversed the ATP-dependent activation of endogenous hIK1 (Fig. 12A). A time course for the experiment shown in Fig. 12A is illustrated as a diary plot in Fig. 12B. In four similar experiments, the NP_o averaged 0.70 ± 0.33 in the presence of 400 nM Ca²⁺, and this was increased to 2.31 ± 1.6 by ATP. The subsequent addition of CaMKII_281-309 had no effect on channel NP_o (2.38 ± 1.7), whereas PKI_5-24 reduced NP_o to 0.92 ± 0.61. The effect of PKI_5-24 was confirmed in an additional nine experiments in which ATP increased NP_o from 0.48 ± 0.16 to 1.02 ± 0.31 with the subsequent addition of PKI_5-24 decreasing NP_o to control levels (0.67 ± 0.23, p < 0.05). The PKC inhibitory peptide, PKC_19-31 was also evaluated. In four experiments, PKC_19-31 (1 µM) had no effect on the ATP-dependent activity (400 nM Ca²⁺, NP_o = 1.78 ± 0.82; ATP, NP_o = 4.67 ± 2.12; PKC_19-31, NP_o = 5.10 ± 2.54). These results demonstrate that endogenous hIK1 expressed in colonic epithelia is activated by PKA associated with the membrane patch, whereas calmodulin kinase and PKC have no effect on channel gating.

View larger version (39K): [in this window] [in a new window]   Fig. 12.   Inhibition of ATP-dependent activation of endogenous hIK1 by PKI5-24. Endogenous hIK1 was studied in excised inside-out patches from the T84 human colonic crypt cell line at a holding potential of 100 mV in symmetric potassium gluconate. A, addition of ATP (1 mM, second trace) increased channel activity compared with control (400 nM Ca2+, first trace). Whereas addition of CaMKII281-309 (2 µM) had no effect on channel activity (third trace), PKI5-24 (fourth trace) reversed the ATP-dependent activation of hIK1. Each sweep is 30 s in duration. B, diary plot representation of the experiment shown in A. The record is sampled at 2-min intervals.

Effect of PKA-dependent Phosphorylation on Ca²⁺-dependent Gating of Endogenous hIK1-- Our results demonstrate that a membrane-associated PKA is capable of activating hIK1 expressed in T84 cells. When heterologously expressed in Xenopus oocytes this PKA-mediated regulation results in an increase in NP_o with no change in Ca²⁺ affinity (K_s) or cooperativity (n) of gating. Thus, we determined whether a similar mechanism of action could explain the activation of endogenous hIK1. These experiments were carried out in a manner identical to that outlined above for Xenopus oocytes. That is, a complete concentration-response relationship was generated for Ca²⁺ in the presence of alkaline phosphatase (1 unit/ml) to determine both the K_s and n for Ca²⁺ of dephosphorylated hIK1. Once a saturating concentration of Ca²⁺ was reached (10 µM), the alkaline phosphatase was removed, and ATP (1 mM) was added to demonstrate activation of hIK1 by ATP at saturating levels of Ca²⁺. The Ca²⁺ was then decreased to 30 nM, and a complete Ca²⁺ concentration-response curve was generated in the presence of ATP. Importantly, the entire experiment was conducted on a single patch. The results of these experiments are shown in Fig. 13. As shown in Fig. 13A, for a single patch the K_s and n were not different in the presence of alkaline phosphatase (K_s = 152 nM, n = 1.7; open circles) and ATP (K_s = 162 nM, n = 2.0; filled circles), although the NP_o was increased at all concentrations of Ca²⁺ above 80 nM in the presence of ATP. Fig. 13B shows the time course for activation of hIK1 by ATP in the presence of 10 µM Ca²⁺ followed by the return to 30 nM free Ca²⁺ for the experiment shown in Fig. 13A. Similar to our oocyte and HEK293 data, the activation by ATP took several minutes to reach a stable value, consistent with a kinase-mediated event. The average increase in NP_o by ATP at 10 µM Ca²⁺ is shown in Fig. 13C. Similar results were obtained in a total of four experiments. In the presence of alkaline phosphatase the K_s averaged 184 ± 52 nM with a Hill coefficient of 2.0 ± 0.1, and these values were not affected by the addition of ATP (K_s = 194 ± 43 nM, n = 1.7 ± 0.1). These results demonstrate that endogenous hIK1 is activated by a membrane-associated PKA via an increase in V_max with no change in Ca²⁺ affinity or cooperativity of gating, similar to our results in Xenopus oocytes.

View larger version (12K): [in this window] [in a new window]   Fig. 13.   Effect of phosphorylation on the Ca2+ dependence of endogenous hIK1. Endogenous hIK1 channels from T84 cells were recorded from excised inside-out membrane patches in symmetric potassium gluconate at a holding potential of 100 mV using the indicated concentrations of Ca2+. Complete Ca2+ concentration response data were generated either in phosphorylating (ATP) or dephosphorylating (alkaline phosphatase, alk. phos., 1 unit/ml) conditions. A, Ca2+ concentration-response relationships are shown for a single experiment. A complete Ca2+ concentration-response curve was run in the continuous presence of alkaline phosphatase (1 unit/ml, open circles). Following maximal activation, ATP (1 mM) was added to the bath solution until a new steady-state level of activity was achieved. A second Ca2+ concentration response relationship was then generated on the same patch in the continued presence of ATP (filled circles). ATP-dependent activation of hIK1 resulted in an increase in Vmax without a change in either the Ks (ATP, Ks = 162 nM; alkaline phosphatase, Ks = 152 nM) or apparent cooperativity as determined by the Hill coefficient (ATP, Hill coefficient = 2.0; alkaline phosphatase, Hill coefficient = 1.7). B, diary plot of the experiment shown in A demonstrating the time course of ATP-dependent activation of hIK1 in the presence of 10 µM Ca2+ followed by a reduction in free Ca2+ to 30 nM. C, histogram showing the effect of ATP and alkaline phosphatase on channel NPo at saturating (10 µM) concentrations of Ca2+. Alkaline phosphatase caused a significant decrease in NPo (*, p < 0.01).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Ca²⁺-dependent K⁺ channels play a critical role in maintaining a hyperpolarized membrane potential in response to Ca²⁺-mediated agonists. However, during physiological responses cells are often confronted with both increased levels of Ca²⁺ as well as cAMP, suggesting these K_Ca channels may be under dual modulatory control. Modulation of the Ca²⁺-dependent gating of K_Ca channels by phosphorylation has been most thoroughly studied on the large conductance BK_Ca channels. This PKA-dependent phosphorylation has been shown to shift the affinity of the BK_Ca channel for Ca²⁺ such that it becomes active at physiologically relevant Ca²⁺ concentrations (12-14). The PKA consensus phosphorylation site on BK_Ca involved in this regulatory shift in Ca²⁺ affinity has recently been identified (15). Importantly the BK_Ca channels have been shown to associate with PKA in the membrane as part of a regulatory complex, further arguing for the physiological significance of this regulation (29). However, much less is known about the phosphorylation-dependent regulation of the intermediate conductance, Ca²⁺-dependent K⁺ (IK_Ca) channels. Here we provide evidence that the Ca²⁺-dependent regulation of the cloned IK_Ca channel, hIK1, can be modified by a membrane-associated PKA.

hIK1 Exists as Part of a Regulatory Complex-- In total, our data suggest that hIK1 exists associated with a regulatory complex composed minimally of hIK1 associated with calmodulin (25, 26), a phosphatase, and an protein kinase A. Although we have no direct evidence for an associated phosphatase, this is the simplest interpretation of our data. That is, upon patch excision we typically observed rundown of hIK1 to a new steady-state level of activity (Fig. 2B). Addition of exogenous phosphatase augmented this decrease in channel activity (Fig. 6), suggesting that hIK1 or an associated regulatory protein (see below) exists in a phosphorylated state upon patch excision, which is then dephosphorylated over time by an associated phosphatase. Also, upon washout of ATP from the bath, channel activity slowly declines, suggesting that a phosphatase is active in the patch and is capable of reversing the kinase-dependent activation of hIK1.

