Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Devireddy, L. R.
Right arrow Articles by Jones, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Devireddy, L. R.
Right arrow Articles by Jones, C. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

J Biol Chem, Vol. 275, Issue 1, 77-81, January 7, 2000


Olf-1, a Neuron-specific Transcription Factor, Can Activate the Herpes Simplex Virus Type 1-Infected Cell Protein 0 Promoter*

Laxminarayana R. DevireddyDagger and Clinton J. Jones§

From the Center for Biotechnology, Department of Veterinary and Biomedical Sciences, University of Nebraska, Lincoln, Nebraska 68583-0905

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Herpes simplex virus type 1 (HSV-1) establishes a life-long latent infection in sensory neurons of infected individuals. Infected cell protein 0 (ICP0) is important for productive infection and reactivation from latency. Thus, activation of ICP0 expression in neurons is likely to be important for reactivation from latency. In a mouse neuroblastoma cell line, ICP0 promoter activity is high compared with other strong viral promoters. In contrast, promoter activity is low in non-neuronal cells. DNase I footprinting assays indicated that three distinct motifs in the ICP0 promoter are bound by nuclear factors. One of these motifs contains a binding site for a novel helix-loop-helix olfactory neuron-specific transcription factor (Olf-1). Gel shift assays and supershift assays using an Olf-1-specific antibody demonstrated that mouse neuroblastoma cells express Olf-1, which is bound to the Olf-1-like site in the ICP0 promoter. Deletion of the putative Olf-1 motif reduced ICP0 promoter activity more than 5-fold in mouse neuroblastoma cells and prevented trans-activation by an Olf-1 expression vector. We hypothesize that the Olf-1-binding site activates ICP0 promoter activity in neurons during reactivation from latency.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Herpes simplex virus type 1 (HSV-1)1 is a large DNA virus that establishes latency in sensory neurons. Periodically, latent virus reactivates resulting in recurrent disease and transmission to uninfected individuals (reviewed in Refs. 1 and 2). During productive infection, viral gene expression is sequentially activated as follows: immediate early (IE), early, and late. IE gene expression is activated by VP16, a tegument protein, that forms a complex with the ubiquitous cellular transcription factor Oct-1 and host cell factor (3-5). This complex binds to the DNA sequence TAATGARAT, which is present in all IE promoters. Abundant IE gene expression does not occur during latent infection, and mutants that do not express individual IE genes establish latent infections at reduced efficiency (reviewed in Refs. 1 and 2).

ICP0 RNA is expressed under IE conditions, and the transcript encodes a protein that activates expression of all classes of viral genes (6, 7). One domain in the ICP0 protein activates IE gene expression and a second activates early and late gene expression (8). Viral mutants that contain deletions in the ICP0 gene exhibit substantial impairment in infectivity (6). ICP0 also facilitates reactivation of HSV-1 from a latent infection in animal models (9, 10) and an in vitro tissue culture latency model (11). Several distinct cis-acting elements in the ICP0 promoter have been identified (12, 13). Sequences between -70 and -420 of the ICP0 promoter are important for expression during productive infection of Vero cells and virulence in mice but not for explant-induced reactivation.

The central and peripheral nervous system consists of approximately 1012 cells, which are distinct in biochemical and functional properties. During development and following stress, gene expression undergoes many changes in the nervous system (reviewed in Ref. 14). The peripheral olfactory system has the unique ability to generate new neurons from precursor cells, thus offering a system to study neuron-specific gene expression (15, 16). Olfactory marker protein expression is involved with smell, and its expression is tightly controlled, in part because of the olfactory neuron-specific transcription factor (Olf-1) (15-18). Olf-1 is a helix-loop-helix (HLH) protein, which is implicated in olfactory gene regulation and B-cell development (19, 20). Olf-1 specifically binds to a consensus DNA sequence, TCCCC(A/T)NGGAG (15, 18). The Olf-1 transcript is alternatively spliced and thus may encode protein isoforms with novel biological properties (21).

We have identified a trans-acting factor that regulates ICP0 promoter activity in mouse neuroblastoma (neuro-2A) cells. TAATGARAT motifs are dispensable for efficient ICP0 promoter activity in neuro-2A cells. High constitutive promoter activity is dependent on a cis-acting element that closely matches the Olf-1-binding site. Cellular factors that bind to the Olf-1 site are different in neuro-2A cells compared with non-neuronal cells suggesting tissue-specific factors can regulate ICP0 promoter activity.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmids-- A plasmid that contains part of the HSV-1 ICP0 promoter (-160 to +150) is designated pAB5 (4). Plasmid pAB5 contains only one TAATGARAT motif. Plasmid pAB2 contains the region of the ICP0 promoter spanning -130 to +150 but lacks the TAATGARAT motif in pAB5. The VP16 expression plasmid contains the HSV-1 VP16 coding sequences linked to the Moloney murine leukemia virus-long terminal repeat (22). Plasmid pSV2 CAT (SV40 enhancer-promoter linked to the CAT gene) was provided by Bruce Howard, National Institutes of Health. pcDNA3.1 CAT (CMV/CAT), pSV2-beta -galactosidase, and pUC19 were purchased from Invitrogen, CLONTECH, and New England Biolabs, respectively. Randall Reed, The Johns Hopkins University, provided pCMV/Olf-1 cDNA. The ICP0 promoter was also cloned into pUC19 using standard molecular biology techniques.

The Olf-1-like site in pAB5 was deleted using a polymerase chain reaction that employed a primer spanning ICP0 promoter sequences downstream of this site (primer 1) and a downstream primer (primer 2). Primer 1 has the same sense as the coding strand, is located between -77 to -58, and has a HindIII site at its 5' end. Primer 2 is complementary to +145 to +121 and has a terminal XbaI site. These primers were used to amplify the ICP0 promoter using pAB5 as a template in a Hybaid thermal cycler under the following conditions: 95 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min, and 72 °C for 7 min to allow for final extension. The resulting polymerase chain reaction product was purified as described previously (23), digested with HindIII and XbaI, and subsequently cloned into pBLCAT 6 vector (provided by Gunther Schutz, German Cancer Institute, Heidelberg, Germany).

Cells and Transfection Procedures-- Mouse neuroblastoma (neuro-2A), COS-7, CV-1, and NIH 3T3 cells were obtained from American Type Culture Collection (Manassas, VA). All cell lines were maintained in Earle's minimum essential medium supplemented with 10% fetal bovine serum. Transfections were performed in 100-mm plates with the indicated amounts of DNA by calcium phosphate precipitation as described previously (24).

Chloramphenicol Acetyltransferase (CAT) Assay-- Cells were co-transfected with the pSV2-beta -galactosidase expression plasmid and the designated CAT reporter plasmid. The amount of DNA transfected was kept constant in all experiments with pUC19. Cells were harvested 48 h after transfection and CAT enzymatic levels measured as described previously (24). The amount of extract used for measuring CAT was adjusted based on beta -galactosidase activity as described previously (25). To measure beta -galactosidase activity, a portion of the cell extract (10 µl) was incubated for 4 min with 40 µl of 4 mg/ml ortho-nitrophenyl beta -D-galactopyranoside (Sigma) in 200 µl of buffer (60 mM Na2PO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM beta -mercaptoethanol). To stop the reaction, 100 µl of 1 M Na2CO3 was added and the absorbance of the supernatant measured (420 nm).

Preparation of Nuclear Extract-- Nuclear extract (NE) was prepared as described previously (26). Protein concentration in nuclear extract was determined using a kit from Bio-Rad according to the manufacturer's instructions.

DNase I Protection Assays-- DNase I protection assays were performed using the Sure track footprinting system (catalogue number 27-9101-01; Amersham Pharmacia Biotech) following the manufacturer's instructions. Radiolabeled fragments for footprinting the ICP0 promoter were generated from plasmid pUC19-ICP0 containing nucleotides -165 to +150 of the ICP0 promoter cloned into BamHI and XbaI sites. The ICP0 promoter was liberated by cutting with PstI and EcoRI (to detect binding on the top strand) or KpnI and SalI (to detect binding on the bottom strand). Probes for DNase I footprinting were labeled with Super-Script reverse transcriptase (Life Technologies, Inc.) in the presence of [alpha -32P]dATP (Amersham Pharmacia Biotech). Labeled inserts were purified by polyacrylamide gel electrophoresis. Footprinting was performed in a volume of 100 µl by incubating 15-30 µg of nuclear extract and 100 pg of the probe in a binding buffer, supplied by the manufacturer. After 20 min incubation, the designated concentration of DNase I was added and the incubation continued for 1 min at room temperature. Reactions were terminated by addition of an equal volume of stop buffer supplied by the manufacturer. The mixture was then phenol-extracted and ethanol-precipitated. Products were denatured at 95 °C, resolved on a 6% urea-polyacrylamide gel, and subjected to autoradiography.

Electrophoretic Mobility Shift Assays (EMSA)-- Oligonucleotides were purchased from Integrated DNA Technology (Coralville, IA). The sequences of these oligonucleotides are as follows.
<AR><R><C><UP>5′ </UP><IT>AGCTT</IT><UNL><UP>TGCCTCCCCTGGGA<B>C</B>GCGC</UP></UNL><UP>T 3′ </UP>(<UP>+</UP>)</C></R><R><C><UP>    3′ AACGGAGGGGACCCTGCGCGA</UP><IT>GATC</IT><UP> 5′ </UP>(<UP>−</UP>)</C></R></AR>

<UP><SC>Oligonucleotide WT ICP0 Olf-1</SC></UP>

<AR><R><C><UP>5′ </UP><IT>AGCTT</IT><UP>TGCCTCCCCTG<UNL>TTCT</UNL>GCGCT 3′ </UP>(<UP>+</UP>)</C></R><R><C><UP>    3′ AACGGAGGGGACAAGACGCGA</UP><IT>GATC</IT><UP> 5′ </UP>(<UP>−</UP>)</C></R></AR>

<UP><SC>Oligonucleotide Mutant</SC> 1</UP>

<AR><R><C><UP>5′ </UP><IT>AGCTT</IT><UP>TGCCTC<UNL>AG</UNL>CTG<UNL>TTCT</UNL>GCGCT 3′ </UP>(<UP>+</UP>)</C></R><R><C><UP>    3′ AACGGAGTCGACAAGACGCGAG</UP><IT>ATC</IT><UP> 5′ </UP>(<UP>−</UP>)</C></R></AR>

<UP><SC>Oligonucleotide Mutant</SC> 2</UP>

The + and - oligonucleotides have terminal HindIII and XbaI sites, respectively, and these sites are designated by italics. The restriction sites were introduced to facilitate end labeling using reverse transcriptase. The underlined nucleotides are the HSV-1 sequences from -97 to -79 in the ICP0 promoter. The bold nucleotide is the only base that differs from the Olf-1 consensus site. Double underlined nucleotides are those bases that differ from the WT sequence and eliminate Olf-1 binding (15).

EMSA were performed as described in Ref. 27 with the following modifications. The probe was prepared by end labeling with Super-Script reverse transcriptase (Life Technologies, Inc.) in the presence of [alpha -32P]dATP (Amersham Pharmacia Biotech). NE was treated with Nonidet P-40 (Sigma) to a final concentration of 1% on ice (28). Binding reactions contained 10 mM HEPES (pH 7.9), 10 mM MgCl2, 10% glycerol, 50 mM NaCl, 0.5 mM dithiothreitol, 2 µg of poly(dI·dC), 5-15 µg of protein, and 200 pg of 32P-labeled probe. After 10 min incubation on ice, reactions were electrophoresed on a 4% non-denaturing polyacrylamide gel in 0.25× TBE and subjected to autoradiography.

For supershift assays, binding reactions were incubated with 1 µl of Olf-1 antibody (provided by Randall Reed, The Johns Hopkins University), normal rabbit serum, or Bcl-2 antibody (catalogue number sc-783; Santa Cruz Biotechnology, Santa Cruz, CA) on ice for 10 min before loading onto the gel.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Analysis of ICP0 Promoter Activity in Neuro-2A Cells-- IE gene expression is activated by VP16 during productive infection (reviewed in Ref. 5). Since the ICP0 gene is important for reactivation from latency, cis-acting sequences in the ICP0 promoter may be regulated by neuronal factors in the absence of VP16. To test this hypothesis, a chimeric CAT gene containing the ICP0 promoter spanning -165 to +150 (pAB5; Ref. 4) was transfected into neuro-2A cells, and its activity compared with the SV40 (pSV2-CAT) and CMV (CMV/CAT) promoters. Neuro-2A cells are murine neuroblastoma cells that have certain neuronal characteristics and can be readily transfected. At least 10-fold higher levels of CAT activity were obtained with pAB5 in neuro-2A cells compared with COS-7, CV-1, or NIH 3T3 cells (Fig. 1). In contrast, pSV2 CAT and pcDNA3.1 CAT contained similar levels of CAT activity in the respective cell lines (Fig. 1). In neuro-2A cells, pAB5 promoter activity was slightly higher than the SV40 promoter but lower than the CMV IE promoter.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1.   Analysis of ICP0 promoter activity. One µg of the respective CAT reporter plasmid was transfected into neuro-2A, COS-7, CV-1, or NIH 3T3 cells. 48 h after transfection CAT activity was measured as described under "Experimental Procedures." The mean of the data from three experiments is shown. The percent acetylated chloramphenicol values (% Ac-CM) were obtained using a PhosphorImager.

Interaction of Nuclear Factors with the ICP0 Promoter-- The results in Fig. 1 suggested that novel cellular transcription factors in neuro-2A cells interacted with and subsequently activated the ICP0 promoter. To begin to test this possibility, DNase I footprinting assays were performed using NE prepared from neuro-2A cells and the ICP0 promoter. DNA sequences containing an Olf-1-like binding site (15, 18) were protected from DNase I digestion (Fig. 2A and summarized in Fig. 2B). The other prominent DNase I-protected sites were similar to a GC box (29) and initiator-like sequences (reviewed in Ref. 30). Although the DNase I footprinting assay suggested that binding occurred with the Olf-1-like binding site in neuro-2A cells, there was no obvious cell type differences that correlated with enhanced promoter activity in neuro-2A cells (data not shown). Furthermore, the ICP0 Olf-1-like binding site has a C in the last base and not a G as described for the consensus (TCCCC(A/T)NGGAG; Refs. 15 and 18).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2.   DNase I footprinting of the ICP0 promoter. A, the top strand of the 5'-flanking region of ICP0 promoter was end-labeled and subjected to limited DNase I digestion (1 unit) with 15 or 20 µg of NE prepared from neuro-2A cells (lanes 1 and 2, respectively). Negative controls included 50 µg of bovine serum albumin incubated with the ICP0 promoter (lane 3) or without any protein (lane 4). The top strand was also subjected to A + G sequencing reaction (lane 5). Samples were electrophoresed on a 6% sequencing gel. Open boxes depict the protected regions, and the numbers are the distance from the start site of transcription. B, a schematic of pAB5, and the relevant cis-acting motifs is presented. The nucleotide sequence of the ICP0 promoter (-160 to +150) and the various sequences protected from DNase I digestion is also shown. The arrow designates the start site of ICP0 transcription. The last C of the Olf-1-binding site is the only base that is different from the consensus.

EMSA were subsequently performed with NE prepared from neuro-2A, COS-7, CV-1, or NIH 3T3 cells using an oligonucleotide containing the ICP0 Olf-1-binding site. A diffuse complex was observed with NE from neuro-2A cells (Fig. 3A). However, NE from COS-7 or CV-1 cells yielded a faster migrating complex, and the shifted complex was nearly undetectable in NIH 3T3 cells. Two mutant Olf-1 oligonucleotides were synthesized to examine the specificity of binding. A 100-fold excess of WT Olf-1 oligonucleotide reduced the shifted complex in neuro-2A cells (Fig. 3B). However, Mutant 1 and 2 oligonucleotides (Fig. 3B, M1 and M2, respectively) had little effect on the shifted complex. WT, M1, or M2 oligonucleotides reduced the intensity of the faster migrating shifted band in CV-1 NE (Fig. 3C). The intensity of the slower migrating shifted band was nearly eliminated by the WT Olf-1 oligonucleotide but to a lesser degree by the mutant oligonucleotides suggesting that binding to the slower migrating shifted band was specific. In summary, EMSA indicated that novel nuclear proteins in neuro-2A cells specifically bind to the ICP0 Olf-1-like binding site.


View larger version (71K):
[in this window]
[in a new window]
 
Fig. 3.   EMSA using the ICP0 Olf-1-binding site. A, a radiolabeled double-stranded oligonucleotide containing the ICP0 Olf-1 site was incubated with 20 µg of NE from neuro-2A, COS-7, CV-1, or NIH 3T3 (3T3). Probe incubated without NE (-). B, NE from neuro-2A cells was preincubated with 200 ng of WT, Mutant 1 Olf-1 oligonucleotide (M1), or Mutant 2 Olf-1 oligonucleotide (M2) before incubating with labeled WT Olf-1 oligonucleotide. Lane 0 did not contain any competitor. Probe incubated without NE (-). C, NE from CV-1 cells was preincubated with 200 ng of WT, M1, or M2 before incubating with labeled WT Olf-1 oligonucleotide. Lane 0 did not contain any competitor. The arrow indicates the position of the free probe in the respective panels.

To test whether the Olf-1 protein was expressed in neuro-2A cells and was bound to the Olf-1 oligonucleotide, supershift assays were performed using an Olf-1-specific antibody. The Olf-1 antibody specifically binds to a 60-70-kDa protein in neuronal cell types (Ref. 18 and data not shown). Incubation with the Olf-1 antibody retarded mobility of the shifted complex in neuro-2A cells (Fig. 4A, Olf-1 lane). In contrast, incubation of NE from CV-1 cells with the Olf-1 antibody did not alter the mobility of the shifted band (Fig. 4B). Normal rabbit serum (Fig. 4A, NRS) and a Bcl-2 antibody had no effect on complex formation. Thus, in neuro-2A cells Olf-1 was expressed and bound to the ICP0 Olf-1 site.


View larger version (95K):
[in this window]
[in a new window]
 
Fig. 4.   Supershift EMSA using the Olf-1 oligonucleotide. EMSA was performed with NE prepared from neuro-2A cells. A, reactions were subsequently incubated with no serum (0), normal rabbit serum (NRS), the Olf-1 antibody, or a Bcl-2 antibody on ice for 10 min before analyzing on a gel. Lane 0 is the free probe without NE. B, the binding reactions containing NE from CV-1 cells were incubated with Olf-1 antibody as described in A. The small arrow indicates the position of the supershifted complex. The broad arrow indicates the position of the complex formed with NE from neuro-2A or CV-1 cells. The arrowhead indicates the free probe.

Olf-1 trans-Activates the ICP0 Promoter-- The ability of Olf-1 to trans-activate the ICP0 promoter in COS-7, CV-1, or NIH 3T3 cells was subsequently tested. Co-transfection of the Olf-1 cDNA expression plasmid with pAB5 resulted in 5-fold trans-activation in COS-7 cells and 3-fold trans-activation in NIH 3T3 cells (Fig. 5A). In contrast, the Olf-1 cDNA did not activate the ICP0 promoter in CV-1 cells. To evaluate the role of the TAATGARAT motif in Olf-1 trans-activation, the ICP0 promoter (pAB2) lacking this motif was co-transfected with Olf-1 cDNA. The Olf-1 cDNA trans-activated pAB2 in COS-7 and NIH 3T3 cells but not in CV-1 cells (Fig. 5B).


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 5.   Olf-1 trans-activates the ICP0 promoter. A, pAB5 (1 µg) was transfected into the indicated cell type with (+) or with out (-) Olf-1 cDNA (1 µg). B, Olf-1 trans-activation does not require TAATGARAT motifs. The lanes are as in A, but the mutant ICP0 promoter lacking TAATGARAT motifs (pAB2) was employed. Forty eight h after transfection CAT activity was measured. The adjusted percent acetylated chloramphenicol values (% Ac-CM) are indicated and were determined as described under "Experimental Procedures."

To test whether the Olf-1-binding site in the ICP0 promoter was required for Olf-1 trans-activation, the Olf-1 site was deleted (Fig. 6A, Delta Olf-1). Delta Olf-1 was not responsive to Olf-1-mediated trans-activation in COS-7 cells (Fig. 6B). Furthermore, Delta Olf-1 promoter activity was nearly 7-fold less in neuro-2A cells relative to pAB2 (Fig. 6C). In summary, these studies demonstrated that the Olf-1 site, but not the TAATGARAT site, was necessary for Olf-1-mediated trans-activation of the ICP0 promoter.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 6.   Analysis of ICP0 promoter activity without the Olf-1-binding site. A, schematic of the CAT plasmids used for this study. B, Delta Olf-1 (1 µg) was transfected into COS-7 cells with (+) without (-) Olf-1 cDNA (1 µg). C, the designated plasmids (1 µg) were transfected into neuro-2A cells. Forty-eight h after transfection CAT activity was measured. The percent acetylated chloramphenicol values (%Ac-CM) were determined as described under "Experimental Procedures."


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

This study demonstrated that sequences closely resembling a consensus Olf-1-binding site in the ICP0 promoter were necessary for constitutive activity in neuro-2A cells. DNase I footprinting assays protected a 19-base pair motif located from position -97 to -79 that was nearly identical to the consensus Olf-1-binding site. The Olf-1 antibody supershifted the ICP0 Olf-1 DNA protein complex in neuro-2A cells, and an Olf-1 cDNA expression construct activated ICP0 promoter activity. Taken together, these results demonstrated that Olf-1 activated ICP0 promoter activity in transiently transfected cells.

Olf-1 expression occurs during mouse embryogenesis in dorsal root ganglia, trigeminal ganglia, cranial, and glossopharyngeal nerve ganglia (21, 31). We hypothesize that neuronal specific activation of ICP0 expression during reactivation from latency may be regulated by Olf-1. Except for the ICP0 promoter, no additional Olf-1-binding sites were detected in the HSV-1 genome suggesting that ICP0 is the only viral gene that is directly trans-activated by Olf-1. It will be of interest to determine if site-directed mutagenesis of the Olf-1-binding site has any role in HSV-1 pathogenesis or latency. It will also be of interest to determine if stimuli that induce reactivation from latency induce expression of Olf-1 in the peripheral nervous system. Studies aimed at addressing these issues are in progress.

Olf-1 is a novel member of the HLH family of transcription factors that binds to the promoter region of genes involved in odorant transduction pathway (15, 18, 20, 21). Olf-1 was also identified independently and cloned as early B-cell factor that regulates the mb-1 gene (19). Transcriptional activation and DNA binding by Olf-1 is facilitated by homodimerization of Olf-1 (21). Since Olf-1 is an HLH protein, dimerization of Olf-1 with other proteins may also regulate its activity. A novel Olf-1 associated zinc finger protein (Roaz) has been identified that is expressed in precursor cells of olfactory neurons. The Roaz/Olf-1 heterodimer inhibits promoters containing the Olf-1-binding site (32). We hypothesize that Roaz and/or similar factors exist, and these factors prevented activation of the ICP0 promoter by Olf-1 in CV-1 cells.

    ACKNOWLEDGEMENTS

We thank Harikrishna Nakshatri (IU Medical Center, Indianapolis, IN) for help in gel shift assays and Belaguli Narasimhaswamy (Baylor College of Medicine, Houston, TX) and Kotlo Kumar (University of Illinois, Chicago) for their advice. We also thank Dr. Randall Reed (The Johns Hopkins University) for providing Olf-1 cDNA and Olf-1 antibody and Dr. Vikram Misra (University of Saskatchewan) for providing pAB5, pAB2, and pRc/VP16.

    FOOTNOTES

* This work was supported in part by United States Department of Agriculture Grants 9702394 and 9802064 and the Center for Biotechnology.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported in part by a fellowship from the Center for Biotechnology, University of Nebraska, Lincoln.

§ To whom correspondence should be addressed: Center for Biotechnology, Dept. of Veterinary and Biomedical Sciences, University of Nebraska-Lincoln, Fair St. at East Campus Loop, Lincoln, NE 68583-0905. Tel.: 402-472-1890; Fax: 402-472-9690; E-mail: cjones@unlnotes. unl.edu.

    ABBREVIATIONS

The abbreviations used are: HSV-1, herpes simplex virus type 1; IE, immediate early; EMSA, electrophoretic mobility shift assays; ICP0, infected cell protein 0; Olf-1, olfactory neuron-specific transcription factor-1; CAT, chloramphenicol acetyltransferase; NE, nuclear extract; CMV, cytomegalovirus; HLH, helix-loop-helix; WT, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Jones, C. (1998) Adv. Virus Res. 51, 81-133[Medline] [Order article via Infotrieve]
2. Wagner, E. K., and Bloom, D. C. (1997) Clin. Microbiol. Rev. 10, 419-443[Abstract]
3. Cleary, M. A., Stern, S., Tanaka, M., and Herr, W. (1993) Genes Dev. 7, 72-83[Abstract/Free Full Text]
4. O'Hare, P., and Goding, C. R. (1988) Cell 52, 435-445[CrossRef][Medline] [Order article via Infotrieve]
5. O'Hare, P. (1993) Semin. Virol. 4, 145-155
6. Cai, W., and Schaffer, P. A. (1992) J. Virol. 66, 2904-2915[Abstract/Free Full Text]
7. Everett, R. D. (1989) J. Gen. Virol. 70, 1185-1202[Abstract/Free Full Text]
8. Lium, E. K., Panagiotidis, C. A., Wen, X., and Silverstein, S. J. (1998) J. Virol. 72, 7785-7795[Abstract/Free Full Text]
9. Leib, D. A., Coen, D. M., Bogard, C. L., Hicks, K. A., Yager, D. R., Knipe, D. M., Tyler, K. L., and Schaffer, P. A. (1989) J. Virol. 63, 759-768[Abstract/Free Full Text]
10. Stow, N. D., and Stow, E. C. (1986) J. Gen. Virol. 67, 2571-2585[Abstract/Free Full Text]
11. Zhu, X., Chen, J., Young, C. S. H., and Silverstein, S. (1990) J. Virol. 64, 4489-4498[Abstract/Free Full Text]
12. Davido, D. J., and Leib, D. A. (1996) J. Gen. Virol. 77, 1853-1863[Abstract/Free Full Text]
13. Davido, D. J., and Leib, D. A. (1998) J. Gen. Virol. 79, 2093-2098[Abstract]
14. Tamura, T.-A., Konishi, K., Makino, Y., and Mikoshiba, K. (1996) Neurochem. Int. 29, 573-581[CrossRef][Medline] [Order article via Infotrieve]
15. Kudrycki, K., Stein-Izsak, C., Behn, C., Grillo, M., Akeson, R., and Margolis, F. L. (1993) Mol. Cell. Biol. 13, 3002-3014[Abstract/Free Full Text]
16. Verhaagen, J., Oestreicher, A. B., Grillo, M., Khew-Goodall, Y.-S., Gispen, W. H., and Margolis, F. L. (1990) J. Neurosci. Res. 26, 31-44[CrossRef][Medline] [Order article via Infotrieve]
17. Reed, R. R. (1998) Science 279, 193[Free Full Text]
18. Wang, M. M., Tsai, R. Y. L., Schrader, K. A., and Reed, R. R. (1993) Mol. Cell. Biol. 13, 5805-5813[Abstract/Free Full Text]
19. Hagman, J., Belanger, C., Travis, A., Turck, C. W., and Grossched, L. R. (1993) Genes Dev. 7, 760-773[Abstract/Free Full Text]
20. Wang, M. M., and Reed, R. R. (1993) Nature 364, 121-126[CrossRef][Medline] [Order article via Infotrieve]
21. Wang, S. S., Tsai, R. Y. L., and Reed, R. R. (1997) J. Neurosci. 17, 4149-4158[Abstract/Free Full Text]
22. Liu, X., Giza, C. C., and Vrana, K. E. (1990) BioTechniques 9, 168-173[Medline] [Order article via Infotrieve]
23. Devireddy, L. R., and Jones, C. J. (1998) J. Virol. 72, 7294-7301[Abstract/Free Full Text]
24. Devireddy, L. R., Kumar, K. U., Pater, M. M., and Pater, A. (1996) J. Med. Virol. 49, 205-211[CrossRef][Medline] [Order article via Infotrieve]
25. Nakshatri, H., Pater, M. M., and Pater, A. (1990) Virology 177, 784-789[CrossRef][Medline] [Order article via Infotrieve]
26. Hennighausen, L., and Luban, H. (1987) 152, 721-735
27. Chodosh, L. A., Baldwin, A. S., Carthew, R. W., and Sharp, P. A. (1988) Mol. Cell. Biol. 13, 11-24
28. Nakshatri, H., and Bhat-Nakshatri, P. (1997) Anal. Biochem. 249, 103-104[CrossRef][Medline] [Order article via Infotrieve]
29. St.-Arnaud, R., and Moir, J. M. (1993) Mol. Cell. Biol. 13, 1590-1598[Abstract/Free Full Text]
30. Smale, S. T. (1997) Biochim. Biophys. Acta 1351, 73-88[Medline] [Order article via Infotrieve]
31. Davis, J. A., and Reed, R. R. (1996) J. Neurosci. 16, 5082-5094[Abstract/Free Full Text]
32. Tsai, R. Y. L., and Reed, R. R. (1997) J. Neurosci. 17, 4159-4169[Abstract/Free Full Text]


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
R. L. Thompson, M. T. Shieh, and N. M. Sawtell
Analysis of Herpes Simplex Virus ICP0 Promoter Function in Sensory Neurons during Acute Infection, Establishment of Latency, and Reactivation In Vivo
J. Virol., November 15, 2003; 77(22): 12319 - 12330.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
V. Geiser and C. Jones
Stimulation of bovine herpesvirus-1 productive infection by the adenovirus E1A gene and a cell cycle regulatory gene, E2F-4
J. Gen. Virol., April 1, 2003; 84(4): 929 - 938.
[Abstract] [Full Text] [PDF]


Home page
Clin. Microbiol. Rev.Home page
C. Jones
Herpes Simplex Virus Type 1 and Bovine Herpesvirus 1 Latency
Clin. Microbiol. Rev., January 1, 2003; 16(1): 79 - 95.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. M. Loiacono, R. Myers, and W. J. Mitchell
Neurons Differentially Activate the Herpes Simplex Virus Type 1 Immediate-Early Gene ICP0 and ICP27 Promoters in Transgenic Mice
J. Virol., March 1, 2002; 76(5): 2449 - 2459.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Inman, G.-C. Perng, G. Henderson, H. Ghiasi, A. B. Nesburn, S. L. Wechsler, and C. Jones
Region of Herpes Simplex Virus Type 1 Latency-Associated Transcript Sufficient for Wild-Type Spontaneous Reactivation Promotes Cell Survival in Tissue Culture
J. Virol., April 15, 2001; 75(8): 3636 - 3646.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
M. Inman, Y. Zhang, V. Geiser, and C. Jones
The zinc ring finger in the bICP0 protein encoded by bovine herpesvirus-1 mediates toxicity and activates productive infection
J. Gen. Virol., March 1, 2001; 82(3): 483 - 492.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Devireddy, L. R.
Right arrow Articles by Jones, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Devireddy, L. R.
Right arrow Articles by Jones, C. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement