HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Palenchar, P. M. Articles by Mueller, E. G. Search for Related Content PubMed PubMed Citation Articles by Palenchar, P. M. Articles by Mueller, E. G. Social Bookmarking                      What's this?

J Biol Chem, Vol. 275, Issue 12, 8283-8286, March 24, 2000

ACCELERATED PUBLICATION
Evidence That ThiI, an Enzyme Shared between Thiamin and 4-Thiouridine Biosynthesis, May Be a Sulfurtransferase That Proceeds through a Persulfide Intermediate^*

Peter M. Palenchar^§, Christopher J. Buck, Hui Cheng^¶, Timothy J. Larson^¶, and Eugene G. Mueller

From the  Department of Chemistry and Biochemistry, University of Delaware, Newark, Delaware 19716 and the ^¶ Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

ThiI is an enzyme common to the biosynthetic pathways leading to both thiamin and 4-thiouridine in tRNA. Comparison of the ThiI sequence with protein sequences in the data bases revealed that the Escherichia coli enzyme contains a C-terminal extension displaying sequence similarity to the sulfurtransferase rhodanese. Cys-456 of ThiI aligns with the active site cysteine residue of rhodanese that transiently forms a persulfide during catalysis. We investigated the functional importance of this sequence similarity and discovered that, like rhodanese, ThiI catalyzes the transfer of sulfur from thiosulfate to cyanide. Mutation of Cys-456 to alanine impairs this sulfurtransferase activity, and the C456A ThiI is incapable of supporting generation of 4-thiouridine in tRNA both in vitro and in vivo. We therefore conclude that Cys-456 of ThiI is critical for activity and propose that Cys-456 transiently forms a persulfide during catalysis. To accommodate this hypothesis, we propose a general mechanism for sulfur transfer in which the terminal sulfur of the persulfide first acts as a nucleophile and is then transferred as an equivalent of S² rather than S⁰.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Many aspects of sulfur metabolism remain unelucidated, including details of the incorporation of sulfur into iron-sulfur clusters (1), modified bases in RNA (2), and cofactors such as thiamin (3), biotin (3-5), lipoic acid (6), and molybdopterin (7). We report the further characterization of the function of ThiI from Escherichia coli, an enzyme that plays a role in the biosynthesis of both thiamin (8) and 4-thiouridine, s⁴U,¹ at position 8 in bacterial tRNA (9). The s⁴U has an absorbance maximum at 334 nm and serves as a near-UV photosensor, undergoing a photoactivated 2 + 2 cycloaddition with the carbon-carbon double bond of cytidine 13, which leads to a cross-link in the tRNA (10-12). Such cross-linked tRNAs are inefficient aminoacylation substrates (13), and the accumulation of uncharged tRNA triggers growth arrest (14, 15). This role of s⁴U as a photosensor provides for a remarkably powerful selection: mutant bacteria that do not make s⁴U in tRNA continue to grow upon exposure to near-UV light (15-18), and the near-UV resistant phenotype can be complemented by a plasmid-borne functional copy of the defective chromosomal gene. Using this near-UV screen, the role of ThiI in s⁴U biosynthesis was demonstrated (9) as was the functional importance of a catalytically critical "P-loop" motif idiosyncratic to a family of enzymes that catalyze the adenylation of a carbonyl oxygen for subsequent nucleophilic substitution (19). The "P-loop" motif was found by querying the genomic data base with the sequence of ThiI using the PSI-BLAST algorithm (20). Further scrutiny of sequence data revealed a motif shared with rhodanese, an enzyme that catalyzes the transfer of sulfur from thiosulfate to cyanide, generating sulfite and thiocyanate. Rhodanese catalyzes sulfur transfer through the formation of a persulfide on an active site cysteine residue (21), and this cysteine lies in the motif identified in ThiI (Fig. 1). We now report that the cysteine residue, Cys-456, in this rhodanese sulfurtransferase motif is critical for ThiI function both in vivo and in vitro.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Unless otherwise stated, all materials were purchased from either Sigma or Fisher and used as provided. [³⁵S]Cysteine and Sephadex G-25 (DNA grade) were purchased from Amersham Pharmacia Biotech. Nuclease P1, dithiothreitol (DTT), chloramphenicol, and Tris were purchased from Roche Molecular Biochemicals. The thiI mutant strain VJS2890(DE3) contains a kanamycin resistance cassette inserted within thiI and has been described earlier (9). A Higgins Analytical CLIPEUS C18 5-µm column (50 × 4.6 mm) was purchased from Bodman Industries (Aston, PA). The tRNA substrate was unfractionated tRNA from VJS2890(DE3), which has been described previously (9). Spectra were recorded as described earlier (19).

Sulfurtransferase Assays-- Sulfurtransferase activity was measured by the method of Alexander and Volini (22) at ambient temperature (~22 °C). Assay solutions (0.50 ml) consisted of 100 mM Tris acetate buffer, pH 8.6, containing ammonium thiosulfate (50 mM), ThiI (at various concentrations), and potassium cyanide (50 mM), which was added to initiate reaction. After 3 min, formaldehyde (0.25 ml, 15%) was added to quench the reaction, and color was developed by the rapid addition of the ferric nitrate reagent (0.75 ml). Thiocyanate (complexed with iron) was quantitated by A_460 nm using  = 4200 M¹ cm¹.

Site-directed Mutagenesis, Overexpression, and Near-UV Complementation-- The C456A ThiI was generated using the QuikChange^TM protocol (Stratagene, La Jolla, CA); the mutagenic primers were CCTGCCTGCTGTGGGCTGACCGCGGGGTG and its exact complement (the changed positions are italicized). The effectiveness of the mutagenesis was confirmed by sequencing the entire gene. The template plasmid was pBH113, which has thiI placed into pET15b (Novagen, Madison, WI) for overexpression of an N-terminally His₆-tagged protein (9). The plasmid encoding C456A ThiI is pBH140. Both ThiI proteins described in this paper retained the His₆ tag and are referred to simply as "wild-type" and "C456A" ThiI; the numbering of the cysteine residue is that of the native protein (lacking a His₆ tag). The overexpression and one-step purification of recombinant ThiI, the near-UV selection, and the isolation of tRNA from VJS2890(DE3) bearing plasmids encoding ThiI have been described in detail elsewhere (9, 19).

s⁴U Generation Assays-- The method of Harris (23) was used with modification to measure the generation of s⁴U in tRNA by monitoring incorporation of ³⁵S into s⁴U from L-[³⁵S]cysteine. Cell extracts of VJS2890(DE3) were subjected to centrifugation at 105,000 × g for 1.5 h, and the supernatant was used without further purification. The cell extracts themselves did not support s⁴U generation. Recombinant ThiI (either wild-type or C456A) was added to the assay mixture to initiate reaction, and aliquots were withdrawn periodically to measure s⁴U generation. A typical assay mixture (0.4 ml) was 50 mM Tris·HCl buffer, pH 8.5, containing ATP (4 mM), pyridoxal 5'-phosphate (40 µM), MgCl₂ (5 mM), tRNA (47 µM), L-[³⁵S]cysteine (20 µM; 1.25 Ci/mmol), cell extracts (4.95 mg/ml total protein), DTT (1 mM), and ThiI (1 nM to 24 µM).

Analysis was accomplished by rapid size exclusion chromatography over a spin column of Sephadex G-25 followed by the addition of carrier s⁴U and the total digestion/C₁₈ HPLC analysis described previously (9), which resolves all of the bases in E. coli tRNA (24, 25). To analyze the distribution of radioactivity on-line, a 500TR series Flow Scintillation Analyzer (Packard Instrument Co., Meriden, CT) was fitted to the HPLC; column effluent was mixed with Ultima Flo M scintillation fluid (Packard Instrument Co.).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Identification of a C-terminal Sulfurtransferase Domain in ThiI-- Comparison of the ThiI orthologs present in the COG (clusters of orthologous groups) data base (26) revealed that ThiI proteins from E. coli and Hemeophilus influenzae possess an extension of ~100 amino acid residues at the C terminus. This C-terminal extension was found to possess limited sequence similarity to sulfurtransferases, including rhodanese (Fig. 1), and the region of similarity is found only in ThiI proteins of E. coli and the closely related species Salmonella typhimurium and H. influenzae. ThiI proteins from other organisms present in the sequence data bases do not possess the putative rhodanese motif.

View larger version (31K): [in this window] [in a new window]   Fig. 1.   Alignment of the sequences of sulfurtransferases and E. coli ThiI in the area containing the rhodanese active site cysteine residue (arrowhead). This segment of ThiI is contained in a C-terminal extension (~100 amino acids) found in the ThiI of E. coli, S. typhimurium, and H. influenzae but absent in all other identified orthologs of ThiI. A comprehensive alignment of sulfurtransferases and related protein tyrosine phosphatases has been published (35). Enclosed in boxes are the positions of the CH2A, active site, and CH2B motifs as described for protein-tyrosine phosphatases (36). Residues of ThiI that conform to a sulfurtransferase consensus as proposed by E. V. Koonin (unpublished data) are indicated by light shading. The asterisks highlight positions that are identical in all four sequences. The sequences compared with ThiI include bovine rhodanese (Rhod-Bt), rat mercaptopyruvate sulfurtransferase (MPST-Rn) and GlpE, a single-domain rhodanese from E. coli (37).

Site-directed Mutagenesis, Near-UV Selection, and Analysis of Isolated tRNA-- The site-directed mutagenesis introduced the desired changes to afford the gene for C456A ThiI. Sequencing of the entire gene, however, also revealed an N49S mutation. Further investigation revealed that this particular preparation of the parent plasmid, pBH113, also contained this mutation, which must have arisen spontaneously during propagation. All of the data contained in this report were obtained with wild-type ThiI that contained the N49S mutation, so all comparisons between wild-type and C456A are internally consistent. We have also confirmed that N49S ThiI behaves identically to authentic wild-type ThiI in terms of measurable catalytic activity (data not shown).

The near-UV-resistant thiI mutant VJS2890(DE3) became near-UV-sensitive (wild-type phenotype) when transformed with pBH113 (encoding wild-type ThiI), but when the same strain was transformed with pBH140 (encoding C456A ThiI), UV resistance was retained (data not shown). Consistent with the ability of wild-type but not C456A ThiI to complement the near-UV-resistant phenotype, tRNA isolated from VJS2890(DE3)/pBH113 displayed a normal amount of s⁴U in tRNA, while no s⁴U was observed in tRNA isolated from VJS2890(DE3)/pBH140 (Fig. 2).

View larger version (11K): [in this window] [in a new window]   Fig. 2.   The UV spectra of tRNA isolated from the thiI mutant VJS2890(DE3) transformed with either pBH113 (encoding wild-type ThiI (solid line)) or pBH140 (encoding C456A ThiI (dashed line)). For these samples, A260 nm = 40. The absorbance maximum of s4U is 334 nm, which is obvious in the tRNA from VJS2890(DE3)/pBH113 and is not detectable in tRNAfrom VJS2890(DE3)/pBH140.

Overexpression, Purification, and s⁴U-generating Activity of C456A ThiI-- The overexpression and purification of C456A ThiI proceeded smoothly with no significant difference from wild-type enzyme in expression levels or storage behavior. The CD spectra of wild-type and C456A ThiI were identical qualitatively and quantitatively within 10% (data not shown). The addition of wild-type ThiI to an assay mixture containing VJS2890(DE3) cell extracts allowed s⁴U generation, but no s⁴U production was detected when the cell extracts were supplemented with C456A ThiI even under single turnover conditions (Fig. 3). Combining the measured activity of wild-type ThiI (at 1 nM) and conservative estimates for detection limits of the method, the C456A variant possesses <3.5·10⁵ the activity of wild-type ThiI.

View larger version (12K): [in this window] [in a new window]   Fig. 3.   The in vitro assays of ThiI. A, the dependence of the rate of thiocyanate formation on [ThiI]. Wild-type ThiI () is 7.5-fold more effective than C456A ThiI () as a catalyst for thiocyanate formation, as indicated by the ratio of the slopes. B, the formation of s4U in tRNA as assessed by transfer of 35S from [35S]cysteine into [35S]s4U. No s4U was detected when using C456A ThiI. , [wild-type ThiI] = 1 nM; , [wild-type ThiI] = 3 µM; ×, [C456A ThiI] = 24 µM. Single turnover conditions are approached when [wild-type ThiI] = 3 µM and exceeded when [C456A ThiI] = 24 µM.

Sulfur Transfer from Thiosulfate to Cyanide-- The transfer of sulfur from thiosulfate to cyanide is clearly catalyzed by wild-type ThiI but not nearly so effectively by C456A ThiI (Fig. 3). The rate of this reaction in the presence of wild-type ThiI is sluggish, ~0.03% of the rhodanese-catalyzed rate (22), almost certainly because thiosulfate and cyanide are not the natural substrates for ThiI. The C456A ThiI is impaired for this "unnatural" reaction, catalyzing generation of thiocyanate at a rate 7.5-fold slower than wild-type ThiI.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The two groups that took part in this work independently discerned a stretch of sequence similarity between E. coli ThiI and the carboxyl-terminal domain of rhodanese, which contains the active site. Rhodanese catalyzes sulfur transfer through the formation of a persulfide on an active site cysteine residue (21), which aligns with Cys-456 in ThiI (Fig. 1). This "rhodanese motif" lies in a ~100-amino acid C-terminal extension of ThiI found only in the enzymes of E. coli and closely related organisms. The COG data base, which compares proteins encoded by the 21 organisms whose entire genome sequence are currently known (26), contains 11 ThiI orthologs. Of these, only ThiI proteins from E. coli and H. influenzae possess the sequence of limited similarity to rhodanese.

As a first test of the functional significance of this sequence alignment, the ability of ThiI to catalyze rhodanese-like sulfur transfer was assayed. Thiosulfate could be utilized as the sulfur donor with cyanide as the acceptor, and ThiI was shown to catalyze the reaction (Fig. 3). Next, the cysteine residue implicated by the sequence alignment was changed to alanine by site-directed mutagenesis to generate C456A ThiI, and the altered enzyme was examined both in vivo and in vitro.

E. coli strain VJS2890(DE3) is a thiI mutant and so does not generate s⁴U in tRNA. This strain, therefore, continues to grow when exposed to near-UV light (it lacks the photosensor). The near-UV resistant phenotype of this strain is complemented by a plasmid bearing the wild-type thiI gene. The thiI⁺-complemented cells produce s⁴U in tRNA and enter growth arrest when exposed to near-UV light. Transformation of VJS2890(DE3) with a plasmid encoding C456A ThiI does not effect complementation, indicating that the mutant enzyme is inactive in vivo. This conclusion was confirmed by the lack of detectable s⁴U in tRNA from VJS2890(DE3) harboring the plasmid for expression of C456A ThiI (Fig. 2).

Data from in vitro assays also demonstrate the inactivation of the enzyme by elimination of the putative active site thiol group. First, C456A ThiI is an impaired catalyst for the transfer of sulfur from thiosulfate to cyanide (Fig. 3). It seems likely that the residual catalysis can be ascribed to the presence of one (or all) of the other cysteine residues in C456A ThiI. In this case, Cys-456 is roughly 6.5-fold more effective in forming a persulfide than are the other four cysteine residues combined. Second, the addition of purified C456AThiI to VJS2890(DE3) cell extracts does not enable the in vitro generation of s⁴U, while addition of wild-type ThiI to the same assay system leads to s⁴U production (Fig. 3). Third, the overexpression, storage behavior, and CD spectrum of C456A ThiI are essentially identical to wild-type ThiI (data not shown), indicating that the altered enzyme retains a wild-type fold and eliminating the possibility that a gross structural change inactivates C456A ThiI.

Based on our findings, we propose that catalysis by ThiI proceeds via a persulfide intermediate at Cys-456 during catalysis. This proposal fits nicely with the recent identification of the NifS-like protein IscS as an enzyme capable of mobilizing sulfur from cysteine for the in vitro generation of s⁴U (27). NifS and IscS, like rhodanese, are sulfurtransferases that undergo formation of a persulfide on an active-site cysteine, in this case generated by transfer of the sulfur from free cysteine to the enzymic cysteine thiol group (28, 29). The terminal sulfur in the persulfide of IscS could then be transferred to ThiI in a "transpersulfidation" reaction. This hypothesis is consistent with the proposal by Kambampati and Lauhon (27) that IscS transfers a sulfur originating on cysteine to ThiI, which we further develop by proposing that S⁰ (formally) is transferred to ThiI.

The direct transfer of sulfur from ThiI to tRNA remains to be established definitively, but the use of a persulfide as a sulfur donor is chemically reasonable. While most discussion of enzymic persulfide moieties has focused on the transfer of the terminal sulfur atom as S⁰, each sulfur in a persulfide is formally S¹ and so can undergo chemistry either as formal S⁰ or S² centers. In other words, the electrons from the S-S bond can flow toward either sulfur during reaction. Based on the generation of hydrogen sulfide and an enzymic disulfide from a thioredoxin persulfide formed by transfer of S⁰ from rhodanese (30), the additional C-terminal amino acid residues in ThiI from E. coli and closely related organisms might be a sulfide-generating domain, analogous to ammonia-generating domains in enzymes such as carbamoyl phosphate synthetase (31) and GMP synthetase (32). The generated sulfide would then nucleophilically attack C4 of uridine to make s⁴U. The sulfur could even reside transiently in an iron-sulfur cluster, an intriguing possibility raised by recent findings regarding biotin (4, 5) and lipoic acid (6) biosynthesis; however, there is currently no evidence of an iron-sulfur cluster in overexpressed ThiI.

The exchange of oxygen in uridine for sulfur almost certainly will proceed via nucleophilic attack of anionic sulfur at C4 of uridine. Since the terminal sulfur has nucleophilic character, it is chemically reasonable for the persulfide of Cys-456 to participate directly in the substitution reaction. The nucleophilicity of the persulfide group is the crux of a general reaction scheme that is, to our knowledge, a novel proposal of chemistry by an enzymic persulfide (Fig. 4). The activation of O⁴ of uridine as a leaving group is quite likely, and the requirement of ATP for the generation of s⁴U supports activation of O⁴ by adenylation.² Attack by the terminal sulfur of the persulfide generates a tetrahedral intermediate, which collapses by the expulsion of AMP and forms an enzyme-uridine disulfide species. The sulfur-sulfur bond is reductively cleaved by familiar disulfide chemistry, perhaps by attack of a thiol(ate) group on S to form s⁴U and a different disulfide on Lys-456. The attacking thiol(ate) could be from another cysteine residue on ThiI³ or from an exogenous thiol. The resulting enzymic disulfide bond would then be reduced: in vivo, perhaps, by a coupled protein system such as those involving thioredoxin or glutaredoxin; and in vitro by DTT (or -mercaptoethanol), which is required for activity. The regenerated active site cysteine thiol(ate) is then converted to the persulfide by transfer of sulfur from IscS, restarting the catalytic cycle.

View larger version (16K): [in this window] [in a new window]   Fig. 4.   A mechanism for transfer of sulfur from a persulfide on ThiI to uridine-8 of tRNA. The events occur at the ThiI active site containing Cys-456, which aligns with the active site cysteine residue of rhodanese. The persulfide of Cys-456 attacks C4 of uridine-8 in tRNA, which may be activated by adenylation. Reductive cleavage of the S-S bond between Cys-456 and the incipient s4U then occurs, perhaps by attack of a thiol group (either exogenous or from another cysteine residue of ThiI) to form a disulfide bond and generate s4U as shown. DTT could serve this role in vitro. The pictured enzymic disulfide bond is reduced, perhaps by a thioredoxin- or glutaredoxin-type system in vivo (in vitro reduction by DTT is shown). The formation of the Cys-456 persulfide for the next reaction cycle is effected by sulfur transfer from a persulfide on a cysteine residue in IscS, as postulated by Kambampati and Lauhon (27). H-A denotes a general acid; the squiggles denote attachment to ThiI; tRNA denotes the rest of the tRNA molecule; R denotes attachment of the thiol group to a small molecule or ThiI.

Although Kambampati and Lauhon (27) have generated s⁴U with no proteins other than purified recombinant IscS and ThiI, we stress that no direct reaction between uridine in tRNA and ThiI has been demonstrated definitively. The general scheme we present in our mechanism (Fig. 4) can transfer the terminal sulfur in a persulfide as S² whether in s⁴U itself or in a metabolic intermediate. For example, Begley and co-workers (33) have elegantly demonstrated that the thiocarboxylate of the small protein ThiS lies along the thiamin biosynthetic pathway, and our general scheme can accommodate generation of such a species if the persulfide attacks an activated carboxylate group rather than an activated uridine residue. Similarly, a thiophosphate species might also be generated by such chemistry (either thiophosphate itself or the thiophosphate analog of AMP) using ATP as a substrate. Stadtman and co-workers (34) have demonstrated an analogous system for selenophosphate formation: NifS and selenocysteine substitute effectively for selenide in the generation of selenophosphate, the selenium donor for the biosynthesis of 2-selenouridine residues in tRNA.

While distinction of these various possibilities awaits further experimentation, we have shown that Cys-456 of ThiI is catalytically essential. Our proposal that ThiI bears a persulfide on Cys-456 during its catalytic cycle respresents, at the very least, a novel twist in the fascinating biosynthetic pathways leading to s⁴U and thiamin. The confirmation of the proposed persulfide on ThiI and the elucidation of its chemistry may have broader impact on the understanding of sulfur metabolism by revealing a new mode of sulfur transfer based on the nucleophilicity of persulfides.

	ACKNOWLEDGEMENT

We acknowledge Janet Donahue for technical assistance and advice.

	FOOTNOTES

^* This work was supported in part by the National Institutes of Health Grant GM59636-01 (to E. G. M.) and National Science Foundation Grant MCB-9118757 (to T. J. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Supported in part by United States Public Health Service Grant T32 GM08550.

To whom correspondence should be addressed: Dept. of Chemistry & Biochemistry, University of Delaware, Newark, DE 19716. Tel.: 302-831-2739; Fax: 302-831-6335; E-mail: emueller@udel.edu.

² While the presence of an essential P-loop motif that is shared with other adenylating enzymes makes ThiI an obvious candidate for the enzyme that adenylates O⁴ (19, 27), we have been unable to detect any reaction between ATP and tRNA catalyzed by ThiI alone.

³ E. coli, S. typhimurium, and H. influenzae ThiI have four other cysteine residues in identical positions, though Cys-456 is the sole cysteine residue in the C-terminal extension unique to ThiI from these three closely related organisms.

	ABBREVIATIONS

The abbreviations used are: s⁴U, 4-thiouridine; DTT, dithiothreitol; COG, clusters of orthologous groups; HPLC, high performance liquid chromatography.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				B. Campanini, F. Schiaretti, S. Abbruzzetti, D. Kessler, and A. Mozzarelli Sulfur Mobilization in Cyanobacteria: THE CATALYTIC MECHANISM OF L-CYSTINE C-S LYASE (C-DES) FROM SYNECHOCYSTIS J. Biol. Chem., December 15, 2006; 281(50): 38769 - 38780. [Abstract] [Full Text] [PDF]

				N. Shigi, T. Suzuki, T. Terada, M. Shirouzu, S. Yokoyama, and K. Watanabe Temperature-dependent Biosynthesis of 2-Thioribothymidine of Thermus thermophilus tRNA J. Biol. Chem., January 27, 2006; 281(4): 2104 - 2113. [Abstract] [Full Text] [PDF]

				G. Gabant, S. Auxilien, I. Tuszynska, M. Locard, M. J. Gajda, G. Chaussinand, B. Fernandez, A. Dedieu, H. Grosjean, B. Golinelli-Pimpaneau, et al. THUMP from archaeal tRNA:m22G10 methyltransferase, a genuine autonomously folding domain. Nucleic Acids Res., January 1, 2006; 34(9): 2483 - 2494. [Abstract] [Full Text] [PDF]

				N. C. Martinez-Gomez, M. Robers, and D. M. Downs Mutational Analysis of ThiH, a Member of the Radical S-Adenosylmethionine (AdoMet) Protein Superfamily J. Biol. Chem., September 24, 2004; 279(39): 40505 - 40510. [Abstract] [Full Text] [PDF]

				J. Armengaud, J. Urbonavicius, B. Fernandez, G. Chaussinand, J. M. Bujnicki, and H. Grosjean N2-Methylation of Guanosine at Position 10 in tRNA Is Catalyzed by a THUMP Domain-containing, S-Adenosylmethionine-dependent Methyltransferase, Conserved in Archaea and Eukaryota J. Biol. Chem., August 27, 2004; 279(35): 37142 - 37152. [Abstract] [Full Text] [PDF]

				C. T. Lauhon, W. M. Erwin, and G. N. Ton Substrate Specificity for 4-Thiouridine Modification in Escherichia coli J. Biol. Chem., May 28, 2004; 279(22): 23022 - 23029. [Abstract] [Full Text] [PDF]

				C. T. Lauhon, E. Skovran, H. D. Urbina, D. M. Downs, and L. E. Vickery Substitutions in an Active Site Loop of Escherichia coli IscS Result in Specific Defects in Fe-S Cluster and Thionucleoside Biosynthesis in Vivo J. Biol. Chem., May 7, 2004; 279(19): 19551 - 19558. [Abstract] [Full Text] [PDF]

				R. Leonardi and P. L. Roach Thiamine Biosynthesis in Escherichia coli: IN VITRO RECONSTITUTION OF THE THIAZOLE SYNTHASE ACTIVITY J. Biol. Chem., April 23, 2004; 279(17): 17054 - 17062. [Abstract] [Full Text] [PDF]

				G. Jager, R. Leipuviene, M. G. Pollard, Q. Qian, and G. R. Bjork The Conserved Cys-X1-X2-Cys Motif Present in the TtcA Protein Is Required for the Thiolation of Cytidine in Position 32 of tRNA from Salmonella enterica serovar Typhimurium J. Bacteriol., February 1, 2004; 186(3): 750 - 757. [Abstract] [Full Text] [PDF]

				R. Leipuviene, Q. Qian, and G. R. Bjork Formation of Thiolated Nucleosides Present in tRNA from Salmonella enterica serovar Typhimurium Occurs in Two Principally Distinct Pathways J. Bacteriol., February 1, 2004; 186(3): 758 - 766. [Abstract] [Full Text] [PDF]

				M. D. Wolfe, F. Ahmed, G. M. Lacourciere, C. T. Lauhon, T. C. Stadtman, and T. J. Larson Functional Diversity of the Rhodanese Homology Domain: THE ESCHERICHIA COLI ybbB GENE ENCODES A SELENOPHOSPHATE-DEPENDENT tRNA 2-SELENOURIDINE SYNTHASE J. Biol. Chem., January 16, 2004; 279(3): 1801 - 1809. [Abstract] [Full Text] [PDF]

				M. S. Alphey, R. A. M. Williams, J. C. Mottram, G. H. Coombs, and W. N. Hunter The Crystal Structure of Leishmania major 3-Mercaptopyruvate Sulfurtransferase: A THREE-DOMAIN ARCHITECTURE WITH A SERINE PROTEASE-LIKE TRIAD AT THE ACTIVE SITE J. Biol. Chem., November 28, 2003; 278(48): 48219 - 48227. [Abstract] [Full Text] [PDF]

				F. Forlani, A. Carpen, and S. Pagani Evidence that elongation of the catalytic loop of the Azotobacter vinelandii rhodanese changed selectivity from sulfur- to phosphate-containing substrates Protein Eng. Des. Sel., July 1, 2003; 16(7): 515 - 519. [Abstract] [Full Text] [PDF]

				R. A. M. Williams, S. M. Kelly, J. C. Mottram, and G. H. Coombs 3-Mercaptopyruvate Sulfurtransferase of Leishmania Contains an Unusual C-terminal Extension and Is Involved in Thioredoxin and Antioxidant Metabolism J. Biol. Chem., January 10, 2003; 278(3): 1480 - 1486. [Abstract] [Full Text] [PDF]

				K. Nilsson, H. K. Lundgren, T. G. Hagervall, and G. R. Bjork The Cysteine Desulfurase IscS Is Required for Synthesis of All Five Thiolated Nucleosides Present in tRNA from Salmonella enterica Serovar Typhimurium J. Bacteriol., December 15, 2002; 184(24): 6830 - 6835. [Abstract] [Full Text] [PDF]

				J. Xi, Y. Ge, C. Kinsland, F. W. McLafferty, and T. P. Begley Biosynthesis of the thiazole moiety of thiamin in Escherichia coli: Identification of an acyldisulfide-linked protein-protein conjugate that is functionally analogous to the ubiquitin/E1 complex PNAS, June 28, 2001; (2001) 141226698. [Abstract] [Full Text] [PDF]

				C. T. Lauhon and R. Kambampati The iscS Gene in Escherichia coli Is Required for the Biosynthesis of 4-Thiouridine, Thiamin, and NAD J. Biol. Chem., June 23, 2000; 275(26): 20096 - 20103. [Abstract] [Full Text] [PDF]

				E. G. Mueller, P. M. Palenchar, and C. J. Buck The Role of the Cysteine Residues of ThiI in the Generation of 4-Thiouridine in tRNA J. Biol. Chem., August 31, 2001; 276(36): 33588 - 33595. [Abstract] [Full Text] [PDF]

				H. D. Urbina, J. J. Silberg, K. G. Hoff, and L. E. Vickery Transfer of Sulfur from IscS to IscU during Fe/S Cluster Assembly J. Biol. Chem., November 21, 2001; 276(48): 44521 - 44526. [Abstract] [Full Text] [PDF]

				J. Xi, Y. Ge, C. Kinsland, F. W. McLafferty, and T. P. Begley Biosynthesis of the thiazole moiety of thiamin in Escherichia coli: Identification of an acyldisulfide-linked protein-protein conjugate that is functionally analogous to the ubiquitin/E1 complex PNAS, July 17, 2001; 98(15): 8513 - 8518. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend