|
J Biol Chem, Vol. 275, Issue 11, 8183-8189, March 17, 2000
Molecular Basis of Cell-specific Endothelial Nitric-oxide
Synthase Expression in Airway Epithelium*
Zohre
German ,
Ken L.
Chambliss ,
Margaret C.
Pace ,
Urs A.
Arnet§,
Charles J.
Lowenstein§, and
Philip W.
Shaul ¶
From the Department of Pediatrics, University of
Texas Southwestern Medical Center, Dallas, Texas 75235 and the
§ Department of Medicine, The Johns Hopkins University
School of Medicine, Baltimore, Maryland 21287
 |
ABSTRACT |
Nitric oxide (NO) plays an important role in
airway function, and endothelial NO synthase (eNOS) is expressed in
airway epithelium. To determine the basis of cell-specific eNOS
expression in airway epithelium, studies were performed in NCI-H441
human bronchiolar epithelial cells transfected with the human eNOS
promoter fused to luciferase. Transfection with 1624 base pairs of
sequence 5' to the initiation ATG (position 1624) yielded a 19-fold
increase in promoter activity versus vector alone. No
activity was found in lung fibroblasts, which do not express eNOS. 5'
deletions from 1624 to 279 had modest effects on promoter activity
in H441 cells. Further deletion to 248 reduced activity by 65%, and
activity was lost with deletion to 79. Point mutations revealed that
the GATA binding motif at 254 is mandatory for promoter activity and
that the positive regulatory element between 248 and 79 is the Sp1
binding motif at 125. Electrophoretic mobility shift assays yielded
two complexes with the GATA site and three with the Sp1 site.
Immunodepletion with antiserum to GATA-2 prevented formation of the
slowest migrating GATA complex, and antiserum to Sp1 supershifted the
slowest migrating Sp1 complex. An electrophoretic mobility shift assay
with H441 versus fibroblast nuclei revealed that the
slowest migrating GATA complex is unique to airway epithelium. Thus,
cell-specific eNOS expression in airway epithelium is dependent on the
interaction of GATA-2 with the core eNOS promoter, and the proximal Sp1
binding site is also an important positive regulatory element.
 |
INTRODUCTION |
There is increasing evidence that nitric oxide
(NO),1 produced by the enzyme
nitric-oxide synthase (NOS), plays an important role in physiologic and
pathologic processes in the airway (1-3). NO is present in expired gas
(4), and studies in animal models as well as in humans suggest that the
principle source of expired NO is the airway rather than the pulmonary
vasculature (5, 6). The functions of NO in the mature airway include
smooth muscle relaxation, neurotransmission, and bacteriostasis, as
well as the modulation of ciliary motility, mucin secretion, and plasma exudation (1, 2). Studies in the perinatal period indicate that airway
NO is also critically involved in the regulation of lung liquid
production and tissue resistance (7-10).
One of the key cellular sources of airway NO is the epithelium (2), and
it has been previously demonstrated that the endothelial isoform of NOS
(eNOS) is constitutively expressed in the airway epithelium of humans
and a variety of animal species (11-13). There is also evidence that
airway epithelial NOS expression is attenuated during inflammatory
conditions, potentially contributing to airway dysfunction, but the NOS
isoform(s) involved has not been identified (14). In addition, studies
suggest that there are dramatic changes in whole lung eNOS expression
during normal development and with prolonged changes in oxygenation,
but the cell specificity of these alterations has not been elucidated
(15). As such, the mechanisms regulating eNOS expression in the
pulmonary epithelium have an important impact on lung function.
The transcriptional regulation of eNOS in endothelial cells is
partially understood. The 1600-base pair regulatory region upstream of
the eNOS transcription initiation site has lengthy conserved regions in
mice, cows, and humans (16). Contained within this region are response
elements to Sp1 and GATA, and these sites are critical to basal
transcription of eNOS in aortic endothelial cells (17). The eNOS
promoter also contains two regulatory regions that bind to a variety of
transcription factors, including Ets and Sp family members, MAZ and
YY1, and these domains may be important in regulating eNOS
transcription as well (18). In addition, recent evidence suggests that
eNOS is expressed in selective microvascular beds, and this selectivity
may be related to a platelet-derived growth factor response element in
the eNOS promoter (19). Thus, a considerable amount of work has
identified regulatory elements within the eNOS promoter and the
transcription factors that interact with them to regulate eNOS
expression in endothelial cells. However, eNOS is also expressed in a
variety of nonendothelial cell types, and the cell-specific regulation of eNOS is not understood. In particular, the mechanisms regulating eNOS expression in airway epithelial cells have not been characterized.
To begin to better understand the regulation of lung epithelial NO
production and eNOS expression, the present studies were designed to
determine the molecular basis of cell-specific eNOS expression in the
airway epithelium. In this investigation, the cis DNA sequences
required for basal eNOS transcription in airway epithelium have been
identified. In addition, since studies employing immunohistochemistry
or in situ hybridization have revealed that pulmonary eNOS
expression is limited solely to the vascular endothelium and airway
epithelium (11-13), these mechanisms have been compared in the
epithelium and endothelium.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
Airway epithelial cell experiments were
principally performed with NCI-H441 human bronchiolar epithelial cells,
which are of Clara cell lineage (20-22). We have previously
demonstrated that these cells exclusively express the eNOS isoform in a
constitutive manner and that the abundance of eNOS is approximately 2%
of that found in pulmonary endothelial cells (23). The use of this
continuous cell line allows for the specific examination of airway
epithelial cell eNOS gene regulation without contamination by resident
macrophages or endothelial cells that may be present in primary cell
cultures. In addition, eNOS expression in this cell line is not altered after multiple passages in culture. The cells were propagated in RPMI
medium containing 10% fetal bovine serum, 1% L-glutamine, 1% antibiotic/antimycotic mixture, 0.5% ampicillin, 0.15% nystatin, 0.15% gentamycin, and 0.10% tylosin in a humidified incubator with
5% CO2 in air at 37 °C. The cells were studied in
six-well tissue culture plates (Corning Costar Corp., Cambridge, MA) at subconfluence.
In order to compare eNOS transcription in different pulmonary cell
types, additional experiments were performed in primary ovine
intrapulmonary artery endothelial cells known to express the enzyme
(24) and also in CCD-Lu human lung fibroblasts (ATCC, Manassas, VA),
which do not express the enzyme. The pulmonary artery endothelial cells
were obtained and propagated as described previously and studied at
passage 4-6 (24), and the CCD-Lu cells were maintained in the RPMI
medium described above. Studies were also done using BEAS-2B (ATCC) and
NHBE cell lines (Clonetics Corp., San Diego, CA) to evaluate eNOS
transcription in airway epithelium that is not of Clara cell origin.
BEAS-2B and NHBE cells were propagated in BEGM medium (Clonetics).
Construction of Reporter Plasmids and Mutagenesis--
A
fragment of DNA containing the 5'-flanking region of the human eNOS
gene was amplified using the polymerase chain reaction (PCR). The
template DNA for the PCR was a BlueScript plasmid (Stratagene) containing 6 kilobase pairs of genomic human DNA, including 1.6 kilobase pairs upstream from the human eNOS gene (25). This was kindly
provided by Thomas Michel (Department of Medicine, Brigham and Women's
Hospital and Harvard Medical School, Boston, MA). The primers for the
PCR, designed to amplify DNA from 1.6 kilobase pairs upstream of the
eNOS AUG to the transcriptional start site of eNOS were
5'-CGCGGTACCATCTGATGCTGCCTGTCA-3' (forward) and
5'-CGCAAGCTTGTTACTGTGCGTCCACTC-3' (reverse). The 1.6-kilobase pair PCR
product was inserted into KpnI/HindIII sites of
the luciferase reporter gene plasmid, pGL2 (Promega Corp., Madison, WI)
to yield the full-length promoter-reporter plasmid denoted as
1624eNOS-Luc. The nucleotide sequence was determined to confirm that
no errors had been introduced by PCR amplification.
To generate progressive 5' deletion mutants, a series of forward
primers were used in combination with the above noted reverse primer in
a PCR with the full-length promoter as template. The forward primers,
each with a KpnI site (underlined), were
5'-CGCGGTACCCCTGTGGACCAGATGCC-3', 5'-CGCGGTACCCACTCCCCAATGCCCCAG-3',
5'-CGCGGTACCGCTCTGCTGGACACCTGGGCT-3', 5'-CGCGGTACCAGCCTCAGTCCTCACAGCGGAAC-3', and
5'-CGCGGTACCTCCTCTCGGTCCCCTCCCTCTTC-3'. The resulting
PCR products were gel-purified, digested, and subcloned into the
KpnI/HindIII sites of pGL2. They were designated
as 994eNOS-Luc, 318eNOS-Luc, 279eNOS-Luc, 248eNOS-Luc, and
79eNOS-Luc.
To generate site-directed mutants of GATA and Sp1 elements at 254 and
125, respectively, recombinant PCR was performed with two rounds of
amplification. The primers for mutation of the GATA domain were
GCTCCCACTTTAGAGCCTCAGT (sense) and
GAGGCTCTAAAGTGGGAGC (antisense), and for the Sp1 domain they
were GGATAGGGACTGGGCGAGG (sense) and
CCTCGCCCAGTCCCTATCC (antisense), with the
mutations shown in boldface type. Sense and antisense mutated primers
were incubated in separate reaction tubes with 1624eNOS-Luc as
template and with one outside complementary primer from upstream or
downstream of the mutation site, thus yielding two complementary fragments that each contained the appropriate mutation. These subfragments were end-filled and annealed, and a second round of PCR
was performed using two outside primers. The PCR products were isolated
and subcloned into the KpnI/HindIII sites of
pGL2. All constructs were verified by sequencing the inserts and
flanking regions of the plasmid.
Cell Transfection--
Cell transfection was performed using
methods modified from those previously reported (26, 27). Cells grown
to 50-60% confluence in 6-well plates were preincubated in Opti-MEM
medium (Life Technologies, Inc.) for 30 min at 37 °C. 1624eNOS-Luc
or 5' deletion or site-directed mutant constructs (1 µg) and a
plasmid containing SV40-driven -galactosidase (pSV- -Gal; Promega
Corp.), to normalize for transfection efficiency, were mixed with
LipofectAMINE (Life Technologies; 10 µl/well) and incubated in a
total volume of 200 µl for 30 min at room temperature. The
lipid-coated DNA and 800 µl of Opti-MEM were then added to each well
of cells. After 5 h, 1 ml of growth medium containing 20%
iron-supplemented calf serum and 20% lamb serum was added to each
well, and the following day the medium was replaced with growth medium.
72 h following transfection, the cells were lysed, and the
extracts were centrifuged at 10,000 × g to remove
unbroken cells and debris. Luciferase activity was measured using a
luminometer (Monolight 2010, Analytical Luminescence Laboratory, Ann
Arbor, MI) (28), and -galactosidase activity was measured
spectrophotometrically (at 420 nm) by the generation of
o-nitrophenol from the substrate, o-nitrophenyl- -D-galactopyranoside (29). The
results are normalized as relative luciferase light
units/ -galactosidase activity. In selected wells, the cells were
transfected with pGL2-Control Vector (Promega Corp.) containing an SV40
promoter and enhancer to serve as a positive control for luciferase expression.
Nuclear Extract Preparation--
Cells were rinsed twice with
ice-cold phosphate-buffered saline, scraped, and pelleted at 500 × g for 5 min. Cell pellets were lysed in buffer containing
10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, and 0.5% Nonidet P-40 and incubated
at 4 °C for 5 min. The lysate was then transferred into an ice-cold
Dounce homogenizer, broken with 35 strokes of a pestle, and centrifuged at 500 × g for 5 min at 4 °C. The nuclear pellet
was suspended in buffer containing 20 mM Tris-HCl (pH 8.1),
75 mM NaCl, 0.5 mM EDTA, 1 mM
dithiothreitol, 50% glycerol, 1 µg/ml leupeptin, 5 µg/ml
aprotinin, and 0.5 mM phenylmethylsulfonyl fluoride. The nuclear extracts were sonicated and stored at 80 °C.
Electrophoretic Mobility Shift Assays--
The oligonucleotide
probes were prepared by annealing complementary DNA strands at 95 °C
for 5 min. Probes were end-labeled with [ -32P]ATP
using T4 polynucleotide kinase (Life Technologies), and unlabeled
oligonucleotide was removed using P6 columns (Bio-Rad). Typically,
specific activities were 300,000 cpm/ng DNA. Nuclear extracts (8 µg)
were incubated in buffer containing 25 mM HEPES (pH 7.5),
50 mM KCl, 1 mM dithiothreitol, 5% glycerol,
and 1 µg of poly(dI-dC) (Sigma) at room temperature for 10 min. The
32P-labeled oligonucleotide probe (approximately 2 × 106 cpm) was then added for an additional 20 min in a total
reaction volume of 30 µl. In competition studies, excess wild-type,
mutant, or unrelated oligonucleotides were added in a 2-200-fold molar excess prior to the addition of the 32P-labeled probe. The
wild-type GATA probe was 5'-GCTCCCACTTATCAGCCTCAGT-3' (upper
strand), and the mutant GATA probe was
5'-GCTCCCACTTTAGAGCCTCAGT-3'. The wild-type Sp1 probe was
5'-GGATAGGGGCGGGGCGAGG-3' (upper strand), and the
mutant probe was 5'-GGATAGGGACTGGGCGAGG-3'.
To identify the nuclear proteins that bound to the GATA and Sp1
domains, antibody depletion or supershifting of the DNA-protein complex
was performed. For GATA, 2 µl of antiserum to GATA-1 or GATA-2 (Santa
Cruz Biotechnology, Inc., Santa Cruz, CA) or unrelated antiserum was
added to the nuclear extract for 30 min prior to the addition of
oligonucleotide probe. For Sp1, 2 µl of antiserum to Sp1 (Santa Cruz
Biotechnology) or unrelated antiserum was added to the DNA-nuclear
protein complexes for 45 min at room temperature prior to
electrophoresis. All nuclear protein-DNA complexes were resolved on 5%
nondenaturing polyacrylamide gels containing 1× Tris borate/EDTA
buffer. Dried gels were exposed to Kodak XAR film for autoradiography.
Statistical Analysis--
Data for promoter activity were
analyzed by analysis of variance and Neuman-Keuls post hoc
testing (30). Results are expressed as mean ± S.E. All stated
differences achieved statistical significance at the 0.05 level of
probability or less.
 |
RESULTS |
eNOS Promoter Activity in Pulmonary Cell Types--
Since
pulmonary eNOS expression is limited solely to the vascular endothelium
and airway epithelium (11-13), we first compared basal promoter
activity in the epithelium and endothelium and in lung fibroblasts,
which do not express eNOS, serving as a negative control. Transfection
of H441 airway epithelial cells with 1624eNOS-Luc resulted in a
19-fold increase in promoter activity compared with transfection with
vector alone (Fig. 1). In parallel but to
a greater extent, transfection of pulmonary artery endothelial cells with 1624eNOS-Luc yielded 35-fold more activity than vector alone. However, there was no detectable eNOS promoter activity in the lung
fibroblasts. Basal promoter activity was then compared in different
airway epithelial cell types, using the H441 cells, which are of Clara
cell lineage, and BEAS-2B and NHBE cells, which are not of Clara cell
origin (Fig. 2). Transfection with
1624eNOS-Luc resulted in approximately 6-fold greater promoter
activity in the H441 Clara cells compared with the other epithelial
cell types, which displayed 3-4-fold more activity than vector
alone.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1.
eNOS gene promoter activity in different
pulmonary cell types. The eNOS promoter-reporter gene construct,
1624eNOS-Luc, or vector alone, Luc, were cotransfected with
SV40-driven -galactosidase plasmid ( -gal), and
relative activities (Luc/ -gal) were determined in cell
lysates 72 h later. Studies were performed in H441 airway
epithelial cells, pulmonary endothelial cells, and CCD-18Lu lung
fibroblasts. Values are mean ± S.E. (n = 3), and
the results are representative of the findings of three independent
experiments.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 2.
eNOS gene promoter activity in different
airway epithelial cell types. The eNOS promoter-reporter gene
construct, 1624eNOS-Luc, or vector alone, Luc, were cotransfected
with SV40-driven -galactosidase plasmid ( -gal), and
relative activities (Luc/ -gal) were determined in cell
lysates 72 h later. Studies were performed in H441 cells of Clara
cell origin and the non-Clara cell lines BEAS-2B and NHBE. Values are
mean ± S.E. (n = 3), and the results are
representative of the findings of three independent experiments.
|
|
Promoter Elements Required for Airway Epithelial
Expression--
To determine the elements in the eNOS promoter
required for airway epithelial expression of the gene, the activities
of progressive 5' deletion mutants were evaluated in the H441 cells.
Deletion from 1624 to 994 resulted in a modest decline in promoter
activity of 21% (Fig. 3A).
However, further deletion to 318 caused a return to activity levels
that were comparable with those with 1642eNOS-Luc. Deletion from
318 to 279 yielded a modest increase in promoter activity of 27%
(Fig. 3B). Further deletion from 279 to 248 resulted in
a 65% decline in promoter activity. In addition, deletion from 248
to 79 caused a complete loss of basal promoter activity.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 3.
Activity of 5' deletion mutants of the eNOS
gene promoter in H441 airway epithelial cells. A, the
eNOS promoter-reporter gene constructs, 1624eNOS-Luc, 994eNOS-Luc,
or 318eNOS-Luc, were cotransfected with SV40-driven -galactosidase
plasmid ( -gal), and relative activities
(Luc/ -gal) were determined in cell lysates 72 h
later. The activity with vector alone was less than 5% of that
obtained with the eNOS promoter constructs (not shown). B,
similar studies were performed with 318eNOS-Luc, 279eNOS-Luc,
248eNOS-Luc, or 79eNOS-Luc. Values are mean ± S.E.
(n = 3), and the results are representative of the
findings of three independent experiments.
|
|
Inspection of the proximal eNOS promoter reveals that there is a
potential GATA binding site at 254 and a potential Sp1 regulatory element at 125 (25). Because a dramatic decrease in promoter activity
in the H441 airway epithelial cells was observed with progressive 5'
deletion of these domains, site-directed mutants of either the GATA or
Sp1 site within 1624eNOS-Luc were tested (Fig.
4, upper panel).
Mutation of the GATA motif caused a marked decrease in basal promoter
activity to levels comparable with the background observed with vector
alone. Mutation of the Sp1 site resulted in a 74% decline in promoter
activity. Since these binding domains have also been found to be
critical to basal transcription of eNOS in endothelial cells (27),
parallel studies were performed in that cell type (Fig. 4,
lower panel). Similar to the findings in airway
epithelium, mutation of the GATA motif caused a complete loss of basal
promoter activity in the pulmonary endothelial cells, and mutation of
the Sp1 site caused an 82% decrease in basal promoter activity.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 4.
Activity of GATA and Sp1 site mutants of the
eNOS gene promoter in H441 airway epithelial cells (upper
panel) and pulmonary endothelial cells
(lower panel). The 1624eNOS-Luc
wild-type construct or site-directed mutants (Mut.) of the
GATA consensus site at 254 or the Sp1 binding motif at 125 or
vector alone ( Luc) were cotransfected with SV40-driven
-galactosidase plasmid ( -gal), and relative activities
(Luc/ -gal) were determined in cell lysates 72 h
later. Values are mean ± S.E. (n = 3), and the
results are representative of the findings of three independent
experiments.
|
|
Evaluation of Relevant Nuclear Proteins--
To evaluate the
nuclear proteins in airway epithelial cells involved in binding to the
GATA and Sp1 domains of the eNOS promoter, electrophoretic mobility
shift assays were performed. Incubation of nuclear extracts from the
H441 airway epithelial cells with a double-stranded oligonucleotide
probe encompassing the putative GATA site at 254 resulted in the
appearance of two major DNA-protein complexes that were diminished by a
200-fold molar excess of unlabeled probe (Fig.
5A). The slower migrating
complex was not formed with mutated GATA site probe, but the faster
migrating complex was formed. The use of the mutated oligonucleotide as
a competitor did not prevent the formation of either complex by the
wild-type probe. In addition, competition with an unrelated
oligonucleotide did not prevent complex formation by the wild-type
probe (data not shown). Incubation of H441 nuclear extracts with a
probe containing the putative Sp1 site at 125 resulted in the
appearance of three major DNA-protein complexes and one minor
DNA-protein complex that were prevented by a 200-fold molar excess of
unlabeled probe (Fig. 5B). The three major Sp1-nuclear
protein complexes were not formed with mutated Sp1 DNA probe, and the
mutated oligonucleotide did not prevent the formation of the major
complexes by the wild-type probe. Unrelated oligonucleotide also did
not prevent complex formation by the wild-type probe (data not
shown).

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 5.
Electrophoretic mobility shift assays with
H441 airway epithelial cell nuclear extracts. Extracts were
incubated with labeled double-stranded oligonucleotide probes
containing either the eNOS gene GATA consensus binding site at 254
(A) or the Sp1 binding motif at 125 (B) or
their corresponding mutant probes. Competition reactions were performed
with either cold, wild-type competitor (comp.) at a 2-, 20-, or 200-fold molar excess or mutant competitor (mut. comp.)
at a 200-fold molar excess. The observations were confirmed in at least
three independent experiments. Major complexes are identified with
solid arrows, and minor complexes are designated
by arrowheads.
|
|
To identify the epithelial nuclear proteins involved in complex
formation with the GATA and Sp1 eNOS promoter elements, immunodepletion and supershift analyses were done. Preincubation of H441 nuclear extracts with an antiserum directed against GATA-2, but not an antiserum directed against GATA-1 or an unrelated antiserum, caused diminished formation of the slower migrating DNA-protein complexes involving the GATA site (Fig.
6A). Antiserum to Sp1 shifted
the slowest migrating Sp1 probe-nuclear protein complex, whereas an unrelated antiserum did not do so (Fig. 6B).

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 6.
Immunodepletion and supershift analyses of
nuclear protein-eNOS promoter DNA complexes in H441 airway epithelial
cells. A, antiserum to GATA-2 or GATA-1 or unrelated
antiserum was added to the nuclear extract prior to the addition of
oligonucleotide probe containing the GATA consensus binding site at
254. B, antiserum to Sp1 or unrelated antiserum was added
to the DNA-nuclear protein complexes formed using oligonucleotide probe
containing the Sp1 binding motif at 125 prior to electrophoresis. The
observations were confirmed in at least three independent experiments.
Major complexes are identified with solid arrows,
and minor complexes are designated by solid
arrowheads. Supershifted complex is identified with an
open arrow.
|
|
To reveal which DNA-nuclear protein complexes are involved in
cell-specific eNOS expression, electrophoretic mobility shift assays
were compared using nuclear extracts from H441 epithelial cells, which
express eNOS, and from CCD-18Lu lung fibroblasts, which do not express
eNOS. As observed previously (Fig. 5), two primary DNA-protein
complexes were formed when oligonucleotide probe encompassing the GATA
site was incubated with H441 nuclear extract, and complex formation was
prevented by unlabeled probe (Fig.
7A). However, whereas the
faster migrating DNA-protein complex was present when fibroblast
nuclear extract was employed, the slower migrating complex was
completely absent. In contrast, in the experiment using the Sp1 DNA
probe (Fig. 7B), identical multiple DNA-protein complexes
were obtained with both H441 epithelial and lung fibroblast nuclear
extracts. Thus, the slower migrating GATA site-protein complex is
unique to the epithelial cells, which express eNOS.

View larger version (74K):
[in this window]
[in a new window]
|
Fig. 7.
Comparison of nuclear protein-eNOS promoter
DNA complexes in H441 airway epithelial cells and CCD-18Lu lung
fibroblasts. Nuclear extracts were incubated with labeled
double-stranded oligonucleotide probes containing either the eNOS gene
GATA consensus binding site at 254 (A) or the Sp1 binding
motif at 125 (B). Competition reactions were performed
with cold, wild-type competitor (comp.) at 2-, 20-, or
200-fold molar excess. The observations were confirmed in at least
three independent experiments. Major complexes are identified with
solid arrows, and minor complexes are designated
by arrowheads.
|
|
 |
DISCUSSION |
In the present study, we have determined the molecular basis of
cell-specific eNOS expression in the airway epithelium. In transient
transfection experiments with 1624 base pairs of the human eNOS
promoter sequence 5' to the initiation ATG fused to a luciferase gene
( 1624eNOS-Luc), we have observed that basal transcription is
demonstrable in H441 airway epithelial cells as well as in pulmonary
endothelial cells but not in lung fibroblasts. These findings are
consistent with the previous observation that eNOS protein in the lung
is expressed solely in the airway epithelium and vascular endothelium
(11-13). In addition, we have found that basal transcription is
greater in airway epithelium of Clara cell origin compared with
non-Clara cells. Thus, the mechanisms underlying cell-specific eNOS
expression in airway epithelium reside in the function of cis DNA
sequences of the eNOS gene, and these processes are maximal in certain
airway epithelial cell types.
Studies of progressive 5' deletion mutants of the 1624eNOS-Luc
construct revealed that there are positive and negative regulatory elements of modest significance between 1624 and 279 and that key
positive regulatory elements reside between 279 and 248 and also
between 248 and 79. Since there is a potential GATA binding site at
254 and a potential Sp1 binding site at 125 (25), site-directed
mutants of either the GATA or Sp1 site within 1624eNOS-Luc were
tested in the H441 cells. Mutation of the GATA site at 254 caused
complete attenuation of basal promoter activity, and mutation of the
Sp1 site at 125 yielded promoter activity that was one-fourth of that
with the wild-type promoter. Parallel studies in pulmonary endothelial
cells yielded comparable results. These collective findings indicate
that both the GATA and Sp1 binding motifs in the core eNOS promoter are
critical to the basal transcription of the eNOS gene in the airway
epithelium and also the pulmonary vascular endothelium. The present
observations contrast with those previously made in aortic endothelium,
in which site-directed mutation of the GATA binding motif only yielded
a 25-30% decline in promoter activity, whereas mutation of the Sp1
site caused an 85-90% fall (17). This suggests that the GATA binding
site may be of particular importance to eNOS gene transcription in the
lung, but a comparison of promoter function in epithelium and
endothelium from numerous organs would be required to test such a possibility.
To evaluate the nuclear proteins in airway epithelial cells involved in
binding to the GATA domain of the eNOS promoter, electrophoretic mobility shift assays were performed with oligonucleotide probe encompassing the GATA site at 254. Two specific DNA-protein complexes were formed with wild-type probe. When a mutated GATA site probe was
used, the slower migrating complex was not formed, but the faster
migrating complex was evident. Since the identical mutation of the
1624eNOS-Luc construct yielded a total loss of basal promoter activity, it suggests that the slower migrating complex, and not the
faster migrating one, is primarily involved in the regulation of basal
eNOS gene expression in the airway epithelium. These findings are
consistent with the formation of a single GATA DNA element-nuclear
protein complex in previous studies of aortic endothelium (17).
Epithelial nuclear protein binding to the Sp1 site at 125 was also
assessed, yielding three major DNA-protein complexes and one minor
specific DNA-protein complex. This finding is similar to previous
observations made in studies of aortic endothelium (17). The three
major complexes were not formed with a mutated Sp1 DNA probe, and the
mutated oligonucleotide did not prevent the formation of the major
complexes by the wild-type probe, but the rapidly migrating minor
complex was present when a mutated Sp1 site probe was used. Since the
identical mutation of the 1624eNOS-Luc construct yielded a
considerable loss in basal transcription, it suggests that the
protein-DNA interaction represented by one or all of the three major
complexes plays a role in the regulation of basal eNOS gene expression
in the airway epithelium.
To identify the epithelial nuclear proteins involved in complex
formation with the GATA and Sp1 eNOS promoter elements, immunodepletion and supershift analyses were done. Antiserum directed against GATA-2,
but not an antiserum to GATA-1 or an unrelated antiserum, prevented the
formation of the slower migrating DNA-protein complex involving the
GATA site. This finding suggests that the GATA-2 nuclear protein plays
a pivotal role in the regulation of basal eNOS gene expression in the
airway epithelium. Although GATA proteins are primarily known to be of
importance to gene modulation in hematopoietic cells, a unique role for
GATA-2, and not GATA-1, has been observed in transcriptional regulation
in nonhematopoietic cells such as in platelet-endothelial cell adhesion
molecule gene transcription in endothelium (31). Antiserum to Sp1
shifted the slowest migrating Sp1 probe-nuclear protein complex,
whereas an unrelated antiserum did not do so. Thus, the Sp1 nuclear
protein is likely to also play a role in basal eNOS gene expression in the airway epithelium. The identities of the proteins forming the other
two complexes with the Sp1 binding motif are yet to be determined.
Previous work in aortic endothelial cells has yielded virtually
identical findings for immunodepletion and supershift analyses (17),
revealing that the GATA-2 and Sp1 nuclear proteins are integrally
involved in the expression of eNOS in both the airway epithelium and
vascular endothelium.
To reveal which DNA-nuclear protein complexes underlie the cell
specificity of eNOS expression in the airway epithelium,
electrophoretic mobility shift assays were compared using nuclear
extracts from the H441 cells, which express eNOS, and from the CCD-18Lu
lung fibroblasts, which do not express eNOS. In contrast to the
findings with the GATA site probe and H441 nuclear extract, incubation of GATA probe with fibroblast nuclear extract yielded the faster migrating DNA-protein complex, but the slower migrating complex was
completely absent. In experiments using the Sp1 DNA probe, identical
multiple complexes were obtained with both H441 epithelial and lung
fibroblast nuclear extracts. Thus, the slower migrating GATA
site-protein complex is unique to the epithelial cells compared with
fibroblasts. Since immunodepletion with antiserum to GATA-2 prevented
the formation of this complex in the H441 cells, these findings
indicate that GATA-2 protein interaction with the core eNOS promoter is
required for cell-specific expression of eNOS in airway epithelium.
In addition to revealing the basis for airway epithelial eNOS
expression, the present observations may be relevant to the role of
eNOS in nonpulmonary epithelial cells. eNOS expression has been
demonstrated in renal epithelium, where it may have a critical role in
tubular function (32, 33). In addition, eNOS is expressed in various
epithelial cell types of both the male and female reproductive organs,
with differential expression during the oestrus cycle in the latter,
suggesting that it is involved in modulating reproduction (34, 35).
Further studies of eNOS promoter function in the airway epithelium will
enhance our basic understanding of the regulation of eNOS gene
expression in epithelium of both pulmonary and nonpulmonary origin.
 |
ACKNOWLEDGEMENTS |
We are indebted to Marilyn Dixon and Todd
Sherman for assistance in preparing the manuscript.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grants HD30276 and HL63399.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
An Established Investigator of the American Heart Association.
To whom correspondence should be addressed: Dept. of Pediatrics, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235-9063. Tel.: 214-648-2015; Fax: 214-648-2481; E-mail: pshaul@mednet.swmed.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
NO, nitric oxide;
NOS, nitric-oxide synthase;
eNOS, endothelial nitric-oxide synthase;
PCR, polymerase chain reaction.
 |
REFERENCES |
| 1.
|
Barnes, P. J.
(1995)
Ann. Med.
27,
389-393[Medline]
[Order article via Infotrieve]
|
| 2.
|
Gaston, B.,
Grazen, J. M.,
Loscalzo, J.,
and Stamler, J. S.
(1994)
Am. J. Respir. Crit. Care. Med.
149,
538-551[Abstract]
|
| 3.
|
Nijkamp, F. P.,
and Folkerts, G.
(1995)
Arch. Int. Pharmacodyn. Ther.
329,
81-96[Medline]
[Order article via Infotrieve]
|
| 4.
|
Gaston, B.,
Drazen, J.,
Chee, C. B. E.,
Wohl, M. E. B.,
and Stamler, J. S.
(1993)
Endothelium
1,
87-92
|
| 5.
|
Gustafsson, L. E.,
Leone, A. M.,
Persson, M. G.,
Wiklund, N. P.,
and Moncada, S.
(1991)
Biochem. Biophys. Res. Commun.
181,
852-857[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Dweik, R. A.,
Laskowski, D.,
Abu-Soud, H. M.,
Kaneko, F. T.,
Hutte, R.,
Stuehr, D. J.,
and Erzurum, S. C.
(1998)
J. Clin. Invest.
101,
660-666[Medline]
[Order article via Infotrieve]
|
| 7.
|
Cummings, J. J.
(1995)
J. Appl. Physiol.
79,
1212-1218[Abstract/Free Full Text]
|
| 8.
|
Cummings, J. J.
(1997)
J. Appl. Physiol.
83,
1538-1544[Abstract/Free Full Text]
|
| 9.
|
Jakupaj, M.,
Martin, R. J.,
Dreshaj, I. A.,
Potter, C. F.,
Haxhiu, M. A.,
and Ernsberger, P.
(1997)
Am. J. Physiol.
273,
L531-L536[Abstract/Free Full Text]
|
| 10.
|
Potter, C. F.,
Dreshaj, I. A.,
Haxhiu, M. A.,
Stork, E. K.,
Chatburn, R. L.,
and Martin, R. J.
(1997)
Pediatr. Res.
41,
886-891[Medline]
[Order article via Infotrieve]
|
| 11.
|
Giaid, A.,
and Saleh, D.
(1995)
N. Engl. J. Med.
333,
214-221[Abstract/Free Full Text]
|
| 12.
|
Xue, C.,
Reynolds, P. R.,
and Johns, R. A.
(1996)
Am. J. Physiol.
270,
L88-L100[Abstract/Free Full Text]
|
| 13.
|
Sherman, T. S.,
Chen, Z.,
Yuhanna, I. S.,
Lau, K. S.,
Margraf, L. R.,
and Shaul, P. W.
(1999)
Am. J. Physiol.
276,
L383-L390
|
| 14.
|
Folkerts, G.,
van der Linde, H. J.,
and Nijkamp, F. P.
(1995)
J. Clin. Invest.
95,
26-30
|
| 15.
|
Shaul, P. W.
(1997)
Semin. Perinatol.
21,
381-392[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Teichert, A.,
Karantzoulis-Fegaras, F.,
Wang, Y.,
Mawji, I. A.,
Bei, X.,
Gnanapandithen, K.,
and Marsden, P. A.
(1998)
Biochim. Biophys. Acta
1443,
352-357[Medline]
[Order article via Infotrieve]
|
| 17.
|
Zhang, R.,
Min, W.,
and Sessa, W. C.
(1995)
J. Biol. Chem.
270,
15320-15326[Abstract/Free Full Text]
|
| 18.
|
Karantzoulis-Fegaras, F.,
Antoniou, H.,
Lai, S.-L. M.,
Kulkarni, G.,
D'Abreo, C.,
Wong, G. K. T.,
Miller, T. L.,
Chan, Y.,
Atkins, J.,
Wang, Y.,
and Marsden, P. A.
(1999)
J. Biol. Chem.
274,
3076-3093[Abstract/Free Full Text]
|
| 19.
|
Guillot, P. V.,
Guan, J.,
Liu, L.,
Kuivenhoven, J. A.,
Rosenberg, R. D.,
Sessa, W. C.,
and Aird, W. C.
(1999)
J. Clin. Invest.
103,
799-805[Medline]
[Order article via Infotrieve]
|
| 20.
|
O'Reilly, M. A.,
Gazdar, A. F.,
Morris, R. E.,
and Whitsett, J. A.
(1988)
Biochim. Biophys. Acta
970,
194-204[Medline]
[Order article via Infotrieve]
|
| 21.
|
Voorhout, W. F.,
Veenendaal, T.,
Kuroki, Y.,
Ogasawara, Y,
van Golde, L. M.,
and Geuze, H. J.
(1992)
J. Histochem. Cytochem.
40,
1589-1597[Abstract]
|
| 22.
|
Harkema, J. R.,
Mariassy, A.,
St. George, J.,
Hyde, D. M.,
and Plopper, C. G.
(1991)
The Airway Epithelium: Physiology, Pathophysiology, and Pharmacology
, pp. 3-39, Marcel Dekker, New York
|
| 23.
|
Shaul, P. W.,
North, A. J.,
Wu, L. C.,
Wells, L. B.,
Brannon, T. S.,
Lau, K. S.,
Michel, T.,
Margraf, L. R.,
and Star, R. A.
(1994)
J. Clin. Invest.
94,
2231-2236
|
| 24.
|
Shaul, P. W.,
and Wells, L. B.
(1994)
Am. J. Respir. Cell Mol. Biol.
11,
432-438[Abstract]
|
| 25.
|
Robinson, L. J.,
Weremowicz, S.,
Morton, C. C.,
and Michel, T.
(1994)
Genomics
19,
350-357[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
MacRitchie, A. N.,
Jun, S. S.,
Chen, Z.,
German, Z.,
Yuhanna, I. S.,
Sherman, T. S.,
and Shaul, P. W.
(1997)
Circ. Res.
81,
355-362[Abstract/Free Full Text]
|
| 27.
|
Arnet, U. A.,
McMillan, A.,
Dinerman, J. L.,
Ballerman, B.,
and Lowenstein, C. J.
(1996)
J. Biol. Chem.
271,
15069-15073[Abstract/Free Full Text]
|
| 28.
|
Ow, D. W.,
Wood, K. V.,
DeLuca, M.,
DeWet, J. R.,
Helinski, D. R.,
and Howell, S. H.
(1986)
Science
234,
856-859[Abstract/Free Full Text]
|
| 29.
|
Rosenthal, N.
(1987)
Methods Enzymol.
152,
704-720[Medline]
[Order article via Infotrieve]
|
| 30.
|
Snedecor, G. W.,
and Cochran, W. G.
(1980)
Statistical Methods
, Iowa State University Press, Ames, IA
|
| 31.
|
Gumina, R. J.,
Kirschbaum, N. E.,
Piotrowski, K.,
and Newman, P. J.
(1997)
Blood
89,
1260-1269[Abstract/Free Full Text]
|
| 32.
|
Tracey, W. R.,
Pollack, J. S.,
Murad, F.,
Nakane, M.,
and Forstermann, U.
(1994)
Am. J. Physiol.
266,
C22-C28[Abstract/Free Full Text]
|
| 33.
|
Ujiie, K.,
Yuen, J.,
Hogarth, L.,
Danziger, R.,
and Star, R. A.
(1994)
Am. J. Physiol.
267,
F296-F302[Abstract/Free Full Text]
|
| 34.
|
Zini, A.,
O'Bryan, M. K.,
Magid, M. S.,
and Schlegel, P. N.
(1996)
Biol. Reprod.
55,
935-941[Abstract]
|
| 35.
|
Chatterjee, S.,
Gangula, P. R.,
Dong, Y. L.,
and Yallampalli, C.
(1996)
Histochem. J.
28,
715-723[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Schwartz, S. Osborne-Lawrence, L. Hahner, L. L. Gibson, A. K. Gormley, W. Vongpatanasin, W. Zhu, R. A. Word, D. Seetharam, S. Black, et al.
C-Reactive Protein Downregulates Endothelial NO Synthase and Attenuates Reendothelialization In Vivo in Mice
Circ. Res.,
May 25, 2007;
100(10):
1452 - 1459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Khandekar, W. Brandt, Y. Zhou, S. Dagenais, T. W. Glover, N. Suzuki, R. Shimizu, M. Yamamoto, K.-C. Lim, and J. D. Engel
A Gata2 intronic enhancer confers its pan-endothelia-specific regulation
Development,
May 1, 2007;
134(9):
1703 - 1712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. L. Gibson, L. Hahner, S. Osborne-Lawrence, Z. German, K. K. Wu, K. L. Chambliss, and P. W. Shaul
Molecular Basis of Estrogen-Induced Cyclooxygenase Type 1 Upregulation in Endothelial Cells
Circ. Res.,
March 18, 2005;
96(5):
518 - 525.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. A. Ghofrani, J. Pepke-Zaba, J. A. Barbera, R. Channick, A. M. Keogh, M. A. Gomez-Sanchez, M. Kneussl, and F. Grimminger
Nitric oxide pathway and phosphodiesterase inhibitors in pulmonary arterial hypertension
J. Am. Coll. Cardiol.,
June 16, 2004;
43(12_Suppl_S):
68S - 72S.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Tai, G. B. Robb, and P. A. Marsden
Endothelial Nitric Oxide Synthase: A New Paradigm for Gene Regulation in the Injured Blood Vessel
Arterioscler. Thromb. Vasc. Biol.,
March 1, 2004;
24(3):
405 - 412.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. S. van's Gravesande, M. E. Wechsler, H. Grasemann, E. S. Silverman, L. Le, L. J. Palmer, and J. M. Drazen
Association of a Missense Mutation in the NOS3 Gene with Exhaled Nitric Oxide Levels
Am. J. Respir. Crit. Care Med.,
July 15, 2003;
168(2):
228 - 231.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Fleming and R. Busse
Molecular mechanisms involved in the regulation of the endothelial nitric oxide synthase
Am J Physiol Regulatory Integrative Comp Physiol,
January 1, 2003;
284(1):
R1 - R12.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Saura, C. Zaragoza, W. Cao, C. Bao, M. Rodriguez-Puyol, D. Rodriguez-Puyol, and C. J. Lowenstein
Smad2 Mediates Transforming Growth Factor-{beta} Induction of Endothelial Nitric Oxide Synthase Expression
Circ. Res.,
November 1, 2002;
91(9):
806 - 813.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-S. Choi, P. R. Rai, H. W. Chu, C. Cool, and E. D. Chan
Analysis of Nitric Oxide Synthase and Nitrotyrosine Expression in Human Pulmonary Tuberculosis
Am. J. Respir. Crit. Care Med.,
July 15, 2002;
166(2):
178 - 186.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|