Several lines of evidence suggest that hIK1 is associated with an endogenous protein kinase A. First, activation of hIK1 is strictly dependent upon ATP; alternative nucleotide triphosphates fail to support channel activity (Fig. 3). Second, this activation depends upon the presence of a hydrolyzable -phosphate, i.e. AMP-PNP and AMP-PCP fail to activate hIK1 (Fig. 3). Third, activation of hIK1 by ATP is dependent upon Mg²⁺ (Fig. 4), consistent with this effect being kinase-mediated. Fourth, the ATP-dependent activation of hIK1 can be reversed by alkaline (Fig. 5) or acid phosphatase, arguing for a kinase-mediated process. Finally, this conclusion is supported most strongly by the demonstration that inhibitors of PKA reverse the ATP-dependent activation of hIK1 in both Xenopus oocytes (Figs. 7 and 9) and T84 cells (Fig. 12). One interpretation of these results, which we are currently evaluating, is that hIK1 is associated with a membrane delimited A-kinase anchoring protein (AKAP). AKAPs have been shown to be intimately associated with L-type Ca²⁺ channels (30, 31) and voltage-dependent Na⁺ channels (32), as well as a large conductance K_Ca in tracheal myocytes (33), thereby targeting the kinase to the effector protein. Interestingly, AKAP79 has been shown to bind both protein kinase A as well as phosphatase 2B (34). Because hIK1 is known to be intimately associated with calmodulin (25) this may provide a means of localizing the phosphatase with the protein kinase A. Alternatively, PKA may associate directly with hIK1 as has been recently demonstrated for the Drosophila Slowpoke BK_Ca channel (dSlo) (35).

Although our initial results were obtained using the Xenopus oocyte expression system, we also determined whether these could be extrapolated to endogenously expressed hIK1. For these studies we utilized the T84 colonic crypt cell line. Previously we reported an IK_Ca in this cell line with identical biophysical and pharmacological properties to hIK1 (3, 16, 17). Also, we recently demonstrated that the cloned hIK1 is directly activated by 1-ethyl-2-benzimidazolinone and chlorzoxazone in a Ca²⁺ dependent manner (36), similar to our previous reports on the endogenous channel (16, 37). To confirm that this channel is hIK1 we performed Northern blot analysis on poly(A)⁺ mRNA isolated from T84 cells. We detected a single transcript at ~2.4 kilobases (Fig. 11), consistent with previous reports (22, 23) confirming that T84 cells express hIK1. We demonstrate that hIK1, endogenously expressed in the T84 cell line, can be activated by ATP in a Mg²⁺-, alkaline phosphatase-, and PKI_5-24-dependent fashion (Fig. 12), consistent with modulation by a membrane-associated PKA.

In contrast to our results from Xenopus oocytes and T84 cells, the ATP-dependent activation of hIK1 in HEK293 cells was independent of PKA. The divergent results between endogenously and heterologously expressed hIK1 suggest that caution must be used in interpreting kinase-dependent regulation of hIK1 in some overexpression systems. Our results suggest that overexpression of hIK1 may overwhelm the ability of endogenous PKA to modulate channel activity, depending on the expression system being utilized. These divergent results argue for an additional protein/subunit that interacts with hIK1 to convey kinase-dependent regulation.

In support of the notion that an additional protein/subunit may interact with hIK1 to modulate its gating, Khanna et al. (26) reported that the calmodulin antagonists W-7, trifluoperazine, and calmidazolium inhibited hIK1 whole cell currents in T cells while having greatly diminished effects on hIK1 heterologously expressed in Chinese hamstar ovary cells. These results further argue that an additional protein interacts with hIK1 to regulate the channel. However, it should be noted that, in contrast to the results of Khanna et al. (26), Fanger et al. (25) reported no effect of the calmodulin antagonists, W-7, trifluoperazine, or calmidazolium on hIK1 in T cells. In addition, Khanna et al. (26) demonstrated that the CaMKII inhibitor, KN-62 reversed the Ca²⁺-dependent activation of hIK1 in T cells, whereas we observed no effect of the peptide inhibitor of CaMKII (CaMKII_281-309) on hIK1 in either T84 or HEK293 cells using the excised inside-out patch-clamp technique (Figs. 10 and 12). Although the reason for these disparities is not clear, these results further suggest that this regulatory event is not associated with the pore-forming -subunit of the channel and that expression of this alternate protein may be cell type-specific, thereby allowing for differential regulation across tissue types. In this regard, Pellegrino and Pellegrini (38) recently demonstrated the red blood cell IK_Ca is modulated by a membrane-associated PKA, likely via an AKAP. Thus, although expression of hIK1 in HEK293 cells does not accurately reflect the regulation observed on endogenous hIK1, our results indicate that an alternate kinase is capable of dramatically up-regulating channel activity. In contrast to hIK1, the highly homologous Ca²⁺-dependent K⁺ channel rSK2 is not activated by ATP.² Therefore, hIK1/rSK2 chimeras may be successfully employed to define this regulation in the HEK293 expression system.

An additional possibility for kinase-dependent regulation of a Ca²⁺-dependent K⁺ channel is modulation by PKC. However, we previously demonstrated that endogenous hIK1 expressed in T84 cells is not acutely modulated by PKC in excised inside-out patches (39). Consistent with this, we observed no effect of the peptide PKC inhibitor, PKC_19-31 on hIK1 in either T84 or HEK293 cells. In addition, mutating each of the four PKC consensus sites to alanine (T101A, S178A, T329A, and S388A) had no effect on the ATP-dependent gating of hIK1.²

PKA-dependent Regulation of hIK1 Is Ca²⁺-dependent-- Our initial TEVC studies demonstrated that hIK1 could be activated by increasing cellular cAMP. However, this activation was dependent on an elevated level of intracellular Ca²⁺ (Fig. 1), suggesting Ca²⁺ plays a permissive role in the phosphorylation-dependent activation of hIK1. These results were confirmed by our excised patch-clamp data. That is, at resting levels of cytoplasmic Ca²⁺ (80 nM) addition of ATP failed to augment channel activity (Figs. 8 and 13). We further demonstrate that the effect of phosphorylation on hIK1 channel gating is due to an increase in the V_max of the Ca²⁺ concentration relationship for hIK1 without a change in the K_s or apparent cooperativity for Ca²⁺-dependent activation (Figs. 8 and 13). The values we report here for K_s (190-350 nM) and Hill coefficient (n = 1.7-2.6) are similar to those detailed in the initial reports of the cloning of this channel (K_s = 95-300 nM, n = 1.7-3.2; Refs. 22, 23, and 40).

In contrast to our results on hIK1, PKA-dependent phosphorylation of BK_Ca channels has been shown to shift the P_o versus Ca²⁺ concentration-response curve such that there is an increased affinity of BK_Ca channels for Ca²⁺ (14). Thus, the effect of PKA-mediated phosphorylation on the Ca²⁺-dependent gating of hIK1 differs from that of the BK_Ca class of channels. This shift in V_max for the Ca²⁺-dependent activation of hIK1, as opposed to affinity, may be physiologically significant. That is, hIK1 has a K_s for Ca²⁺ (100-400 nM; Figs. 8 and 13) (22, 23) that is within the physiologically relevant range for the increase in intracellular Ca²⁺ achieved in response to Ca²⁺-mediated agonists. If phosphorylation shifted the K_s to resting levels of Ca²⁺, then these channels would be activated by cAMP-mediated agonists such that the dichotomy between cAMP- and Ca²⁺-dependent K⁺ channels would be lost. In contrast, BK_Ca channels require a shift in Ca²⁺ affinity to become active at physiologically relevant levels of intracellular Ca²⁺. Perhaps this difference in the PKA-dependent activation of IK_Ca and BK_Ca channels is a consequence of the different mechanisms by which Ca²⁺ gates these channels. The Ca²⁺-dependent gating of hIK1 has recently been shown to require interaction with bound calmodulin (25), whereas the BK_Ca channels are thought to directly bind Ca²⁺ via a series of negatively charged amino acids known as the "calcium bowl" (41). However, it is unlikely that the PKA-dependent activation of hIK1 involves an effect on calmodulin itself because the highly homologous small conductance Ca²⁺-dependent K⁺ channel rSK2 is not modulated by the addition of ATP to excised patches²; the Ca²⁺-dependent gating of rSK2 has similarly been shown to depend upon a direct interaction with calmodulin (42). To our knowledge, this report is the first to describe the effect of PKA-mediated phosphorylation on the Ca²⁺ dependence of an IK_Ca channel.

Stimulation of hIK1 Activity by PKA-mediated Phosphorylation Is Independent of Serine 334-- The PKA-dependent activation of hIK1 could be due to either a direct effect on hIK1 itself or a closely associated protein. In an attempt to elucidate which of these two possible mechanisms underlie the activation of hIK1, we mutated serine 334 to an alanine (S334A). Ser³³⁴ is the only putative PKA phosphorylation site in hIK1 as defined by the dibasic consensus sequence, RRXXS. However, S334A hIK1 was activated by forskolin plus IBMX in the TEVC configuration as well as stimulated by ATP in a PKI_5-24-dependent manner in excised inside-out patches (Fig. 9). Thus, we conclude that Ser³³⁴ alone is not the residue involved in the PKA-dependent stimulation of hIK1 channel gating. This result suggests one of two possibilities. First, PKA-dependent activation could occur via phosphorylation of a closely associated protein rather than being a direct effect on hIK1. Second, PKA could phosphorylate a nonconsensus site. For example, mutation of all ten PKA consensus phosphorylation sites on the CFTR chloride channel failed to prevent PKA-dependent activation (43). However, mutation of a nonconsensus PKA domain resulted in a dramatic decrease in the PKA-dependent regulation of CFTR (44).

Convergent Regulation of hIK1 by Ca²⁺ and PKA-- Because hIK1 activity can be modulated by membrane-associated PKA, it is likely that both calcium and cAMP-mediated pathways converge to regulate the channel. We previously demonstrated that endogenous hIK1 in T84 cells is activated by Ca²⁺-mediated agonists (3). Roch et al. (27) demonstrated this channel could also be activated by increasing cAMP during whole cell patch-clamp recording. Also, Welsh and McCann (21) demonstrated that an IK_Ca expressed in airway epithelia could be activated by norepinephrine, a dual Ca²⁺- and cAMP-mediated agonist. An important observation is the clear dissociation between intracellular Ca²⁺ and basolateral K⁺ current that exists during cholinergically mediated epithelial ion transport, suggesting that Ca²⁺ alone is insufficient to account for the modulation of hIK1 in colonic epithelia (45, 46). In addition, Barrett and colleagues (45) have demonstrated that the Ca²⁺ response to Ca²⁺-mediated agonists is blunted in the presence of elevated cAMP, although the current response is potentiated, demonstrating activation of hIK1. Our results suggest that lower levels of Ca²⁺ are required to activate hIK1 to the same level in the presence of PKA, thereby providing a rationale for the experimental results obtained in intact epithelia.

In conclusion, we demonstrate that hIK1 is activated by PKA in a Ca²⁺-dependent fashion and that this activation likely occurs via a membrane delimited kinase. This PKA-dependent activation results in an increase in total current flow (V_max) with no change in the channel affinity for Ca²⁺, a mechanism distinct from that previously described for the BK_Ca channels (14). However, our results do not allow us to conclude whether this effect of PKA is directly on the channel itself or a closely associated protein, although we can conclude that the PKA consensus site, Ser³³⁴ is not involved in this regulation. Future studies will be required to determine whether an AKAP is involved in this PKA-dependent regulation and whether hIK1 itself is directly phosphorylated. This convergent regulation by Ca²⁺ and PKA on hIK1 will be physiologically important when epithelia are under the dual modulation of cAMP- and Ca²⁺-mediated agonists resulting in a potentiated transepithelial secretory response.

	ACKNOWLEDGEMENTS

We gratefully acknowledge the superb secretarial skills of Michele Dobransky and the excellent technical assistance of Cheng Zhang Shi in Xenopus oocyte mRNA injections and two-electrode voltage-clamp experiments.

	FOOTNOTES

^* This work was supported by Cystic Fibrosis Foundation Grant DEVOR 96P0, Competitive Medical Research Fund University of Pittsburgh Medical Center Grant 3976-1000, and National Institutes of Health Grant DK54941-01 (to D. C. D.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Cell Biology and Physiology, S312 Biomedical Science Tower, University of Pittsburgh, 3500 Terrace St., Pittsburgh, PA 15261. E-mail: dd2+@pitt.edu.

² A. C. Gerlach, N. N. Gangopadhyay, and D, C. Devor, unpublished observations.

	ABBREVIATIONS

The abbreviations used are: PKA, cAMP-dependent kinase; TEVC, two-electrode voltage-clamp; HEDTA, N-(2-hydroxyethyl)-ethylenediamine-triacetic acid; AMP-PNP, adenosine 5'-(,-imino)triphosphate; AMP-PCP, adenosine 5'-(,-methylene)triphosphate; IBMX, isobutylmethylxanthine; CTX, charybdotoxin; PKC, protein kinase C; CaMKII, calmodulin kinase II; AKAP, A-kinase anchoring protein; CFTR, cystic fibrosis transmembrane conductance regulator.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				H. Klein, L. Garneau, N. T. N. Trinh, A. Prive, F. Dionne, E. Goupil, D. Thuringer, L. Parent, E. Brochiero, and R. Sauve Inhibition of the KCa3.1 channels by AMP-activated protein kinase in human airway epithelial cells Am J Physiol Cell Physiol, February 1, 2009; 296(2): C285 - C295. [Abstract] [Full Text] [PDF]

				D. Wang, Y. Sun, W. Zhang, and P. Huang Apical adenosine regulates basolateral Ca2+-activated potassium channels in human airway Calu-3 epithelial cells Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1443 - C1453. [Abstract] [Full Text] [PDF]

				Y. Gao, C. K. Chotoo, C. M. Balut, F. Sun, M. A. Bailey, and D. C. Devor Role of S3 and S4 Transmembrane Domain Charged Amino Acids in Channel Biogenesis and Gating of KCa2.3 and KCa3.1 J. Biol. Chem., April 4, 2008; 283(14): 9049 - 9059. [Abstract] [Full Text] [PDF]

				S. A. Nicolaou, L. Neumeier, Y. Peng, D. C. Devor, and L. Conforti The Ca2+-activated K+ channel KCa3.1 compartmentalizes in the immunological synapse of human T lymphocytes Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1431 - C1439. [Abstract] [Full Text] [PDF]

				S.-R. Jung, K. Kim, B. Hille, T. D. Nguyen, and D.-S. Koh Pattern of Ca2+ increase determines the type of secretory mechanism activated in dog pancreatic duct epithelial cells J. Physiol., October 1, 2006; 576(1): 163 - 178. [Abstract] [Full Text] [PDF]

				J. Ledoux, M. E. Werner, J. E. Brayden, and M. T. Nelson Calcium-Activated Potassium Channels and the Regulation of Vascular Tone Physiology, February 1, 2006; 21(1): 69 - 78. [Abstract] [Full Text] [PDF]

				S. Srivastava, P. Choudhury, Z. Li, G. Liu, V. Nadkarni, K. Ko, W. A. Coetzee, and E. Y. Skolnik Phosphatidylinositol 3-Phosphate Indirectly Activates KCa3.1 via 14 Amino Acids in the Carboxy Terminus of KCa3.1 Mol. Biol. Cell, January 1, 2006; 17(1): 146 - 154. [Abstract] [Full Text] [PDF]

				S. Srivastava, Z. Li, L. Lin, G. Liu, K. Ko, W. A. Coetzee, and E. Y. Skolnik The Phosphatidylinositol 3-Phosphate Phosphatase Myotubularin- Related Protein 6 (MTMR6) Is a Negative Regulator of the Ca2+-Activated K+ Channel KCa3.1 Mol. Cell. Biol., May 1, 2005; 25(9): 3630 - 3638. [Abstract] [Full Text] [PDF]

				V. L. Lew, T. Tiffert, Z. Etzion, D. Perdomo, N. Daw, L. Macdonald, and R. M. Bookchin Distribution of dehydration rates generated by maximal Gardos-channel activation in normal and sickle red blood cells Blood, January 1, 2005; 105(1): 361 - 367. [Abstract] [Full Text] [PDF]

				H. Ouadid-Ahidouch, M. Roudbaraki, P. Delcourt, A. Ahidouch, N. Joury, and N. Prevarskaya Functional and molecular identification of intermediate-conductance Ca2+-activated K+ channels in breast cancer cells: association with cell cycle progression Am J Physiol Cell Physiol, July 1, 2004; 287(1): C125 - C134. [Abstract] [Full Text] [PDF]

				H. M. Jones, K. L. Hamilton, G. D. Papworth, C. A. Syme, S. C. Watkins, N. A. Bradbury, and D. C. Devor Role of the NH2 Terminus in the Assembly and Trafficking of the Intermediate Conductance Ca2+-activated K+ Channel hIK1 J. Biol. Chem., April 9, 2004; 279(15): 15531 - 15540. [Abstract] [Full Text] [PDF]

				Y. Ito, M. Son, S. Sato, T. Ishikawa, M. Kondo, S. Nakayama, K. Shimokata, and H. Kume ATP Release Triggered by Activation of the Ca2+-Activated K+ Channel in Human Airway Calu-3 Cells Am. J. Respir. Cell Mol. Biol., March 1, 2004; 30(3): 388 - 395. [Abstract] [Full Text] [PDF]

				M. Son, Y. Ito, S. Sato, T. Ishikawa, M. Kondo, S. Nakayama, K. Shimokata, and H. Kume Apical and Basolateral ATP-Induced Anion Secretion in Polarized Human Airway Epithelia Am. J. Respir. Cell Mol. Biol., March 1, 2004; 30(3): 411 - 419. [Abstract] [Full Text] [PDF]

				M. Hayashi, C. Kunii, T. Takahata, and T. Ishikawa ATP-dependent regulation of SK4/IK1-like currents in rat submandibular acinar cells: possible role of cAMP-dependent protein kinase Am J Physiol Cell Physiol, March 1, 2004; 286(3): C635 - C646. [Abstract] [Full Text]

				Y. Ito, M. Son, S. Sato, T. Ohashi, M. Kondo, K. Shimokata, and H. Kume Effects of Fluoranthene, a Polycyclic Aromatic Hydrocarbon, on cAMP-Dependent Anion Secretion in Human Airway Epithelia J. Pharmacol. Exp. Ther., February 1, 2004; 308(2): 651 - 657. [Abstract] [Full Text] [PDF]

				N. A. Wolff, K. Thies, N. Kuhnke, G. Reid, B. Friedrich, F. Lang, and G. Burckhardt Protein Kinase C Activation Downregulates Human Organic Anion Transporter 1-Mediated Transport through Carrier Internalization J. Am. Soc. Nephrol., August 1, 2003; 14(8): 1959 - 1968. [Abstract] [Full Text] [PDF]

				K. L. Hamilton, C. A. Syme, and D. C. Devor Molecular Localization of the Inhibitory Arachidonic Acid Binding Site to the Pore of hIK1 J. Biol. Chem., May 2, 2003; 278(19): 16690 - 16697. [Abstract] [Full Text] [PDF]

				F. Vogalis, J. R Harvey, and J. B Furness PKA-mediated inhibition of a novel K+ channel underlies the slow after-hyperpolarization in enteric AH neurons J. Physiol., May 1, 2003; 548(3): 801 - 814. [Abstract] [Full Text] [PDF]

				C. A. Syme, K. L. Hamilton, H. M. Jones, A. C. Gerlach, L. Giltinan, G. D. Papworth, S. C. Watkins, N. A. Bradbury, and D. C. Devor Trafficking of the Ca2+-activated K+ Channel, hIK1, Is Dependent upon a C-terminal Leucine Zipper J. Biol. Chem., February 28, 2003; 278(10): 8476 - 8486. [Abstract] [Full Text] [PDF]

				E. A Cowley and P. Linsdell Oxidant stress stimulates anion secretion from the human airway epithelial cell line calu-3: implications for cystic fibrosis lung disease J. Physiol., August 15, 2002; 543(1): 201 - 209. [Abstract] [Full Text] [PDF]

				L. H. Clarson, V. H. J. Roberts, S. L. Greenwood, and A. C. Elliott ATP-stimulated Ca2+-activated K+ efflux pathway and differentiation of human placental cytotrophoblast cells Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2002; 282(4): R1077 - R1085. [Abstract] [Full Text] [PDF]

				K. Kunzelmann and M. Mall Electrolyte Transport in the Mammalian Colon: Mechanisms and Implications for Disease Physiol Rev, January 1, 2002; 82(1): 245 - 289. [Abstract] [Full Text] [PDF]

				S. M. Duffy, W. J. Lawley, E. C. Conley, and P. Bradding Resting and Activation-Dependent Ion Channels in Human Mast Cells J. Immunol., October 15, 2001; 167(8): 4261 - 4270. [Abstract] [Full Text] [PDF]

				F. Potet, J. D. Scott, R. Mohammad-Panah, D. Escande, and I. Baro AKAP proteins anchor cAMP-dependent protein kinase to KvLQT1/IsK channel complex Am J Physiol Heart Circ Physiol, May 1, 2001; 280(5): H2038 - H2045. [Abstract] [Full Text] [PDF]

				S. Singh, C. A. Syme, A. K. Singh, D. C. Devor, and R. J. Bridges Benzimidazolone Activators of Chloride Secretion: Potential Therapeutics for Cystic Fibrosis and Chronic Obstructive Pulmonary Disease J. Pharmacol. Exp. Ther., April 13, 2001; 296(2): 600 - 611. [Abstract] [Full Text]

				E. Vázquez, M. Nobles, and M. A. Valverde Defective regulatory volume decrease in human cystic fibrosis tracheal cells because of altered regulation of intermediate conductance Ca2+-dependent potassium channels PNAS, April 12, 2001; (2001) 91096498. [Abstract] [Full Text]

				C. U. Cotton Basolateral Potassium Channels and Epithelial Ion Transport Am. J. Respir. Cell Mol. Biol., September 1, 2000; 23(3): 270 - 272. [Full Text]

				D. C. Devor, R. J. Bridges, and J. M. Pilewski Pharmacological modulation of ion transport across wild-type and Delta F508 CFTR-expressing human bronchial epithelia Am J Physiol Cell Physiol, August 1, 2000; 279(2): C461 - C479. [Abstract] [Full Text] [PDF]

				C. A. Syme, A. C. Gerlach, A. K. Singh, and D. C. Devor Pharmacological activation of cloned intermediate- and small-conductance Ca2+-activated K+ channels Am J Physiol Cell Physiol, March 1, 2000; 278(3): C570 - C581. [Abstract] [Full Text] [PDF]

				A. C. Gerlach, C. A. Syme, L. Giltinan, J. P. Adelman, and D. C. Devor ATP-dependent Activation of the Intermediate Conductance, Ca2+-activated K+ Channel, hIK1, Is Conferred by a C-terminal Domain J. Biol. Chem., March 30, 2001; 276(14): 10963 - 10970. [Abstract] [Full Text] [PDF]

				E. Vazquez, M. Nobles, and M. A. Valverde Defective regulatory volume decrease in human cystic fibrosis tracheal cells because of altered regulation of intermediate conductance Ca2+-dependent potassium channels PNAS, April 24, 2001; 98(9): 5329 - 5334. [Abstract] [Full Text] [PDF]

				Y. Li and D. R. Halm Secretory modulation of basolateral membrane inwardly rectified K+ channel in guinea pig distal colonic crypts Am J Physiol Cell Physiol, April 1, 2002; 282(4): C719 - C735. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gerlach, A. C. Articles by Devor, D. C. Search for Related Content PubMed PubMed Citation Articles by Gerlach, A. C. Articles by Devor, D. C. Social Bookmarking                      What's this?