J Biol Chem, Vol. 275, Issue 1, 71-76, January 7, 2000

Inhibition of Subsets of G Protein-coupled Receptors by Empty Mutants of G Protein  Subunits in G_o, G₁₁, and G₁₆^*

From the Division of Biology, 147-75, California Institute of Technology, Pasadena, California 91125

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We previously reported that the xanthine nucleotide binding G_o mutant, G_oX, inhibited the activation of G_i-coupled receptors. We constructed similar mutations in G₁₁ and G₁₆ and characterized their nucleotide binding and receptor interaction. First, we found that G₁₁X and G₁₆X expressed in COS-7 cells bound xanthine 5'-O-(thiotriphosphate) instead of guanosine 5'-O-(thiotriphosphate). Second, we found that G₁₁X and G₁₆X interacted with subunits in the presence of xanthine diphosphate. These experiments demonstrated that G₁₁X and G₁₆X were xanthine nucleotide-binding proteins, similar to G_oX. Third, in COS-7 cells, both G₁₁X and G₁₆X inhibited the activation of G_q-coupled receptors, whereas only G₁₆X inhibited the activation of G_i-coupled receptors. Therefore, when in the nucleotide-free state, empty G₁₁X and G₁₆X appeared to retain the same receptor binding specificity as their wild-type counterparts. Finally, we found that G_oX, G₁₁X, and G₁₆X all inhibited the endogenous thrombin receptors and lysophosphatidic acid receptors in NIH3T3 cells, whereas G₁₁X and G₁₆X, but not G_oX, inhibited the activation of transfected m1 muscarinic receptor in these cells. We conclude that these empty G protein mutants of G_o, G₁₁, and G₁₆ can act as dominant negative inhibitors against specific subsets of G protein-coupled receptors.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Heterotrimeric G protein signaling pathways are commonly used to transduce signals across cell membranes in eukaryotic cells. G proteins contain three subunits, , , and , and can be activated by hundreds of seven-transmembrane receptors. Binding of agonist to receptor activates the receptor, which then catalyzes the exchange of GTP for GDP bound to G protein  subunits. Activated GTP-bound  subunits and free subunits regulate a variety of cellular effectors, including enzymes and ion channels (1-3). G protein  subunits can be divided into four families: G_s, G_i (G_i, G_o, and transducin), G_q (G_q, G₁₁, G₁₄, and G₁₆), and G₁₂ (G₁₂ and G₁₃). Some G protein-coupled receptors activate only one family of G proteins, whereas other receptors may activate multiple families of G proteins. G₁₆ and its mouse homologue G₁₅ behave promiscuously; they can be activated by all classes of G protein-coupled receptors (4).

We recently reported that the xanthine nucleotide binding G_o mutant, G_oX (a double mutant of G_o, D273N/Q205L) can interact with appropriate receptors on the membrane (5, 6). G_oX was regulated by xanthine nucleotides instead of guanine nucleotides. The empty form (nucleotide-free) of G_oX has been shown to form a stable complex with G_o-coupled receptors and to inhibit the cognate receptor by competing with endogenous wild-type G proteins. In the present study, we investigated the functions of similar mutants in another G protein family. We found that both G₁₁X (G₁₁DN/QL) and G₁₆X (G₁₁DN/QL) were xanthine nucleotide-binding proteins. They bound XTPS, but not GTPS. These mutant proteins were also able to bind subunits only in the presence of XDP. In the nucleotide-free state, they interacted with their appropriate receptors and inhibited activation. Furthermore, G₁₁X and G₁₆X retained the same receptor binding specificity of the wild-type proteins. G₁₁X only inhibited G_q-coupled receptors, but not G_i-coupled receptors, whereas G₁₆X was able to inhibit receptors from both families. These results suggest that as with G_oX, G₁₁X, and G₁₆X can be used as dominant inhibitors against a subset of G protein-coupled receptors.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Purified bovine retinal transducin were generous gifts from Dr. O. Nakanishi (Division of Biology, Caltech). Xanthine nucleotides and guanine nucleotides were from Sigma. Radioactive [³⁵S]ATPS,¹ [³⁵S]GTPS, and [³H]quinuclidinylbenzilate were from NEN Life Science Products.

