|
J Biol Chem, Vol. 275, Issue 13, 9749-9757, March 31, 2000
A Novel Activation Function for NAB Proteins in
EGR-dependent Transcription of the Luteinizing Hormone Gene*
Bradley R.
Sevetson,
John
Svaren, and
Jeffrey
Milbrandt
From the Departments of Pathology and Internal Medicine, Division
of Laboratory Medicine, Washington University School of Medicine,
St. Louis, Missouri 63110
 |
ABSTRACT |
The EGR1/NGFI-A transcription factor directly
activates the luteinizing hormone (LH ) subunit promoter, and
female mice lacking EGR1 are infertile due to LH deficiency. The
NGFI-A-binding proteins NAB1 and
NAB2 are corepressors of EGR1/NGFI-A and of the related proteins
EGR2/Krox20 and EGR3. Here we report that at certain promoters,
including LH , NAB proteins display a novel ability to stimulate
EGR-directed transcription. NAB coactivation requires the conserved
NCD2 protein domain, previously implicated in NAB corepression, is
strictly dependent upon EGR binding to the LH proximal promoter and
is independent of EGR activation domains. Furthermore, we report that
NAB-activated promoters such as LH contain EGR consensus sites that
are fewer in number and lower in binding affinity than those found at
NAB-repressed promoters such as basic fibroblast growth factor.
Analysis of mutant and synthetic promoters confirms that both the
strength and multiplicity of EGR-binding sites influence the
transcriptional outcome of NAB recruitment. These results suggest a
novel means by which EGR target genes could be differentially regulated
in cells where EGR and NAB proteins are coexpressed.
 |
INTRODUCTION |
Transcriptional control plays a key role in fundamental cellular
processes throughout the life of an organism and is regulated by the
interactions of DNA-bound transcription factors with other nuclear
proteins. Although direct contacts between transactivators and
components of the core RNA polymerase II complex provide one method of
controlling transcriptional activation, interactions between DNA-bound
factors and coregulatory proteins also regulate gene transcription. One
example of a corepressor is the retinoblastoma protein, which, by
interacting with the E2F transcription factor, converts E2F into a
repressor of cell-cycle genes (1). Members of the nuclear receptor
family such as RAR and TR also use coregulatory proteins to achieve
both positive and negative effects on transcription (2). These nuclear
receptors interact with SRC-CBP-CAF coactivator complexes or with
N-CoR-Rpd3 corepressor complexes in the presence or absence of ligand,
respectively, resulting in activation or repression of transcription.
These complexes may influence transcription through effects on
chromatin structure and/or through interactions with the
transcriptional initiation machinery (3).
EGR proteins are zinc finger transcription factors that have been
implicated in the control of cell growth, differentiation, and
apoptosis in the nervous system, the immune system, and elsewhere (4-6). As immediate-early genes that are rapidly synthesized following
a wide range of extracellular stimuli, EGR proteins transduce
extracellular signals into a rapid transcriptional response. Although
members of the EGR family are frequently coexpressed and may be
functionally redundant, targeted gene disruption of EGR family members
has revealed specific roles for individual EGR proteins. Female mice
lacking EGR1 display infertility due to reduced transcription of LH
(7, 8), whereas mice without EGR3 fail to develop muscle spindles (9).
Loss of EGR4 results in male infertility due to increased germ cell
apoptosis and defective spermiogenesis (10). EGR2 knockout mice exhibit
defects in hindbrain patterning, peripheral nerve myelination, and bone
formation (11-14).
Transcriptional activation by EGR family members is modulated by
interactions with the NAB family of corepressors. These proteins represent a broadly conserved family with homologues in mammals, Caenorhabditis elegans, and Drosophila
melanogaster.1 The
mammalian NAB1 and NAB2 proteins possess a conserved N-terminal domain
necessary for the interaction with EGR proteins and for NAB
self-association (NAB Conserved
Domain 1, NCD1) and a conserved C-terminal domain
implicated in transcriptional corepression (NCD2). NAB proteins
down-regulate the activity of EGR1, EGR2, and EGR3, which contain a
conserved domain (R1) that lies N-terminal of the DNA-binding zinc
fingers, but do not interact with EGR4, which lacks this domain (15).
NAB repression normally requires the recruitment of NAB-EGR complexes
to promoters via EGR-binding sites, but direct tethering of NAB
proteins by fusion to the Gal4 DNA-binding domain can repress various
Gal4-responsive promoters in the absence of EGR proteins (16). NAB
proteins could potentially coregulate a wide variety of EGR target
genes, including bFGF2 (17,
18), TGF- 1 (19, 20), tissue factor (21), several Hox
genes (22-24), platelet-derived growth factor (A and B chains) (25,
26), Fas ligand (27, 28), and LH (7, 8). In PC12 cells, NAB2
overexpression blocked NGF-dependent differentiation and
prevented NGF induction of TGF- 1, MMP-3, and p21WAF1
(29). Interestingly, a recessive mutation in the NAB-binding domain of
EGR2 has recently been linked to human myelinopathy, as have dominant
mutations in the EGR2 DNA-binding domain (30).
NAB1 is widely expressed in the adult mouse, whereas NAB2 mRNA
expression is highest in brain and thymus (31). NAB2 is induced as a
delayed-early gene by several stimuli that also up-regulate EGR
expression, such as serum stimulation of fibroblasts or NGF treatment
of PC12 cells. NAB1 induction has also been observed in several
systems, including glucocorticoid treatment of a leiomyosarcoma cell
line (32).
The infertility phenotype of female EGR1 knockout mice has demonstrated
the physiological relevance of EGR1 transactivation at the LH
promoter. The GnRH-responsive element of the LH promoter encompasses
two broadly conserved EGR1-binding sites as well as two binding sites
for steroidogenic factor-1 (SF-1), which synergizes with EGR1 to
dramatically up-regulate LH transcription (33, 34). LH is
up-regulated in pituitary gonadotropes following stimulation by the
hypothalamic peptide GnRH, and several studies have reported
up-regulation of EGR1 in gonadotrope cell lines following GnRH
administration (34, 35). In addition, the homeobox transcription factor
PTX1 has recently been reported to enhance LH transcription through
synergistic interactions with SF-1 and EGR1 (36).
In this study we report a novel ability of NAB proteins to
enhance EGR-mediated activation of the LH gene. NAB activation was found to require the protein domain (NCD2) previously implicated in
NAB repression and was not dependent upon the presence of EGR activation domains or of SF-1-binding sites at the LH promoter. Additionally, analysis using chimeric, synthetic, and mutant promoters demonstrated that both the number and relative affinity of
EGR-binding sites combine to determine the effect of NAB proteins
on transcription.
 |
MATERIALS AND METHODS |
Plasmid and DNA Manipulation--
All protein-coding sequences
were placed under the control of the cytomegalovirus (CMV)
immediate-early promoter in the pCB6 mammalian expression vector (37).
Expression constructs for wild type and mutant EGR and NAB proteins
have been previously described, as have the construction of R1-ZnF,
R1(mut)-ZnF, and HA-EGR2 (16, 38, 39). N-terminal HA-tagged versions of
EGR1, EGR3, and EGR4 were generated using forward PCR primers bearing the Kozak consensus sequence (40) and HA epitope used in
constructing HA-EGR2
(GAATTCACCATGGGGTACCCGTACGACGTCCCGGACTACGCTTCC) fused to the 5' end of each open reading frame. The proximal LH promoter construct with a native or mutated downstream EGR site has been described previously (7), as has the luciferase reporter containing four GCGGGGGCG motifs with a minimal prolactin promoter (38). The
1.7-kb rat LH promoter was provided by R. Maurer (see Ref. 41).
Mutations and deletions in the upstream SF-1 and EGR consensus sites
(Fig. 5) were created by PCR-directed mutagenesis of the proximal LH
promoter. The upstream SF-1 site was replaced with the sequence
TGAGATTGTG, and the upstream EGR site was replaced with the sequence
TTGGAAACG. The LH promoter bearing mutations in both SF-1-binding
sites was a gift of Y. Sadovsky (see Ref. 34). Duplication and/or
replacement of the LH downstream EGR site with the GCGGGGGCG
consensus was performed using inverse PCR and resulted in the insertion
only of the EGR-binding sites shown in Fig. 8B. Creation of
luciferase reporters bearing one or two copies of the downstream
LH EGR site (GTGGGGGTG) upstream of a minimal prolactin
promoter was accomplished by ligation of annealed oligonucleotides
bearing one or two copies of this site upstream of a minimal prolactin promoter.
The bFGF promoter construct was described previously (18). The tissue
factor promoter was provided by S. Felts, and the Fas ligand promoter
was provided by J. Ashwell. The TGF- 1 reporter construct contains
175 to +10 of the human TGF- 1 promoter (63) fused to the
luciferase gene in pGL3 (Promega). Prior to creation of the chimeric
bFGF/LH promoters, both LH and bFGF promoter sequences were
subcloned into the pGL2 vector (Promega). The chimeric LH /bFGF
reporter contains 156 to 35 of the LH promoter sequence fused to
34 to +160 of the bFGF promoter in pGL2. The chimeric bFGF/LH
reporter contains 500 to 35 of the bFGF promoter fused to 34 to
+6 of the LH promoter in pGL2. The GC-rich LH promoter (Fig.
7B) was created by PCR-directed mutagenesis and was cloned into pGL2. The Gal4 consensus site (Fig. 7C) or various
EGR-binding sites (Fig. 8A) were fused to the proximal LH
promoter ( 156 to +6) in pGL2. Gal4-Sp1 was created by fusing the Gal4
DNA-binding domain to the N terminus of Sp1. Sp1 cDNA was provided
by G. Suske. Sequencing of all plasmids was performed with an ABI model
373 automated sequencer.
Cell Culture and Transfection--
CV-1 cells were cultured as
described previously (42) and transfected using the calcium phosphate
method. Luciferase assays were carried out as described previously
(38). Transfections were performed in 12-well plates (Corning Glass)
using 3.5 × 104 cells per well and included 250 ng of
a reporter construct, 50 ng of a CMV-driven lacZ, expression
constructs as indicated in the figure legends, and sufficient
Bluescript plasmid (Stratagene) to provide a total of 1 µg of DNA per
transfection. Different amounts of EGR family member expression
constructs were used in order to optimize NAB responsiveness and to
account for variations in expression among the EGR proteins (see Fig.
2). Luciferase activity was normalized to the -galactosidase
activity from the transfected lacZ reporter as described
previously, and normalized activity was divided by basal promoter
activity to derive fold activation. Each data point represents the
average normalized activity in lysates prepared from two
identically transfected wells, and the standard deviation is indicated
by error bars. All reporter constructs were tested in at least two
independent experiments.
Immunoblot Analysis--
CV-1 cells in 6-well plates (7 × 104 cells/well) were transfected with 2 µg of the
indicated HA-EGR expression construct and lysed 48 h later in
Laemmli buffer. Lysates were boiled for 10 min, electrophoresed on a
sodium dodecyl sulfate-10% polyacrylamide gel, and transferred to a
nitrocellulose membrane (Midwest Scientific). Membranes were blocked in
Tris-buffered saline/Triton (TBST: 25 mM Tris-HCl, pH 7.4, 145 mM NaCl, 5 mM KCl, 1% Triton X-100)
containing 5% milk prior to incubation with TBST containing 3% milk
and a 1:200 dilution of the 12CA5 anti-HA monoclonal antibody. Protein blots were washed five times in TBST, incubated with horseradish peroxidase-conjugated anti-mouse immunoglobulin G (Jackson
ImmunoResearch Laboratories, Inc., West Grove, PA), washed five times
in TBST, and visualized by chemiluminescence detection (Amersham
Pharmacia Biotech). To confirm the migration size of the relatively
faint HA-EGR1 band, an additional lane was loaded with an HA-EGR1
lysate and probed with the anti-EGR1 antibody A310 (data not shown).
 |
RESULTS |
NAB2 Enhances EGR Activation of the LH Promoter--
To
determine the effect of NAB2 expression on the proximal rat LH
promoter ( 156 to +6), NAB2 was cotransfected into CV-1 cells along
with the four EGR proteins (EGR1-4) and an LH promoter-luciferase reporter employed in our previous studies. Surprisingly, NAB2 did not
repress but instead potentiated LH transactivation by all EGR family
members except EGR4/NGFI-C, which lacks the NAB-binding R1 domain (Fig.
1A). NAB2 coactivation of EGR3
was particularly potent. In contrast, EGR-dependent
activation of a synthetic promoter-luciferase reporter containing four
canonical EGR-binding sites (GCGGGGGCG) was repressed by NAB2 except in
the case of EGR4 (Fig. 1B), as previously observed (15).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1.
NAB2 coactivates EGR-dependent
LH transcription through a specific NAB2-EGR
interaction. A, CV-1 cells were transfected with the
appropriate amount of each EGR family member (500 ng of EGR1, 20 ng of
EGR2, 10 ng of EGR3, and 10 ng of EGR4), the LH -luciferase reporter
and NAB2 as indicated. Luciferase activity was normalized to the
-galactosidase activity produced by a cotransfected CMV-lacZ
construct and divided by basal promoter activity to derive fold
activation. B, CV-1 cells were transfected with EGR
expression constructs (25 ng of EGR1, 20 ng of EGR2, 10 ng of EGR3, and
2 ng of EGR4), a synthetic promoter bearing four EGR consensus sites
(GCGGGGGCG), and NAB2 as indicated. C, the LH reporter
(250 ng) was transfected into CV-1 cells along with an EGR3 expression
plasmid (10 ng) and the indicated amounts of NAB1 expression construct.
D, CV-1 cells were transfected with the 1.7-kb LH
promoter-luciferase construct and the indicated amounts of expression
constructs for NAB2, EGR1, and EGR1(I293F).
|
|
To determine whether NAB1 could also enhance EGR-directed transcription
of the LH promoter, increasing amounts of NAB1 were cotransfected
with EGR3. As shown in Fig. 1C, the maximum amount of
cotransfected NAB1 resulted in approximately 10-fold stimulation of
EGR3-mediated transcription. To test whether NAB coactivation could be
observed in the context of a more extensive LH promoter fragment, we
cotransfected NAB2 along with wild type or mutant EGR1 and a reporter
construct containing a 1.7-kb fragment ( 1700 to +5) of the rat LH
promoter (Fig. 1D). NAB2 stimulated EGR1 transcription of
this larger LH promoter by approximately 4-fold.
These experiments demonstrated that both NAB1 and NAB2 possessed an
unexpected ability to coactivate EGR-mediated transcription of the
LH promoter and that this coactivation depended upon interactions with EGR proteins. In the absence of cotransfected EGR1, NAB2 expression had no effect on the LH promoter (Fig. 1D).
Conversely, EGR1 with a point mutation (I293F) in its NAB-binding
domain was not responsive to NAB coactivation. Notably, EGR1(I293F) was
no more active than wild type EGR1 in the absence of NAB. This
observation contrasts sharply with results previously reported using
NAB-repressed promoters, where EGR1(I293F) is typically 10-15-fold
more active than wild type EGR1 (38), presumably due to its inability
to interact with endogenous NAB proteins, and provides further evidence that the LH promoter is not subject to NAB repression. Additionally, a deletion of the EGR-binding NCD1 domain of NAB1 was found to abrogate
coactivation of EGR-dependent LH transcription (see Fig.
4, mutant 2-210), further confirming that a specific
NAB-EGR interaction is required for NAB activation.
Differential Responses of EGR Proteins to NAB2
Coactivation--
In performing the experiments depicted in Fig.
1A, we noticed differences in the ability of NAB2 to
coactivate EGR family members. For instance, NAB2 coactivation was
observed in transfections employing 10 ng of an EGR3 expression vector,
but greater than 100 ng of an EGR1 expression vector was required to
see a similar effect (data not shown). To test whether protein
expression levels influence these differences in NAB responsiveness,
the hemagglutinin (HA) epitope was fused to the N terminus of all four
EGR proteins. In transfection experiments using the promoters employed
in Fig. 1, A and B, HA-tagged EGR proteins
behaved indistinguishably from the untagged versions (data not shown).
Equal amounts of HA-EGR proteins were transfected into CV-1 cells, and
3-fold dilutions of cell lysates were probed on a Western blot using an
anti-HA monoclonal antibody. This experiment revealed striking
differences in expression levels among HA-tagged EGR proteins (Fig.
2). HA-EGR1 was expressed roughly 10-fold
less robustly than EGR2 or EGR3, which were detected at essentially
equal levels. EGR4 appeared at least 10-fold more highly expressed than
EGR2.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 2.
HA-tagged EGR proteins display wide
variations in expression level. CV-1 cells were transfected with
equal amounts (2 µg) of HA-tagged EGR expression vectors, and
identically prepared lysates (200, 60, and 20 µl) were probed on a
Western blot with the anti-HA antibody 12CA5. The HA-tagged EGR
proteins migrated at their predicted relative mobilities; a 90-kDa
nonspecific band was detected in all four samples.
|
|
This result provided a possible explanation for the relative difficulty
of observing NAB2 coactivation of EGR1 compared with EGR2 or EGR3 at
comparable levels of expressor. The apparent instability of EGR1 may
reflect its short half-life within the cell, consistent with the
observation that many EGR1 inductions involve a massive burst followed
by a rapid (2-4 h) disappearance of the EGR1 protein (31), whereas
EGR3 is reported to be significantly more stable (43). Due to the
relatively poor expression level of transfected EGR1, we included EGR2
and EGR3 throughout our analysis, as these more highly expressed
proteins facilitated the evaluation of NAB-EGR interactions at various
mutant promoters.
Similarities between NAB1 Corepression and Coactivation--
NAB
proteins are active transcriptional repressors that function as part of
a DNA-bound EGR-NAB complex (Ref. 16 and data not shown). NAB1
represses activation domains other than those of EGR1, and tethered NAB
proteins can repress several types of constitutively active promoters.
To determine whether NAB2 coactivation of the LH promoter could
occur independently of EGR transcriptional activation domains, NAB2 was
recruited to the LH promoter using an EGR1 expression construct
consisting solely of the NAB-binding R1 domain and DNA-binding domain
of EGR1 (R1-ZnF). R1-ZnF does not activate transcription by itself, but
cotransfection of wild type NAB2 with R1-ZnF resulted in a 4-fold
activation of the LH promoter (Fig.
3). Cotransfection of R1-ZnF with a
non-EGR-binding NAB2 mutant, or of a mutant R1-ZnF with NAB2,
failed to enhance transcription above background levels. Therefore,
NAB2 appears to contain an independent coactivation domain that can be
specifically recruited to the LH promoter independently of EGR
transcriptional activation domains.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 3.
NAB2 activates transcription when tethered to
the LH promoter in the absence of EGR
activation domains. CV-1 cells were transfected with the
LH -luciferase reporter and indicated amounts of expression
constructs for NAB2 and a fusion of the NAB-binding R1 domain of EGR1
with the EGR1 DNA-binding domain (R1-ZnF). The R1 mutant (I293F) and
the NAB2 mutant (E82K) disrupt the interaction between NAB2 and the R1
domain of EGR1. Activation of the LH promoter was determined as
described in Fig. 1.
|
|
Previous work in our laboratory (16) mapped the NAB1 corepression
activity to the C-terminal NCD2 domain using deletion, insertion, and
replacement mutations in the NAB1 protein. To learn whether NAB1
coactivation might involve a region of the protein distinct from that
required for NAB1 corepression, we assayed the effect of various NAB1
mutants on EGR3-mediated activation of either the LH
promoter-reporter or a promoter containing four EGR consensus sites. As
expected, an N-terminal deletion that removed the EGR-binding NCD1
domain disrupted both coactivation and corepression by NAB1 (Fig.
4, 2-210). An insertional
mutation (insertion 244-245) that had no effect on NAB1 repression
also failed to disrupt NAB1 coactivation. However, a small deletion within NCD2 ( 361-388) was found to abolish both coactivation and
corepression. Even more strikingly, a replacement mutation within a
region of NCD2 homologous to the E1b 55-kDa repressor protein also
eliminated both coactivation and corepression. Indeed, none of the
other NAB1 mutants tested (data not shown) allowed us to distinguish
between the NAB1 coactivation and corepression domains, suggesting that
the same domain of NAB1 is involved in both functions (see
"Discussion").

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 4.
NAB1 coactivation localizes to the NCD2
domain implicated in NAB1 corepression. Wild type NAB1 and mutant
versions of NAB1 were tested for their effect on EGR3-mediated
activation of the LH promoter or with the synthetic EGR-responsive
promoter used previously. CV-1 cells were transfected with the
LH -luciferase reporter, EGR3 (10 ng), and NAB1 or NAB1 mutants (100 ng) to analyze NAB activation. To analyze NAB repression, CV-1 cells
were transfected with the synthetic EGR-responsive promoter as well as
expression constructs for EGR3 (2 ng) and NAB1 or NAB1 mutants (25 ng).
Normalized luciferase activity in the presence of NAB was divided by
normalized luciferase activity in the absence of NAB to derive fold
coactivation; the inverse calculation was performed to derive fold
corepression. Although more expressor was required to detect a
significant response for the NAB-activated promoters (i.e.
10 ng of EGR3, rather than 2 ng for repressed promoters), the ratio of
EGR3 to NAB1 was kept essentially constant for all promoters
tested.
|
|
Lack of an SF-1 Contribution to NAB Coactivation--
Coexpression
of EGR1 and SF-1 has been shown to have a synergistic effect upon LH
transcription in CV-1 cells (7), and this synergy has been attributed
to protein-protein interactions between EGR1 and SF-1 (36). The rat
LH promoter contains SF-1-binding sites at 127 and 59 (33). To
learn whether these SF-1-binding sites might influence NAB2
coactivation, mutant proximal LH promoters were tested in which one
or both SF-1-binding sites were deleted. As shown in Fig.
5, mutation of either or both
SF-1-binding sites had no effect upon NAB2 coactivation of EGR-mediated
transcription, suggesting that SF-1-binding sites are not required for
NAB activity.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 5.
NAB2 coactivation of the
LH promoter requires EGR1-binding sites.
CV-1 cells were transfected with the indicated promoter-luciferase
constructs and expression constructs for NAB2 (20 ng), and EGR1 (60 ng), EGR2 (20 ng), or EGR3 (10 ng). An X denotes a missense
mutation in the designated consensus site (see "Materials and
Methods"). Normalized luciferase activity was divided by basal
promoter activity to determine fold activation.
|
|
To determine whether the two EGR-binding sites in the LH promoter
are both required for NAB activation, we tested an LH promoter-reporter with a mutated downstream EGR1-binding site (GTGGGGGTG to CTAAGAATA). This mutant promoter still demonstrated NAB2
coactivation, although the overall level of transcription was
attenuated compared with that seen with wild type LH (Fig. 5). When
the upstream EGR-binding site (TTGGGGGCG) was mutated to TTGGAAAGCG in
the context of the native downstream EGR site, the resulting promoter
was still NAB-activated but showed lower activity (Fig. 5). If both
potential EGR-binding sites were mutated, the promoter lost all EGR and
NAB responsiveness. Therefore, NAB2 coactivation is absolutely
dependent on the presence of a functional EGR-binding site in the LH
promoter but does not require that both sites be intact.
Comparison of NAB Function at Potential EGR Target Genes--
To
determine the effect of NAB2 on several potential Egr target
genes, we cotransfected the NAB2 and EGR3 expression plasmids with
reporter constructs for the bFGF/FGF-2, tissue factor, TGF- 1, and
Fas ligand promoters (Fig. 6) in CV-1
cells. NAB2 coexpression repressed transcription of the bFGF, tissue
factor, and TGF- 1 promoters. However, the promoter for Fas ligand,
which has been implicated as a target gene of Egr2 and
Egr3 (27, 28), demonstrated robust NAB coactivation, as did
LH . Therefore, NAB2 coactivation is not restricted to the LH gene
but could affect Fas ligand transcription as well.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6.
NAB-repressed EGR target promoters possess
more GC-rich domains than NAB-activated promoters. Black
rectangles depict stretches of at least six nucleotides consisting
exclusively of guanosine or cytosine and are drawn to scale for the
100 to +100 region of each promoter. CV-1 cells were transfected with
promoter-luciferase constructs (250 ng) for bFGF ( 500 to +160),
tissue factor ( 264 to +15), TGF- 1 ( 190 to +20), LH ( 156 to
+6), and FasL ( 511 to 2) along with expression constructs for EGR3
(10 ng) and NAB2 (20 ng). Fold activation was calculated by dividing
normalized luciferase activity in the presence of NAB2 by normalized
luciferase activity in the absence of NAB2 for NAB-activated promoters;
the calculation was performed in the opposite manner for NAB-repressed
promoters. A negative value indicates NAB2 repression.
|
|
Comparison of these EGR target promoters revealed striking differences
in the abundance of sequences rich in the nucleotides guanine (G) and
cytosine (C) according to whether the genes were repressed or activated
by NAB coexpression (Fig. 6; filled boxes depict GC
stretches of 6 nucleotides or more). NAB-repressed genes displayed
abundant GC-rich sequence from 100 to +100. Conversely, no
significant GC-rich domains were observed in NAB-activated promoters.
To assess the number of consensus EGR-binding sites located within the
promoter-reporter constructs tested in Fig. 6, we analyzed these
proximal promoter sequences using an algorithm derived from previous
studies defining the high affinity EGR consensus-binding site as
TGCG(T/g)(G/A)GG(C/a/t)G(G/T) (44). As expected, the GC-rich EGR
consensus sequence was found more frequently in the GC-rich
NAB-repressed promoters than in the GC-poor NAB-activated promoters
(Table I). Three potential EGR-binding
sites were found in the bFGF promoter, for example, compared with one
potential site (GAGTGGGTG) in the FasL promoter. It should be noted,
however, that this algorithm will not identify EGR-binding sites that
deviate from the consensus, such as the upstream LH site (TTGGGGGCG) described earlier. Although computer-based search methods do not provide a completely reliable means of identifying EGR-binding sites,
it nonetheless appears that GC-rich, NAB-repressed promoters generally
possess more consensus EGR-binding sites than do GC-poor, NAB-activated
promoters.
NAB Repression at bFGF/LH Promoter Chimeras--
To gain
insight into the determinant(s) of NAB function at different promoters,
we constructed reciprocal chimeras of the NAB-repressed bFGF proximal
promoter and the NAB-activated LH proximal promoter, and we tested
their function in CV-1 cells. The GC-rich bFGF promoter ( 500 to +160)
contains three EGR-binding sites as defined by the algorithm described
above, and at least two of these sites are involved in promoter
activation (18). In addition, the promoter contains five Sp1 consensus
sites, and Sp1 binding at some of these sites has been observed in gel
mobility shift assays (18). Whereas the LH promoter contains a
functional TATA element near the downstream EGR-binding site, the bFGF
promoter contains neither a TATA box nor initiator consensus sequences (45). A transition point of 35 relative to the transcriptional start
site was chosen in constructing these chimeric promoters so that the
LH TATA sequence, but neither of the LH EGR-binding sites, would
be available to direct transcription of the bFGF/LH chimeric
promoter (see diagram, Fig.
7A).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 7.
NAB proteins repress
EGR-dependent transcription in chimeric reporters
containing bFGF and LH promoter sequence.
A, EGR-binding sites, Sp1-binding sites, and GC-rich
stretches in the LH and bFGF promoters are depicted by the indicated
symbols. Only consensus EGR-binding sites identified by the algorithm
used in Table I are shown; a nonconsensus site has been identified in
the LH promoter (Fig. 4), however, and additional EGR-binding sites
may be present in the bFGF promoter (18). The 35 position in each
promoter was used as a crossover point in constructing the chimeras and
is indicated by a vertical line. Wild type or chimeric
promoters fused to luciferase were transfected along with expression
constructs for EGR1 (60 ng), EGR2 (20 ng), EGR3 (10 ng), and NAB2 as
indicated. Normalized luciferase activity was divided by basal promoter
activity to determine fold activation. NAB2 coactivation of EGR1 at the
wild type LH promoter is diminished relative to that shown in Fig.
1A due to the use of nearly 10-fold less expression
construct. Solid bar, 0 ng of NAB2; shaded bar,
20 ng of NAB2; solid triangle, EGR consensus site;
solid oval, Sp1 consensus site; solid square, GC
stretch 6 nucleotides. B, replacement of 18 base pairs of
the native LH promoter ( 24 to 6) with GC-rich sequence has no
effect upon NAB2 coactivation of EGR-dependent LH
transcription. CV-1 cells were transfected with the GC-rich LH promoter along with expression constructs for EGR1
(50 ng), EGR2 (20 ng), or EGR3 (10 ng) and NAB2 as indicated. Fold
activation was determined as described above. C, recruitment
of Gal4-Sp1 to a modified LH promoter does not prevent NAB2
coactivation. The 5'Gal4-LH promoter reporter (250 ng) and indicated
amounts of EGR3, NAB2, and Gal4-Sp1 expression constructs were
transfected into CV-1 cells. Fold activation was determined as
described above.
|
|
When tested in CV-1 cells, both the LH /bFGF and the bFGF/LH
chimeric promoters were repressed by NAB2 (Fig. 7A). The
bFGF/LH chimera, which features multiple EGR and Sp1 consensus sites
derived from the bFGF promoter, was strongly activated by EGR proteins and strongly repressed by NAB2. This result indicated that NAB repression of bFGF could be observed in a promoter with heterologous elements controlling transcriptional initiation and that sequences surrounding the TATA element of the LH promoter do not dictate NAB function.
More surprisingly, fusion of the upstream LH promoter with the
downstream bFGF sequences (LH /bFGF) resulted in a promoter that no
longer supported NAB coactivation and showed approximately 2-fold NAB
corepression. This chimeric promoter included both LH EGR-binding
sites in addition to downstream bFGF sequence ( 35 to +160); this
GC-rich bFGF sequence includes a consensus Sp1 site and might contain
noncanonical EGR-binding sites as well. Taken together, these data
indicate that both the LH /bFGF and the bFGF/LH chimeric promoters
resembled the intact bFGF promoter in their response to NAB proteins
and suggest a dominant influence of GC-rich bFGF sequence on NAB function.
To determine whether the dominant influence of bFGF promoter sequence
in the chimeric promoters could be due solely to its high GC content,
which might influence promoter melting during transcriptional
initiation (46), a mutant LH promoter was constructed in which
sequence near the transcriptional initiation site ( 24 to 6) was
changed to GGGCCCGGGCCCGGGCCCGG. This GC-rich sequence, which does not
recruit any known transcription factor (47), permitted strong NAB
coactivation (Fig. 7B), suggesting that GC content per
se is not a determinant of NAB function.
Alternatively, GC-rich bFGF promoter sequence might suppress NAB
coactivation by recruiting Sp1 to the bFGF/LH promoter. Sp1 is a
widely expressed transcriptional activator that binds to a GC-rich
consensus site (48). To test the possible role of Sp1 without
interference from endogenous Sp1 protein or complications from cryptic
EGR-binding sites, we recruited a Gal4-Sp1 fusion protein to an LH
promoter bearing a Gal4-binding site at its 5' end (5'Gal4-LH , Fig.
7C). Coexpression of EGR3 and NAB2 resulted in strong NAB2
coactivation of this promoter, whereas expression of Gal4-Sp1 by itself
resulted in dose-dependent activation. Coexpression of
Gal4-Sp1 with EGR3 and NAB2 did not diminish NAB coactivation and in
fact resulted in increased transcriptional activity. Therefore, recruitment of Sp1 to a NAB-activated promoter does not alter NAB function.
Effects of Increased Binding Affinity and Number of EGR-binding
sites on NAB Function--
The ability of bFGF promoter sequences to
prevent NAB2 coactivation in the LH /bFGF promoter chimera could
involve recruitment of additional EGR molecules to the promoter. To
explore the influence of additional EGR-binding sites upon NAB2
function, EGR-binding sites of varying number and binding strength were
fused to the 5' end of the LH proximal promoter fragment (Fig.
8A). These additional sites
included one or two copies of the downstream LH EGR site
(GTGGGGGTG), which is a relatively weak EGR-binding site (35), or one
or two copies of the optimal EGR consensus site (GCGTGGGCG) determined
by in vitro studies. In all four of these promoters,
addition of upstream EGR-binding sites attenuated NAB2 coactivation.
This effect was particularly striking when two copies of the optimal
consensus sequence were employed (5'2×GCGT) and less dramatic when one
optimal consensus site was included (5'1×GCGT) or when one or two
LH downstream sites were included (5'1×GTG and 5'2×GTG).
Therefore, both the number and relative strength of EGR-binding sites
appear to influence NAB function.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 8.
Increasing the number and strength of
EGR-binding sites in the LH promoter
attenuates NAB2 coactivation. A, EGR-binding sites
fused to the 5' end of the proximal LH reporter diminished NAB2
coactivation. EGR binding sequences are depicted in the legend. CV-1
cells were transfected with the indicated promoter-reporter as well as
expression constructs for EGR1 (500 ng), EGR2 (20 ng), or EGR3 (10 ng)
and NAB2 as indicated. Fold activation was determined by
dividing normalized luciferase activity by basal promoter activity, and
fold coactivation was determined by dividing fold activation in the
presence of NAB by fold activation in the absence of NAB. B,
duplication and mutation of the 3' LH EGR site shows that both
the number and strength of EGR-binding sites influence NAB function.
EGR binding sequences are depicted in the legend. CV-1 cells were
transfected, and fold coactivation was determined as described above. A
negative value for NAB2 coactivation indicates NAB2 corepression.
|
|
To extend this observation, we altered the LH promoter's native
downstream EGR-binding site (GTGGGGGTG). When this element was changed
to a double downstream EGR site (2×GTG), NAB2 coactivation was
weakened but not abolished (Fig. 8B). Replacement of the
native site with a single canonical EGR-binding site (GCGGGGGCG) site (1×GCG) had only a minimal effect on NAB function. Insertion of two
canonical-binding sites (2×GCG) resulted in significant attenuation of
NAB2 coactivation. To learn whether the addition of more EGR sites
would result in NAB corepression, we created a mutant LH promoter in
which replacement of the native EGR site with two canonical sites was
combined with insertion of two optimal EGR-binding sites at the 5' end
as in Fig. 8A (2×GCGT/2×GCG). This promoter supported NAB
corepression of transcription mediated by EGR1 and EGR2 and virtually
eliminated NAB2 coactivation of EGR3 (Fig. 8B; corepression
is indicated as negative coactivation). In the context of the native
LH promoter, then, simply increasing the multiplicity or binding
strength of a native EGR site produced attenuated NAB coactivation, but
changing both parameters simultaneously ultimately resulted in NAB corepression.
Analysis of NAB Function on Synthetic EGR-responsive
Promoters--
To examine the effect of EGR site strength and
multiplicity on NAB function in a simplified context, NAB activity was
tested using luciferase reporter constructs featuring various
EGR-binding sites upstream of a minimal promoter. As reported
previously and shown in Fig. 1B, potent NAB repression was
observed at a promoter bearing four canonical EGR consensus sites
(2×GCG) (Fig. 9A). However,
an otherwise identical promoter containing only one EGR consensus site
(1×GCG) supported NAB coactivation of EGR2 and EGR3, whereas NAB
repression of EGR1 was abolished. A single copy of the downstream LH
EGR site (1×GTG) supported NAB coactivation of all three EGR proteins.
Two copies of the LH site (2×GTG) also resulted in coactivation of
EGR3, but NAB had little effect on EGR1 or EGR2. These results confirm
the importance of both the number of EGR-binding sites and their
relative strength in determination of NAB function.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 9.
NAB function at a synthetic promoter is
determined by both the strength and number of EGR-binding sites.
Consensus EGR-binding sites (GCGGGGGCG) or the lower affinity LH
3'-binding sites (GTGGGGGTG) were inserted upstream of a minimal
prolactin promoter fused to luciferase as indicated. CV-1 cells were
transfected with the indicated reporter constructs and expression
constructs for EGR1 (25 ng), EGR2 (25 ng), or EGR3 (10 ng) and NAB2 as
indicated. Fold activation was determined by dividing normalized
luciferase activity by basal promoter activity. Solid
square, 0 ng of NAB2; shaded square, 20 ng of
NAB2.
|
|
 |
DISCUSSION |
The initial characterization of NAB proteins demonstrated that
they repress transactivation by EGR1 of a synthetic promoter bearing
four canonical EGR-binding sites. As widely expressed corepressors of
EGR-dependent transcription that can be induced by many of
the stimuli that up-regulate EGR genes, NAB proteins were predicted to
negatively regulate Egr target genes. Here we have reported
that NAB proteins can also function as potent coactivators of certain
EGR target promoters, including LH , perhaps the best established
physiological target of EGR1. NAB coactivation was also observed using
both various synthetic minimal promoters and the promoter of the Fas
ligand gene, a putative Egr2/Egr3 target gene (27, 28). Both NAB1 and
NAB2 can function as EGR coactivators, and this coactivation is
dependent upon the NAB-EGR interaction. NAB coactivation occurs
independently of EGR transactivation domains and SF-1-binding sites,
and maps to the NCD2 domain previously implicated in NAB corepression.
Comparison of NAB-activated and NAB-repressed EGR-responsive promoters
suggested a positive correlation between the observation of NAB
repression and the presence of GC-rich sequences in a given promoter.
In principle, GC-rich sequences might influence NAB function through an
effect on promoter melting requirements for transcriptional initiation
or by recruiting the ubiquitously expressed Sp1 transactivator, which
binds a GC-rich consensus site (GGCGGG). However, analysis of chimeric,
mutant, and synthetic promoters demonstrated that both the nature and
the number of a promoter's EGR-binding sites ultimately determine NAB function.
An ability to both activate and repress transcriptional activity has
previously been reported for a number of proteins, including WT1, YY1,
p53, retinoblastoma protein, Dorsal, ROR , various prokaryotic transactivators (49-51), and others. WT1, the Wilms tumor suppressor protein, is related to EGR proteins in its DNA-binding domain and binds
a similar consensus site (52). Its differential effects on
transcription have been mapped to independent activation and repression
domains that may interact with various cellular proteins (53). In
several other cases of activator/repressor proteins, such as ROR
(54) and the HIV Tat protein (55), separate activation and repression
domains have also been identified. Concentration-dependent activity switches have been reported for other repressor/activators such as p53, which can activate at low levels and repress at higher levels (56), and BSAP, which at low levels reportedly activates transcription from high affinity binding sites but at higher
concentrations represses transcription from low affinity sites (57).
The activity of Dorsal depends on binding of factors to adjacent DNA
sites (58), whereas the corepressor Rb can activate transcription through interactions with factors such as MyoD (59). YY1
activates or represses in a complex pattern that may depend both on its intrinsic DNA-bending ability and on interactions with promoter-bound factors (60, 61).
A bacteriophage activator/repressor protein, p4 from phage 29, is
reminiscent of NAB proteins in the use of a single protein domain to
carry out both repression and activation. The interaction between p4
and bacterial RNA polymerase (RNAP) leads to activation or repression
depending on the strength of the sigma A-binding site (62). At a weak
binding site, p4-directed transcription is activated through
recruitment and stabilization of RNAP; at a strong binding site, bound
RNAP is overstabilized and trapped at the promoter, leading to
transcriptional repression. Fig. 10 depicts a similar model as applied to NAB activity. According to this
hypothetical scheme, the NAB NCD2 domain might interact with the
mammalian RNA polymerase complex either directly or through an
unidentified bridging factor. At promoters with few or low affinity
EGR-binding sites, such an interaction might result in productive
recruitment of the transcriptional machinery and NAB coactivation. At
promoters with higher affinity and/or greater numbers of EGR-binding
sites, cooperative interactions between bound NAB-EGR complexes and the
NCD2-interacting factor could result in trapping of the overstabilized
polymerase complex, reduced promoter clearance, and NAB repression.
Testing of this model would require the identification of NCD2
target(s) and the development of promoter clearance assays in
NAB-regulated transcriptional systems.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 10.
Model to describe how NAB proteins could
function as transcriptional coactivators or corepressors depending upon
the number and strength of EGR-binding sites. Both activation and
repression functions of NAB map to the conserved NCD2 domain, and this
domain is proposed to interact with the basic transcriptional machinery
either directly or through an intermediary protein. In promoters
bearing few or weak EGR-binding sites, the NCD2-mediated interaction
could function to stabilize binding of the RNA polymerase holoenzyme
and thereby enhance transcription. In promoters with multiple and/or
high affinity EGR-binding sites, the NCD2-mediated interaction might
prevent transcriptional initiation by trapping the holoenzyme in an
overstabilized complex. Horizontal arrows depict possible
interactions between bound EGR-NAB complexes. Solid square,
EGR consensus site.
|
|
Initial analysis of NAB proteins suggested that their interaction with
EGR proteins would transform an EGR transactivator into an EGR-NAB
repressor complex. Results described in this study suggest that, at
certain promoters such as LH , NAB proteins can amplify an
EGR-directed transcriptional response. This novel activation function
of NAB proteins may help to explain the association of a mutation in
the NAB-binding domain of EGR2 (I268N) with a recessive case of human
myelinopathy (30). Myelinopathies result from Schwann cell defects
leading to abnormal myelination, and these particular cases are
presumably caused by misregulation of one or more EGR2 target genes. If
NAB proteins function as repressors of a critical target gene, one
might expect a single, derepressed allele of EGR2(I268N) to up-regulate
markedly target gene transcription, leading to a dominant inheritance
pattern. But if NAB proteins function instead as coactivators of a
critical EGR2 target gene, mutation of both EGR2 alleles might be
required to decrease significantly EGR-directed transcription, and
recessive disease transmission would be predicted. Further elucidation
of the role of NAB proteins in human myelinopathies awaits the
identification of critical EGR2 target genes within Schwann cells, but
the association of a mutation in the NAB-binding domain of EGR2 with
human disease highlights the importance of coregulatory proteins such
as NAB1 and NAB2 in transcriptional control.
 |
ACKNOWLEDGEMENTS |
We thank Paul Mittelstadt for sharing
observations regarding NAB2 coactivation of the Fas ligand promoter and
A. Bruce for critical reading of the manuscript. We thank Y. Sadovsky,
J. Ashwell, S. Felts, R. Maurer, and G. Suske for providing plasmids
described under "Materials and Methods."
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant 5 P01 CA49712-08 and grants from The Association for the Cure of
Cancer of the Prostate (CaP CURE) and from the Monsanto Corp.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Depts. of Pathology
and Internal Medicine, Division of Laboratory Medicine, Washington University School of Medicine, 660 South Euclid Ave., St. Louis, MO
63110. Tel.: 314-362-4651Fax number: 314-362-8756; E-mail: jeff@
milbrandt.wustl.edu.
1
M. Clements and J. Milbrandt, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
bFGF, basic
fibroblast growth factor;
TGF- , transforming growth factor- ;
LH , luteinizing hormone ;
CMV, cytomegalovirus;
HA, hemagglutinin;
kb, kilobase pair;
PCR, polymerase chain reaction;
NGF, nerve growth factor;
GnRH, gonadotropin releasing hormone.
 |
REFERENCES |
| 1.
|
Weintraub, S. J.,
Chow, K. N.,
Luo, R. X.,
Zhang, S. H.,
He, S.,
and Dean, D. C.
(1995)
Nature
375,
812-815[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Torchia, J.,
Glass, C.,
and Rosenfeld, M. G.
(1998)
Curr. Opin. Cell Biol.
10,
373-383[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Mannervik, M.,
Nibu, Y.,
Zhang, H.,
and Levine, M.
(1999)
Science
284,
606-609[Abstract/Free Full Text]
|
| 4.
|
Gashler, A.,
and Sukhatme, V. P.
(1995)
Prog. Nucleic Acid Res. Mol. Biol.
50,
191-224[Medline]
[Order article via Infotrieve]
|
| 5.
|
O'Donovan, K. J.,
Tourtellotte, W. G.,
Millbrandt, J.,
and Baraban, J. M.
(1999)
Trends Neurosci.
22,
167-173[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Beckmann, A. M.,
and Wilce, P. A.
(1997)
Neurochem. Int.
31,
477-510[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Lee, S. L.,
Sadovsky, Y.,
Swirnoff, A. H.,
Polish, J. A.,
Goda, P.,
Gavrilina, G.,
and Milbrandt, J.
(1996)
Science
273,
1219-1222[Abstract]
|
| 8.
|
Topilko, P.,
Schneider-Maunoury, S.,
Levi, G.,
Trembleau, A.,
Gourdji, D.,
Driancourt, M. A.,
Rao, C. V.,
and Charnay, P.
(1998)
Mol. Endocrinol.
12,
107-122[Abstract/Free Full Text]
|
| 9.
|
Tourtellotte, W. G.,
and Milbrandt, J.
(1998)
Nat. Genet.
20,
87-91[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Tourtellotte, W. G.,
Nagarajan, R. N.,
Auyeung, A.,
Mueller, C.,
and Milbrandt, J.
(1999)
Development
126,
5061-5071[Abstract]
|
| 11.
|
Schneider-Maunoury, S.,
Topilko, P.,
Seitanidou, T.,
Levi, G.,
Cohen- Tannoudji, M.,
Pournin, S.,
Babinet, C.,
and Charnay, P.
(1993)
Cell
75,
1199-1214[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Swiatek, P. J.,
and Gridley, T.
(1993)
Genes Dev.
7,
2071-2084[Abstract/Free Full Text]
|
| 13.
|
Topilko, P.,
Schneider-Maunoury, S.,
Levi, G.,
Baron-Van Evercooren, A.,
Chennoufi, A. B. Y.,
Seitanidou, T.,
Babinet, C.,
and Charnay, P.
(1994)
Nature
371,
796-799[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Levi, G.,
Topilko, P.,
Schneider-Maunoury, S.,
Lasagna, M.,
Mantero, S.,
Cancedda, R.,
and Charnay, P.
(1996)
Development
122,
113-120[Abstract]
|
| 15.
|
Russo, M. W.,
Sevetson, B. R.,
and Milbrandt, J.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
6873-6877[Abstract/Free Full Text]
|
| 16.
|
Swirnoff, A. H.,
Apel, E. D.,
Svaren, J.,
Sevetson, B. R.,
Zimonjic, D. B.,
Popescu, N. C.,
and Milbrandt, J.
(1998)
Mol. Cell. Biol.
18,
512-524[Abstract/Free Full Text]
|
| 17.
|
Biesiada, E.,
Razandi, M.,
and Levin, E. R.
(1996)
J. Biol. Chem.
271,
18576-18581[Abstract/Free Full Text]
|
| 18.
|
Wang, D.,
Mayo, M. W.,
and Baldwin, A. S. J.
(1997)
Oncogene
14,
2291-2299[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Kim, S. J.,
Park, K.,
Rudkin, B. B.,
Dey, B. R.,
Sporn, M. B.,
and Roberts, A. B.
(1994)
J. Biol. Chem.
269,
3739-3744[Abstract/Free Full Text]
|
| 20.
|
Liu, C.,
Adamson, E.,
and Mercola, D.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
11831-11836[Abstract/Free Full Text]
|
| 21.
|
Cui, M. Z.,
Parry, G. C., N.,
Oeth, P.,
Larson, H.,
Smith, M.,
Huang, R. P.,
Adamson, E. D.,
and Mackman, N.
(1996)
J. Biol. Chem.
271,
2731-2739[Abstract/Free Full Text]
|
| 22.
|
Seitanidou, T.,
Schneider-Maunoury, S.,
Desmarquet, C.,
Wilkinson, D. G.,
and Charnay, P.
(1997)
Mech. Dev.
65,
31-42[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Sham, M. H.,
Vesque, C.,
Nonchev, S.,
Marshall, H.,
Frain, M.,
Gupta, R. D.,
Whiting, J.,
Wilkinson, D.,
Charnay, P.,
and Krumlauf, R.
(1993)
Cell
72,
183-196[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Theil, T.,
Frain, M.,
Gilardi-Hebenstreit, P.,
Flenniken, A.,
Charray, P.,
and Wilkinson, D. G.
(1998)
Development
125,
443-452[Abstract]
|
| 25.
|
Khachigian, L. M.,
Williams, A. J.,
and Collins, T.
(1995)
J. Biol. Chem.
270,
27679-27686[Abstract/Free Full Text]
|
| 26.
|
Khachigian, L. M.,
Lindner, V.,
Williams, A. J.,
and Collins, T.
(1996)
Science
271,
1427-1431[Abstract]
|
| 27.
|
Mittelstadt, P. R.,
and Ashwell, J. D.
(1998)
Mol. Cell. Biol.
18,
3744-3751[Abstract/Free Full Text]
|
| 28.
|
Mittelstadt, P. R.,
and Ashwell, J. D.
(1999)
J. Biol. Chem.
274,
3222-3227[Abstract/Free Full Text]
|
| 29.
|
Qu, Z.,
Wolfraim, L. A.,
Svaren, J.,
Ehrengruber, M. U.,
Davidson, N.,
and Milbrandt, J.
(1998)
J. Cell Biol.
142,
1075-1082[Abstract/Free Full Text]
|
| 30.
|
Warner, L. E.,
Svaren, J.,
Milbrandt, J.,
and Lupski, J. R.
(1999)
Hum. Mol. Genet.
8,
1245-1251[Abstract/Free Full Text]
|
| 31.
|
Svaren, J.,
Sevetson, B. R.,
Apel, E. D.,
Zimonjic, D. B.,
Popescu, N. C.,
and Milbrandt, J.
(1996)
Mol. Cell. Biol.
16,
3545-3553[Abstract]
|
| 32.
|
Fan, W.,
Ma, J. X.,
Cheng, L.,
and Norris, J. S.
(1997)
Mol. Endocrinol.
11,
1342-1352[Abstract/Free Full Text]
|
| 33.
|
Halvorson, L. M.,
Ito, M.,
Jameson, J. L.,
and Chin, W. W.
(1998)
J. Biol. Chem.
273,
14712-14720[Abstract/Free Full Text]
|
| 34.
|
Dorn, C.,
Ou, Q.,
Svaren, J.,
Crawford, P. A.,
and Sadovsky, Y.
(1999)
J. Biol. Chem.
274,
13870-13876[Abstract/Free Full Text]
|
| 35.
|
Wolfe, M. W.,
and Call, G. B.
(1999)
Mol. Endocrinol.
13,
752-763[Abstract/Free Full Text]
|
| 36.
|
Tremblay, J. J.,
and Drouin, J.
(1999)
Mol. Cell. Biol.
19,
2567-2576[Abstract/Free Full Text]
|
| 37.
|
Brewer, C. B.
(1994)
Methods Cell Biol.
43,
233-245
|
| 38.
|
Russo, M. W.,
Matheny, C.,
and Milbrandt, J.
(1993)
Mol. Cell. Biol.
13,
6858-6865[Abstract/Free Full Text]
|
| 39.
|
Svaren, J.,
Sevetson, B. R.,
Golda, T.,
Stanton, J. J.,
Swirnoff, A. H.,
and Milbrandt, J.
(1998)
EMBO J.
17,
6010-6019[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Kozak, M.
(1986)
Cell
44,
283-292[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Kim, K. E.,
Day, K. H.,
Howard, P.,
Salton, S. R. J.,
Roberts, J. L.,
and Maurer, R. A.
(1990)
Mol. Cell. Endocrinol.
74,
101-107[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Paulsen, R. E.,
Weaver, C. A.,
Fahrner, T. J.,
and Milbrandt, J.
(1992)
J. Biol. Chem.
267,
16491-16496[Abstract/Free Full Text]
|
| 43.
|
O'Donovan, K. J.,
Wilkens, E. P.,
and Baraban, J. M.
(1998)
J. Neurochem.
70,
1241-1248[Medline]
[Order article via Infotrieve]
|
| 44.
|
Swirnoff, A. H.,
and Milbrandt, J.
(1995)
Mol. Cell. Biol.
15,
2275-2287[Abstract]
|
| 45.
|
Kraus, R. J.,
Murray, E. E.,
Wiley, S. R.,
Zink, N. M.,
Loritz, K.,
Gelembiuk, G. W.,
and Mertz, J. E.
(1996)
Nucleic Acids Res.
24,
1531-1539[Abstract/Free Full Text]
|
| 46.
|
Myers, R. M.,
Fischer, S. G.,
Maniatis, T.,
and Lerman, L. S.
(1985)
Nucleic Acids Res.
13,
3111-3129[Abstract/Free Full Text]
|
| 47.
|
Quandt, K.,
Frech, K.,
Karas, H.,
Wingender, E.,
and Werner, T.
(1995)
Nucleic Acids Res.
23,
4878-4884[Abstract/Free Full Text]
|
| 48.
|
Kadonaga, J. T.,
Carner, K. R.,
Masiarz, F. R.,
and Tjian, R.
(1987)
Cell
51,
1079-1090[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
van der Woude, M. W.,
Kaltenbach, L. S.,
and Low, D. A.
(1995)
Mol. Microbiol.
17,
303-312[Medline]
[Order article via Infotrieve]
|
| 50.
|
Ansari, A. Z.,
Bradner, J. E.,
and O'Halloran, T. V.
(1995)
Nature
374,
371-375[Medline]
[Order article via Infotrieve]
|
| 51.
|
Hidalgo, E.,
and Demple, B.
(1997)
EMBO J.
16,
1056-1065[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Rauscher, F. J.,
Morris, J. F.,
Tournay, O. E.,
Cook, D. M.,
and Curran, T.
(1990)
Science
250,
1259-1262[Abstract/Free Full Text]
|
| 53.
|
Wang, Z. Y.,
Qiu, Q. Q.,
Gurrieri, M.,
Huang, J.,
and Deuel, T. F.
(1995)
Oncogene
10,
1243-1247[Medline]
[Order article via Infotrieve]
|
| 54.
|
Harding, H. P.,
Atkins, G. B.,
Jaffe, A. B.,
Seo, W. J.,
and Lazar, M. A.
(1997)
Mol. Endocrinol.
11,
1737-1746[Abstract/Free Full Text]
|
| 55.
|
Brown, J. A.,
Howcroft, T. K.,
and Singer, D. S.
(1998)
J. Acquired Immune Defic. Syndr.
17,
9-16
|
| 56.
|
Kristjuhan, A.,
and Maimets, T.
(1995)
Eur. J. Biochem.
234,
827-831[Medline]
[Order article via Infotrieve]
|
| 57.
|
Wallin, J. J.,
Gackstetter, E. R.,
and Koshland, M. E.
(1998)
Science
279,
1961-1964[Abstract/Free Full Text]
|
| 58.
|
Ip, Y. T.
(1995)
Curr. Biol.
5,
1-3[CrossRef][Medline]
[Order article via Infotrieve]
|
| 59.
|
Sellers, W. R.,
Novitch, B. G.,
Miyake, S.,
Heith, A.,
Otterson, G. A.,
Kaye, F. J.,
Lassar, A. B.,
and Kaelin, W. G., Jr.
(1998)
Genes Dev.
12,
95-106[Abstract/Free Full Text]
|
| 60.
|
Natesan, S.,
and Gilman, M.
(1995)
Mol. Cell. Biol.
15,
5975-5982[Abstract]
|
| 61.
|
Galvin, K. M.,
and Shi, Y.
(1997)
Mol. Cell. Biol.
17,
3723-3732[Abstract]
|
| 62.
|
Monsalve, M.,
Calles, B.,
Mencia, M.,
Salas, M.,
and Rojo, F.
(1997)
Mol. Cell
1,
99-107[CrossRef][Medline]
[Order article via Infotrieve]
|
| 63.
|
Kim, S. J.,
Glick, A.,
Sporn, M. B.,
and Roberts, A. B.
(1989)
J. Biol. Chem.
264,
402-408[Abstract/Free Full Text]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. Desmazieres, P. Charnay, and P. Gilardi-Hebenstreit
Krox20 Controls the Transcription of Its Various Targets in the Developing Hindbrain According to Multiple Modes
J. Biol. Chem.,
April 17, 2009;
284(16):
10831 - 10840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Fustin, H. Dardente, G. C. Wagner, D. A. Carter, J. D. Johnston, G. A. Lincoln, and D. G. Hazlerigg
Egr1 involvement in evening gene regulation by melatonin
FASEB J,
March 1, 2009;
23(3):
764 - 773.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. H. Baloh, A. Strickland, E. Ryu, N. Le, T. Fahrner, M. Yang, R. Nagarajan, and J. Milbrandt
Congenital Hypomyelinating Neuropathy with Lethal Conduction Failure in Mice Carrying the Egr2 I268N Mutation
J. Neurosci.,
February 25, 2009;
29(8):
2312 - 2321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. M. Mager, R. M. Ward, R. Srinivasan, S.-W. Jang, L. Wrabetz, and J. Svaren
Active Gene Repression by the Egr2{middle dot}NAB Complex during Peripheral Nerve Myelination
J. Biol. Chem.,
June 27, 2008;
283(26):
18187 - 18197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Felix, M. Magarinos, and F. J. Diaz-Benjumea
Nab controls the activity of the zinc-finger transcription factors Squeeze and Rotund in Drosophila development
Development,
May 15, 2007;
134(10):
1845 - 1852.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. LeBlanc, R. M. Ward, and J. Svaren
Neuropathy-Associated Egr2 Mutants Disrupt Cooperative Activation of Myelin Protein Zero by Egr2 and Sox10
Mol. Cell. Biol.,
May 1, 2007;
27(9):
3521 - 3529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Lawson, R. Tsutsumi, H. Zhang, I. Talukdar, B. K. Butler, S. J. Santos, P. L. Mellon, and N. J. G. Webster
Pulse Sensitivity of the Luteinizing Hormone {beta} Promoter Is Determined by a Negative Feedback Loop Involving Early Growth Response-1 and Ngfi-A Binding Protein 1 and 2
Mol. Endocrinol.,
May 1, 2007;
21(5):
1175 - 1191.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Maudsley, Z. Naor, D. Bonfil, L. Davidson, D. Karali, A. J. Pawson, R. Larder, C. Pope, N. Nelson, R. P. Millar, et al.
Proline-Rich Tyrosine Kinase 2 Mediates Gonadotropin-Releasing Hormone Signaling to a Specific Extracellularly Regulated Kinase-Sensitive Transcriptional Locus in the Luteinizing Hormone {beta}-Subunit Gene
Mol. Endocrinol.,
May 1, 2007;
21(5):
1216 - 1233.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Carter and W. G. Tourtellotte
Early Growth Response Transcriptional Regulators Are Dispensable for Macrophage Differentiation
J. Immunol.,
March 1, 2007;
178(5):
3038 - 3047.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Collins, L. A. Wolfraim, C. G. Drake, M. R. Horton, and J. D. Powell
Cutting Edge: TCR-Induced NAB2 Enhances T Cell Function by Coactivating IL-2 Transcription
J. Immunol.,
December 15, 2006;
177(12):
8301 - 8305.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Srinivasan, G. M. Mager, R. M. Ward, J. Mayer, and J. Svaren
NAB2 Represses Transcription by Interacting with the CHD4 Subunit of the Nucleosome Remodeling and Deacetylase (NuRD) Complex
J. Biol. Chem.,
June 2, 2006;
281(22):
15129 - 15137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. LeBlanc, S.-W. Jang, R. M. Ward, L. Wrabetz, and J. Svaren
Direct Regulation of Myelin Protein Zero Expression by the Egr2 Transactivator
J. Biol. Chem.,
March 3, 2006;
281(9):
5453 - 5460.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kumbrink, M. Gerlinger, and J. P. Johnson
Egr-1 Induces the Expression of Its Corepressor Nab2 by Activation of the Nab2 Promoter Thereby Establishing a Negative Feedback Loop
J. Biol. Chem.,
December 30, 2005;
280(52):
42785 - 42793.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Li, J. Carter, X. Gao, J. Whitehead, and W. G. Tourtellotte
The Neuroplasticity-Associated Arc Gene Is a Direct Transcriptional Target of Early Growth Response (Egr) Transcription Factors
Mol. Cell. Biol.,
December 1, 2005;
25(23):
10286 - 10300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-G. Yoo and M.-O. Lee
Hepatitis B Virus X Protein Induces Expression of Fas Ligand Gene through Enhancing Transcriptional Activity of Early Growth Response Factor
J. Biol. Chem.,
August 27, 2004;
279(35):
36242 - 36249.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Jorgensen, C. C. Quirk, and J. H. Nilson
Multiple and Overlapping Combinatorial Codes Orchestrate Hormonal Responsiveness and Dictate Cell-Specific Expression of the Genes Encoding Luteinizing Hormone
Endocr. Rev.,
August 1, 2004;
25(4):
521 - 542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. L. Gillian and J. Svaren
The Ddx20/DP103 Dead Box Protein Represses Transcriptional Activation by Egr2/Krox-20
J. Biol. Chem.,
March 5, 2004;
279(10):
9056 - 9063.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. L. Luciano and A. C. Wilson
HCF-1 Functions as a Coactivator for the Zinc Finger Protein Krox20
J. Biol. Chem.,
December 19, 2003;
278(51):
51116 - 51124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Modur, R. Nagarajan, B. M. Evers, and J. Milbrandt
FOXO Proteins Regulate Tumor Necrosis Factor-related Apoptosis Inducing Ligand Expression. IMPLICATIONS FOR PTEN MUTATION IN PROSTATE CANCER
J. Biol. Chem.,
November 27, 2002;
277(49):
47928 - 47937.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yuen, E. Wurmbach, B. J. Ebersole, F. Ruf, R. L. Pfeffer, and S. C. Sealfon
Coupling of GnRH Concentration and the GnRH Receptor-Activated Gene Program
Mol. Endocrinol.,
June 1, 2002;
16(6):
1145 - 1153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Carleton, M. C. Haks, S. A. A. Smeele, A. Jones, S. M. Belkowski, M. A. Berger, P. Linsley, A. M. Kruisbeek, and D. L. Wiest
Early Growth Response Transcription Factors Are Required for Development of CD4-CD8- Thymocytes to the CD4+CD8+ Stage
J. Immunol.,
February 15, 2002;
168(4):
1649 - 1658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Wurmbach, T. Yuen, B. J. Ebersole, and S. C. Sealfon
Gonadotropin-releasing Hormone Receptor-coupled Gene Network Organization
J. Biol. Chem.,
December 7, 2001;
276(50):
47195 - 47201.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Zhang, M. W. Wolfe, and M. S. Roberson
An Early Growth Response Protein (Egr) 1 cis-Element Is Required for Gonadotropin-releasing Hormone-induced Mitogen-activated Protein Kinase Phosphatase 2 Gene Expression
J. Biol. Chem.,
November 30, 2001;
276(49):
45604 - 45613.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Dzialo-Hatton, J. Milbrandt, R. D. Hockett Jr., and C. T. Weaver
Differential Expression of Fas Ligand in Th1 and Th2 Cells Is Regulated by Early Growth Response Gene and NF-AT Family Members
J. Immunol.,
April 1, 2001;
166(7):
4534 - 4542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Levkovitz, K. J. O'Donovan, and J. M. Baraban
Blockade of NGF-Induced Neurite Outgrowth by a Dominant-Negative Inhibitor of the Egr Family of Transcription Regulatory Factors
J. Neurosci.,
January 1, 2001;
21(1):
45 - 52.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|