Mutagenesis of G₁₁ and G₁₆-- The D277N mutation was introduced in both wild-type G₁₁ and the activated mutant G₁₁Q209L. The D280N mutation was introduced in both wild-type G₁₆ and the activated G₁₆Q213L. The site-specific mutagenesis was conducted by polymerase chain reaction using oligonucleotide TTCCTCAACAAGAAGGACCTTCTAGAAGAC for G₁₁ and TTTCTCAACAAAACCGACATCCTGGAGGAGAAAATCCC for G₁₆. The cDNAs were subcloned into the pCIS vector under the control of a CMV promoter.

Expression and Purification of His₆-tagged G_o-- Both wild-type G_o and mutant G_oX were subcloned into the Escherichia coli expression vector pET-15b (Novagen) with a His₆ tag at the N terminus (5). The recombinant proteins were expressed and purified as described previously. The His₆-tagged proteins were purified over a Ni²⁺-nitrilotriacetic acid column according to the protocol provided by the manufacturer (Novagen, Inc.). Purified proteins were stored in TED buffer (20 mM Tris-HCl, pH 8.0, 1 mM EDTA, and 1 mM dithiothreitol) with 0.1 mM MgCl₂.

Membrane Preparation from Baculovirus-infected Sf9 Cells-- Sf9 cells were grown and infected with recombinant baculoviruses encoding m2 MAChR (7, 8). Membranes of the infected cells were prepared as described. Infected cells were centrifuged and resuspended at <10⁷ cells/ml in HME/PI buffer (20 mM NaHepes, pH 8.0, 2 mM MgCl₂, 1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, and 10 µg/ml leupeptin). The cell suspension was homogenized by 10 strokes in a glass homogenizer followed by passing through a 27-gauge hypodermic needle several times. The homogenate was briefly centrifuged at 3,000 × g for 10 min, and then the supernatant was collected and centrifuged at 30,000 × g for 30 min. The pellet was washed once with HME/PI, and the final pellet was resuspended in HME/PI at a protein concentration of 5 mg/ml.

Synthesis of XTPS-- XTPS was synthesized from XDP and ATPS with nucleotide diphosphate kinase as described previously (9). To produce ³⁵S-labeled XTPS, the reaction contained 10 µM XDP, 1 µM [³⁵S]ATPS, and 10 units nucleotide diphosphate kinase (Sigma) in 100 µl of nucleotide diphosphate kinase buffer (1 mM MgCl₂, 5 mM dithiothreitol, and 20 mM Tris-HCl, pH 8.0). The mixture was incubated at room temperature for 2 h. The resulting concentration of [³⁵S]XTPS was about 1 µM (1 µCi/pmol). The radiochemical purity of XTPS was monitored by TLC on Avicel/DEAE plates (Analtech) in 0.07 N HCl.

Receptor-stimulated GTPS Binding of Purified G_o-- Binding of [³⁵S]GTPS to recombinant G_o was performed as described previously (5, 6). 0.5 µg of purified G_o was first incubated with 1 µg of transducin and 100 µg of m2 MAChR membrane in TED buffer with 10 µM GDP, 0.1 mM MgCl₂, and 1 µM ATP for 0.5 h. The reaction was started with the addition of 0.1 µM GTPS (20,000 cpm/pmol) and 100 µM carbachol. For the time course experiments, 20-µl aliquots were withdrawn from a 200-µl reaction, diluted 10-fold with ice-cold TED buffer containing 0.1 mM MgCl₂, filtered through 45-µm nitrocellulose, washed, and dried. The amount of bound radioactivity was determined by scintillation counting.

COS-7 Cell Culture and Transfection-- COS-7 cells were cultured in DMEM containing 10% fetal bovine serum. 1 × 10⁵ cells/well were seeded in 12-well plates 1 day before transfection. All transfection assays contained a total amount of 1 µg of DNA, and pCIS encoding -galactosidase was used to maintain a constant amount of DNA. To each well, 1 µg of DNA was mixed with 5 µl of LipofectAMINE (Life Technologies, Inc.) in 0.5 ml of Opti-MEM (Life Technologies, Inc.), and 5 h later, 0.5 ml of 20% fetal calf serum in DMEM was added to the medium. After 48 h, cells were assayed for inositol phosphate levels as described previously (10, 11).

Immunoprecipitation of XTPS-bound G₁₁X and G₁₆X-- COS-7 cells were transfected with G₁₁X and G₁₆X 2 days before being lysed in the RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS) with 2 mM MgCl₂, 1 mM EDTA, and protease inhibitors (0.1 mM phenylmethylsulfonyl fluoride, 2 µg/ml aprotinin, and 10 µg/ml leupeptin). The lysate was centrifuged at 12,000 × g for 10 min, and the supernatant was incubated with 0.1 µM [³⁵S]XTPS or [³⁵S]GTPS (20,000 cpm/ml) for 1 h at room temperature. G₁₁X and G₁₆X proteins were then immunoprecipitated using appropriate antibodies and protein A-Sepharose (Sigma). The amount of radioactive nucleotide in the immunoprecipitates was determined by scintillation counting.

Permeabilization of COS-7 Cell Membranes-- Membranes of transfected COS-7 cells were permeabilized as described (5). Cells were washed and incubated in 200 ml of permeabilization solution consisting of 115 mM KCl, 15 mM NaCl, 0.5 mM MgCl₂, 20 mM Hepes-NaOH, pH 7, 1 mM EGTA, 100 mM ATP, 0.37 mM CaCl₂ (to give a free Ca²⁺ concentration of 100 nM), and 200 units/ml -toxin with or without 0.1 mM XDP for 10 min at 37 °C. Then 2 µl of 1 M LiCl was added before the inositol phosphate assay.

NIH3T3 Cell Culture and Transfection-- NIH3T3 cells were maintained in DMEM containing 10% calf serum. 1 × 10⁵ cells/well were seeded into 24-well plates 1 day before transfection. Total of 1 µg/well of DNA, including 0.2 µg of pSRF-Luc reporter plasmid (Strategene, Inc.), were used to transfect cells with Superfect (Life Technologies, Inc.), following the manufacturer's recommendations. Plasmid of pCIS encoding -galactosidase was used to maintain a constant amount of DNA for each well.

Luciferase Assay-- Transfected NIT3T3 cells were maintained in DMEM containing 0.05% calf serum overnight and then were stimulated with 500 nM of LPA or 1 unit/ml of thrombin in the same medium for 6 h before cell extracts were collected to determine the activity of luciferase. The luciferase assay was performed following the protocol of Luciferase Assay System from Promega. The activity of luciferase was determined by measuring luminescence intensity using a luminometer (Monolight 2010 from Analytical Luminescence Laboratory).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Inhibition of G_oX to GTPS Binding of Wild-type G_o Stimulated by m2 Muscarinic Receptors-- We have previously shown that G_oX inhibited the activation of m2 muscarinic receptors (m2 MAChR) in transfected COS-7 cells (6). To test inhibition of m2 MAChR more directly, we asked whether preincubation of receptor with G_oX inhibited the binding of GTPS to wild-type G_o facilitated by activated m2 MAChR in vitro. Recombinant m2 MAChR from Sf9 cells has been shown to stimulate the binding of GTPS to wild-type G_o 2-3-fold in response to muscarinic agonists (7, 8). We infected Sf9 cells with recombinant baculoviruses encoding m2 MAChR and prepared membranes. The concentration of receptor in isolated membranes was about 20 pmol/mg of membrane protein, determined from [³H]QNB binding. In the control experiments, we reconstituted purified G_o with the transducin 11 subunits and Sf9 cell membranes containing m2 MAChR and then assayed the binding of GTPS to G_o upon activation with the muscarinic agonist carbachol. We found that carbachol accelerated the binding of GTPS to G_o (Fig. 1A). Then we coincubated different amounts of purified G_oX in similar experiments and found that G_oX attenuated the m2 MAChR-catalyzed activation of GTPS binding to G_o. The inhibitory effect of G_oX was proportional to the amount of G_oX added (Fig. 1A). This result is consistent with our previous finding that G_oX forms a stable complex with m2 MAChR. Since we have also demonstrated that the interaction between G_oX and m2 MAChR can be abolished by either XDP or XTP (6), we then tested whether XDP or XTP could relieve the inhibitory effect of G_oX. As expected, G_oX did not inhibit the activation of m2 MAChR in the presence of XTP. However, G_oX was able to inhibit the binding of GTPS to G_o when XDP was present (Fig. 1B). This is not surprising because G_oX is able to bind in the presence of XDP. We conclude that G_oX competes with wild-type G_o for subunits and inhibits the activation of G_o by receptor. This is also consistent with the fact that the activation of G_o by m2 MAChR requires (Fig. 1B).

View larger version (13K): [in this window] [in a new window]   Fig. 1.   GoX inhibits the GTPS binding of wild-type Go stimulated by m2 MAChR. A, 100 µg of m2 MAChR membranes was incubated with 0.5 µg of Go, 1 µg of , 10 µM GDP, and indicated amount of GoX in TEDM buffer (20 mM Tris-HCl, pH 8.0, 1 mm EDTA, 1 mM dithiothreitol, and 1 mm MgCl2) for 20 min at room temperature and then the mixture was diluted 10-fold with TEDM buffer containing 0.1 µM [35S]GTPS (20,000 cpm/pmol) and 100 µM carbachol at time 0. 20-µl aliquots were withdrawn and assayed for the bound nucleotides at the indicated times. B, 0.5 µg of wild-type Go was preincubated with 100 µg of m2 MAChR membranes and 3 µg of GoX under indicated conditions and then subjected to the similar GTPS binding assay as in A. Only data at 20 min were shown as the percentage of maximum binding.

Binding of XTPS to G₁₁X and G₁₆X-- To test whether the DN mutation of the conserved NKXD motif in other G protein  subunits also generates xanthine nucleotide-binding proteins, we introduced the mutation in both wild-type G₁₁ and G₁₆ and into their activated QL mutant cDNA. We then expressed the mutant proteins G₁₁DN (G₁₁D277N), G₁₁X (G₁₁D277N/Q209L), G₁₆DN (G₁₆D280N), and G₁₆X (G₁₆D280N/Q213L) in COS-7 cells (Fig. 2, A and B). Unlike G_o, large quantities of active recombinant proteins of G₁₁ and G₁₆ are not easily expressed and purified from E. coli. Thus we decided to test the nucleotide binding of the mutant proteins in COS-7 cell lysates. After incubating with the radioactive GTPS or XTPS, we immunoprecipitated the mutant proteins and assayed bound radioactive nucleotide. We found that G₁₁X and G₁₆X bound XTPS instead of GTPS, whereas wild-type G₁₁ and G₁₆ preferred GTPS (Fig. 2, C and D). Consistent with our previous finding that G_oX bound xanthine nucleotides but not guanine nucleotides, whereas G_oDN did not bind either nucleotides, we found that both G₁₁DN and G₁₆DN did not show strong binding of either [³⁵S]GTPS or [³⁵S]XTPS.

View larger version (18K): [in this window] [in a new window]   Fig. 2.   XTPS binding of G11X and G16X. In A and B, mutant proteins of G11X, G11DN, G16X, and G16DN were expressed in COS-7 cell and subjected to Western blots using antibodies against G11 and G16, respectively. In C and D, the lysates of transfected COS-7 cells were incubated with indicated radioactive nucleotide for 1 h at room temperature. The mutant protein was then immunoprecipitated using appropriate antibodies and the amount of radioactive nucleotide was determined.

XDP-dependent Interaction of G₁₁X and G₁₆X-- We previously showed that G_oX was able to bind subunits in the presence of XDP (5). To test whether G₁₁X and G₁₆X also shows XDP-dependent interaction, we assayed their binding with in transfected COS-7 cells. In COS-7 cells, 12 is able to activate PLC2, and the activation of PLC2 can be inhibited by cotransfection with wild-type G_o because of competition for (5, 12). We cotransfected COS-7 cells with PLC2, 1, 2, and G₁₁X or G₁₆X and found that neither mutant inhibited PLC2 activity, whereas wild-type G_o did inhibit. This experiment suggests that G₁₁X and G₁₆X do not bind presumably because the intracellular concentration of XDP is negligible (13) (Fig. 3). To deliver XDP into cells, we permeabilized the cell membrane with -toxin. After incubating transfected COS-7 cells with -toxin in the presence of XDP, we found that both G₁₁X and G₁₆X inhibited PLC2 activity stimulated by (Fig. 3). In the similar experiments with G₁₁DN and G₁₆DN, we did not see inhibition of the activation of PLC2, even when XDP was present (Fig. 3). In the control experiments, we found that -toxin alone or -toxin followed by GDP or GTP addition did not affect the activity of PLC2 (data not shown). These experiments show that G₁₁X and G₁₆X do not bind and interfere with its activation of PLC2 in the nucleotide-free state. However, when in the XDP-bound form, G₁₁X and G₁₆X are able to sequester cellular and inhibit its ability to activate PLC2.

View larger version (17K): [in this window] [in a new window]   Fig. 3.   The interaction of G11X and G16X with in transfected COS-7 cells is XDP-dependent. 1 × 105 cells/well were seeded in a 12-well plate and then were transfected with cDNAs encoding the indicated proteins the next day. The total amount of cDNA for each well was adjusted to 1.0 µg by addition of CMV-LacZ cDNA. Cells were labeled with [3H]inositol, and the levels of inositol phosphates were determined after incubating cells with 200 units/ml of -toxin with or without 104 M XDP.

Dominant Negative Inhibition of G Protein-coupled Receptor by Empty G₁₁X and G₁₆X-- G_oX binds to members of the G_i-coupled receptor family and has been shown to act as a dominant inhibitor of G_i-coupled receptors (6). To test receptor interaction of G₁₁X and G₁₆X, we assayed their ability to inhibit the activation of G protein-coupled receptors in COS-7 cells. m1 muscarinic receptors (m1 MAChR) have been shown to primarily activate the Gq family of G proteins (10). Activated G_q then stimulates PLC isoforms to elevate cellular inositol 1,4,5-trisphosphate concentration. We cotransfected COS-7 cells with m1 MAChR and G₁₁X or G₁₆X and tested whether the mutant proteins inhibited the activation of m1 MAChR by competing with endogenous G_q. We found that both G₁₁X and G₁₆X were able to inhibit the activity of endogenous PLC isoforms stimulated by activated m1 MAChR (Fig. 4A). Since G₁₁X and G₁₆X did not affect the activation of PLC2 by in COS-7 cells, the inhibition of m1 MAChR-stimulation PLC activation by G₁₁X and G₁₆X most probably results from the competitive binding of the mutant proteins to the receptor. In similar experiments using G₁₁DN and G₁₆DN, we found that they inhibited the activation of m1 MAChR as well as G₁₁X and G₁₆X (Fig. 4A), suggesting that G₁₁DN and G₁₆DN could also bind to m1 MAChR, although they do not bind either guanine nucleotides or xanthine nucleotides. In the experiments with two other G_q-coupled receptors, TRH receptor and thrombin receptor (14-16), we found that all four mutant proteins were able to inhibit activation by receptors (Fig. 4, B and C). These results agree with our previous observation that the empty G_o mutant protein forms a stable complex with appropriate receptor. Thus our working hypothesis is that in the absence of xanthine nucleotides sufficient levels of mutant proteins are made to interact with the appropriate receptors.

View larger version (54K): [in this window] [in a new window]   Fig. 4.   Empty mutants of G11 and G16 inhibited appropriate receptors in COS-7 cells. 1 × 105 cells/well were seeded in a 12-well plate and then transfected with m1 MAChR (A), TRH receptor (B), thrombin receptor (C), or m2 MAChR (D) and indicated G. In A-C, the amount of receptor cDNA for each well was 0.25 µg, and the amount of G was 0.75 µg. In D, the amount of both m2 MAChR and G15 cDNA was 0.2 µg/well and that of mutant G was 0.6 µg/well. After cells were labeled with [3H]inositol overnight, they were incubated for 30 min in the medium containing 1 µM carbachol (A and D), 1 µM TRH (B), or 0.1 unit/ml thrombin (C) before levels of inositol phosphates were determined.

Empty G_oX mutants appear to retain the receptor binding specificity of wild-type G_o (6). To test whether empty G₁₁ and G₁₆ mutants also behave similarly, we assayed for their inhibition of activation by the m2 MAChR, a member of G_i-coupled receptor family. Since m2 MAChR couples only to the G_i family of G proteins, but not to the G_q family (4, 9), we could not assay the activity of m1 MAChR by monitoring G_q-stimulated PLC activities in COS-7 cells. Therefore we constructed an artificial pathway by cotransfecting both m2 MAChR and G₁₅ into COS-7 cells. G₁₅ and G₁₆ are homologous proteins (G₁₅ mouse and G₁₆ human) that behave as a promiscuous G protein, which can be activated by all kinds of G protein-coupled receptors, and activated G₁₅ stimulates the activity of PLC (4). In cells cotransfected with both m2 MAChR and G₁₅, we were able to activate endogenous PLC isoforms by the addition of the muscarinic agonist carbachol. In the cotransfection experiments with m2 MAChR, G₁₅, and the empty mutants of G₁₁ and G₁₆, we found that only G₁₆X and G₁₆DN inhibited activation by m2 MAChR, whereas G₁₁X and G₁₁DN had no effect (Fig. 4D). This is consistent with the fact that G₁₁ does not couple to the m2 MAChR and G₁₆ does. These experiments suggest that both empty mutants of G₁₁ and G₁₆ retain the binding specificity of their wild-type counterparts; G₁₁X and G₁₁DN only interact with G_q-coupled receptors, but not with G_i-coupled receptor, whereas G₁₆X and G₁₆DN can interact with both families of receptors.

Inhibition of Endogenous Thrombin Receptor and LPA Receptor in NIH3T3 Cells-- NIH3T3 cells express endogenous thrombin receptors and LPA receptors (17). These two types of receptors couple to a variety of G proteins, including G_i, G_q, and G_12/13 (16, 18). Activation of these receptors leads to the activation of serum response factor (SRF) and SRF-mediated gene transcription through RhoA, via both the G_q and G_12/13 pathways presumably. To investigate whether empty G mutants inhibit thrombin receptor and LPA receptor in NIH3T3 cells, we determined the activity of luciferase, whose expression was under the regulation of SRE.L, when the cells were cotransfected with the mutant G proteins and the reporter gene plasmid. SRE.L is a derivative of the c-Fos serum response element (SRE) to which SRF binds and activates luciferase transcription (19). We found that the empty mutants of all three types of a subunits, G_o, G₁₁, and G₁₆, were able to inhibit the activation of both thrombin receptors (Fig. 5A) and LPA receptors (Fig. 5B). These results are consistent with the experiments in COS-7 cells showing that the empty G proteins bind tightly to their cognate receptors. To exclude the possibility that empty G mutants interfere with the downstream components of the signaling pathway, we cotransfected the cells with the constitutively activate G_q mutant, G_qQL, and the empty G mutants. We found that the empty G mutants did not affect G_qQL-stimulated SRF activation (data not shown), indicating that the inhibition of receptor-stimulated SRF activation by empty G mutants must come from their competitive binding to the receptor, not from direct G activation of downstream effectors.

View larger version (24K): [in this window] [in a new window]   Fig. 5.   Empty mutants of Go, G11, and G16 inhibited endogenous thrombin and LPA receptors in NIH3T3 cells. 1 × 105 cells/well were seeded in a 24-well plate and then transfected with 0.2 µg of SRF-luciferase reporter plasmid cDNA and 0.75 µg of indicated G mutant cDNA (A and B) or 0.2 µg of SRF-luciferase reporter plasmid cDNA, 0.2 µg of m1 MAChR cDNA, and 0.5 µg of indicated G mutant cDNA (C). After 24-h starvation, cells were stimulated with 0.5 µM LPA (A), 1 unit/ml thrombin (B), or 1 µM carbachol (C) for 6 h before the activity of luciferase was determined.

NIH3T3 cells apparently do not have endogenous muscarinic receptors, since addition of carbachol did not lead to the activation of SRF (17). We transfected the cells with m1 MAChR and found that its activation resulted in stimulated luciferase activity, presumably through the endogenous G_q pathway. Coexpression of the G mutants showed that G₁₁X, G₁₁DN, G₁₆X, and G₁₆DN inhibited the activation of m1 MAChR, but G_oX and G_oDN did not. These experiments indicate that the presumptive empty form of G₁₁ and G₁₆ bound m1 MAChR whereas the empty form of G_o did not, consistent with the results from COS-7 cell experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We previously reported that G_oX, the xanthine nucleotide-binding mutant protein of G_o, formed stable complexes with their appropriate receptors and inhibited the activation of cognate receptors because of competitive binding (6). In this study, we reconstituted G_oX, G_o, , and m2 MAChR and Sf9 cell membranes. We monitored the GTPS binding of G_o facilitated by m2 MAChR upon the activation of its agonist carbachol. Not surprisingly, we found that G_oX inhibited the nucleotide exchange of wild-type G_o catalyzed by the activated m2 MAChR. Therefore, we demonstrated that G_oX was able to inhibit the activation of m2 MAChR in vitro.

To extend this work to other families of G proteins, we introduced the similar DN mutation in wild-type G₁₁ and G₁₆, as well as activated G₁₁QL and G₁₆QL, and expressed the mutant proteins in COS-7 cells. After immunoprecipitating the mutant proteins incubated with radioactive nucleotides in COS-7 cell lysates, we found that G₁₁X and G₁₆X bound XTPS instead of GTPS, whereas wild-type G₁₁ and G₁₆ preferred GTPS. However, G₁₁DN and G₁₆DN did not appear to bind either nucleotides. We also showed that the mutant proteins of G₁₁X and G₁₆X expressed in COS-7 cells interacted with subunits in a XDP-dependent fashion; they only bound when XDP was available, whereas G₁₁DN and G₁₆DN did not. These results are consistent with previous findings using G_oX and G_oDN; the single DN mutation resulted in a loss of ability to bind nucleotides, whereas the double DN/QL mutation lead to xanthine nucleotide binding (5). Although the mutation of Asp  Asn in the conserved NKXD motif of G protein  subunits was expected to switch the nucleotide specificity of the mutated protein from guanine nucleotide to xanthine nucleotide, according to the available crystal structures of G protein  subunits and other GTP-binding proteins, we observed that the single DN mutation resulted in a protein not able to bind either nucleotides in three G protein  subunits: G_o, G₁₁, and G₁₆. It is not apparent from the crystal structures why the second QL mutation, a well characterized GTPase-deficient mutation, restored the xanthine nucleotide binding of the mutant proteins; the conserved Gln (position 200 in transducin ) resides at the opposite side of the nucleotide binding pocket from the DN mutation (position 268 in transducin ).

To test whether empty mutants of G₁₁ and G₁₆ interacted with G protein-coupled receptors and inhibited the activation of appropriate receptors, we assayed the stimulated PLC activity by transfected receptors in COS-7 cells and the activation of SRF by endogenous thrombin receptors and LPA receptors in NIH3T3 cells. We found that G₁₁X and G₁₆X inhibited the activation of m1 of MAChR and TRH receptor, but not m2 MAChR, whereas G_oX and G_oDN inhibited the activation of m2 MAChR, but not m1 MAChR or TRH receptor. Furthermore, G₁₆X and G₁₆DN were found to inhibit the activation of m1 MAChR, TRH receptor, and m2 MAChR, in addition to that G_oX, G_oDN, G₁₁X, G₁₁DN, G₁₆X, and G₁₆DN were all able to inhibit the activation of thrombin receptors and LPA receptors. Therefore, we conclude that these empty mutants of G protein  subunits retain the same receptor binding specificity of their wild-type counterparts. Empty G_o interacts with only G_i-coupled receptors, and empty G₁₁ interacts with only G_q-coupled receptors, while G₁₆ can interact with both families of G protein-coupled receptors. It is interesting to note that G₁₁DN and G₁₆DN were able to inhibit the activation of their appropriate receptors as effectively as G₁₁X and G₁₆X, although G₁₁DN and G₁₆DN did not bind xanthine nucleotides. Similarly, G_oDN was shown to interact with receptors but not able to bind nucleotides (5, 6). These experiments proved that the empty mutant forms of these G protein  subunits can act as effective dominant negative inhibitors against a subset of G protein-coupled receptors. They can be very useful tools to dissect signaling pathways of different G protein-coupled receptors by specifically blocking one family of receptors.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

	ABBREVIATIONS

The abbreviations used are: ATPS, adenosine 5'-O-(thiotriphosphate); GTPS, guanosine 5'-O-(thiotriphosphate); XTPS, xanthine 5'-O-(thiotriphosphate); MAChR, muscarinic cholinergic receptor; DMEM, Dulbecco's modified Eagle's medium; LPA, lysophosphatidic acid; TRH, thyrotropin-releasing hormone; SRF, serum response factor; SRE, serum response element; PLC, phospholipase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES