|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 275, Issue 14, 10256-10264, April 7, 2000
From the Institute of Cell Biology, ETH-Zürich
Hönggerberg, CH-8093 Zürich, Switzerland
Myomesin is a structural component of the M-band
that is expressed in all types of striated muscle. Its primary function
may be the maintenance of the thick filament lattice and its anchoring to the elastic filament system composed of titin. Different myomesin isoforms have been described in chicken and mice, but no particular function has been assigned to them. Here we investigate the
spatio-temporal expression pattern of myomesin isoforms by means of
reverse transcriptase-polymerase chain reaction and isoform-specific
antibodies. We find that two alternative splicing events give rise to
four myomesin isoforms in chicken contrary to only one splicing event
with two possible isoforms in mice. A splicing event at the C terminus
results in two splice variants termed H-myomesin and S-myomesin, which
represent the major myomesin species in heart and skeletal muscle of
avian species, respectively. In contrast, in mammalian heart and
skeletal muscle only S-myomesin is expressed. In embryonic heart of
birds and mammals, alternative splicing in the central part of the
molecule gives rise to the isoform that we termed EH-myomesin. It
represents the major myomesin isoform at early embryonic stages of
heart but is rapidly down-regulated around birth. Thus, the strict
developmental regulation of the EH-myomesin makes it an ideally suited
marker for embryonic heart.
Striated muscles are characterized by a very precise organization
of contractile proteins into repeating structural subunits, the
sarcomeres. A sarcomere is defined as the region between two Z-discs
that anchor the thin (actin) filaments, with the thick (myosin)
filaments being anchored in the center via a structure called the
M-band. Elastic filaments composed of the giant protein titin stretch
from the Z-disc to the M-band and may serve as a template for
sarcomeric assembly and to maintain resting tension during the
contraction cycle (for a review see Ref. 1). Despite the striking
similarity at the level of the electron microscope (2, 3), the
different types of striated muscle are characterized by distinct
contractile properties. These adaptations to specific physiological
requirements are associated with an isoform diversity of sarcomeric
proteins (4). Different isoforms either arise from several genes (5) or
from different transcripts of the same gene that are generated either
by alternative splicing of the primary transcript (6-9) or by
alternative initiation of protein synthesis (10). Many isoforms show a
tissue and developmental stage-specific expression pattern (11), but so
far, only a few of the regulatory sequences involved have been identified.
It has recently been demonstrated that myomesin, an integral component
of the M-band, is also expressed in several isoforms (8, 12). Myomesin
is present in all kinds of vertebrate striated muscle and is thought to
play an important role in the integration of thick filaments with
titin, a hypothesis based on its ability to bind both proteins in
vitro (13). Studies of myofibrillogenesis in developing chicken
heart have shown that myomesin becomes localized in its characteristic
pattern simultaneously with the appearance of the first sarcomeres
(14).
The first indications that myomesin may be expressed in several
isoforms resulted from the observation that immunoblots of chicken
heart and skeletal muscle show bands of different molecular weight
(15). Subsequently, two transcripts of different sizes were detected in
chicken heart and skeletal muscle (8). The two isoforms differ only at
their respective C termini, whereas the major part of the protein,
which consists of a unique head domain followed by a conserved pattern
of immunoglobulin-like and fibronectin type III domains, is identical.
The smaller skeletal muscle isoform (with a calculated molecular mass
of 174 kDa) is homologous to mammalian myomesin, whereas the bigger
heart isoform (calculated molecular mass 182 kDa) includes an
additional unique domain at the C terminus. These isoforms designated
as S-1 and H-myomesin are schematically represented in Fig.
1.
Myomesin shares its modular structure with two other M-band associated
proteins, M-protein and skelemin. All three proteins are closely
related and have a common ancestor in evolution (16). The nearest
relative of myomesin is skelemin, which was originally described as a
protein localized at the periphery of the M-band in mouse skeletal
muscle (17, 18). It has recently been shown that skelemin is yet
another splice variant of myomesin that is characterized by the
insertion of a serine/proline-rich domain between domains My6 and My7
(12). The position of this alternatively spliced domain marked as
EH-segment is depicted in Fig. 1.
However, the existence of an avian (chicken) counterpart to skelemin
has not yet been confirmed, and the functional role of this myomesin isoform remains obscure.
In order to understand the significance of this myomesin isoform
diversity in greater detail, we have investigated the expression pattern of different myomesin isoforms in vertebrates using a combination of RT-PCR analysis and isoform-specific antibodies. Our
results indicate that in chicken two alternative splicing events give
rise to four myomesin isoforms, whereas in mammals, a single splicing
event leads to only two isoforms. The expression of the different
isoforms is strictly regulated in a tissue-specific and developmental
stage-specific manner. In addition, we have identified a myomesin
isoform that is specifically expressed during embryonic heart
development in vertebrates, which we have termed EH (embryonic
heart)-myomesin.
RT-PCR Analysis--
Chicken embryos were staged according to
Hamburger and Hamilton (19). Timed pregnant mice were obtained from the
C57BL strain (Life Technologies, Inc.). The day of the detection of the
vaginal plug was considered as embryonic day 0.5. Total RNA was
isolated from heart, leg, and brain of chicken and mouse embryos using the SV Total RNA isolation system (Promega, Wallisellen, Switzerland). RT-PCR was carried out on approximately 1 µg of total RNA with the
Access RT-PCR system (Promega) using the standard RT-PCR protocol suggested by the manufacturer (45 min of reverse transcription followed
by 40 amplification cycles). Primers specific for different chicken
myomesin isoforms were derived from the chicken myomesin sequence (8).
The approximate positions of all primer sets are shown in Fig.
1a. Primer sequences were as follows and are denoted
5'-3'.The forward primers used are as follows: P1,
GGAAGAACGTCAGCTTCACC; P3, TTTGATGAAGCCTTTGCCGAGTTCC; and P5,
GGGAACCATGCAACAACAATC. The reverse primers used are as follows: P2,
TTCCTGTTGTGGTTTGCTC; P4, CCAAAATCTCCCCCACGCTTTTGTT; and P6,
TCCCAGGAACACCACCAATC. Primers used for the amplification of the central
fragment of mouse myomesin were derived from the mouse skelemin
sequence (18) and are as follows: forward primer, GGCAAAATCATCCCAAGTAG;
reverse primer, ATAATAGCCTGTAATCTCTGC. The specificity of primers
was confirmed by sequencing of PCR products. Primers specific for
chicken and mouse Expression of Recombinant Myomesin Fragments--
The H-segment
of chicken myomesin was amplified from the original cDNA clone (8)
and subcloned into the BamHI site of the bacterial
expression plasmid pGEX-2T (Amersham Pharmacia Biotech). The EH-segment
of chicken myomesin including parts of the surrounding fibronectin type
III domains was amplified by RT-PCR from HH38 (Hamburger-Hamilton stage
38) embryonic chicken total RNA, subcloned into the EcoRI
and XbaI sites of Bluescript II KS(+) (Stratagene, Amsterdam, Netherlands), and verified by sequencing. Subsequently, the
EH-segment was amplified by PCR and subcloned into the BglII and EcoRI sites of pGEX-2T. The two recombinant fragments
(H- and EH-segments) were expressed in the Escherichia coli
strain BL-21, and soluble glutathione S-transferase fusion
proteins were purified from crude bacterial lysates by affinity
chromatography on glutathione-agarose (Sigma, Buchs, Switzerland). The
purity and integrity of the recombinant proteins were monitored by
SDS-polyacrylamide gel electrophoresis.
Antibodies--
Antibodies against recombinant myomesin
fragments were generated by immunizing adult female rabbits either with
the H-segment or the EH-segment fused to glutathione
S-transferase. Antibody against the S-segment was generated
by immunizing rabbits with a synthesized 20-mer peptide coupled to
keyhole limpet hemocyanin (ANAWA, Zurich, Switzerland; immunization
performed by Eurogentec, Seraing, Belgium). A standard immunization
scheme was used for all rabbits (20). As soon as strong and specific
responses were detected, the animals were sacrificed, and sera were
collected. The IgG fraction was prepared by ammonium-sulfate
precipitation, and the specificity of the antibodies was further characterized.
The monoclonal mouse anti-myomesin antibody (clone B4) was
characterized in our laboratory (34). The monoclonal anti-sarcomeric SDS-Polyacrylamide Gel Electrophoresis and
Immunoblotting--
Tissue samples (brain, gizzard, heart, and
skeletal muscle) were carefully dissected from the animal, homogenized
by freeze-slamming, resuspended in a modified version of SDS-sample
buffer (3.7 M urea, 134.6 mM Tris, pH 6.8;
5.4% SDS; 2.3% Nonidet P-40; 4.45% Cell Culture and Immunostaining--
Hearts from 11-day-old
chicken embryos were digested with collagenase (108 units/ml,
Worthington) in ADS buffer (116 mM NaCl, 20 mM
HEPES, 0.8 mM NaH2PO4, 1 g/liter
glucose, 5.4 mM KCl, 0.8 mM MgSO4;
pH 7.35) and cultured as described (23). Cells were plated onto dishes
coated with fibronectin in plating medium (67% Dulbecco's modified
Eagle's medium, 17% Medium M199 (Amimed AG, Basel, Switzerland), 10%
horse serum, 5% fetal calf serum and 1% penicillin/streptomycin (Life
Technologies, Inc.)). After 1 day the medium was replaced with
maintenance medium (78% Dulbecco's modified Eagle's medium, 20%
Medium M199, 1% penicillin/streptomycin, 1% horse serum, and
10
For preparation of the skeletal muscle cell cultures, the breast
muscles of 11-day-old chicken embryos were dissociated mechanically in
the absence of Ca2+ by using a vortex. Cells were plated
with a density of 105/ml medium onto dishes coated with
0.1% gelatin in plating medium (M199, 10% horse serum, 2% chicken
embryo extract, 1% L-glutamine, and 1%
penicillin/streptomycin).
For immunofluorescence staining, 4-day-old cultures were fixed with 4%
paraformaldehyde in PBS for 15 min at room temperature, blocked with
0.1 M glycine in PBS for 5 min, and permeabilized in 0.2%
Triton X-100/PBS for 10 min. After blocking with 5% normal (pre-immune) goat serum and 1% bovine serum albumin in PBS for 20 min,
primary antibodies were added and incubated for 1 h at room
temperature. After washing with PBS, secondary antibodies were added
for 45 min. The specimens were washed in PBS and mounted in 0.1 M Tris-HCl, pH 9.5, glycerol (3:7) containing 50 mg/ml n-propyl gallate as anti-fading reagent (24).
Frozen Sections of Chicken Embryos--
Fertilized eggs from
White Leghorn hens (Hungerbühler, Flawil, Switzerland) were
incubated at 37 °C for about 7 days. Embryos were removed from the
eggs, transferred into cold PBS, and staged according to Hamburger and
Hamilton (19). After an overnight incubation in 30% sucrose in PBS,
the embryos were frozen in liquid nitrogen and stored at Microscopy--
Images were recorded with a Leica inverted
microscope DM IRB/E connected to a Leica true confocal scanner TCS NT.
Leica PL APO 100×/1.4 oil or PL APO 63×/1.4 oil immersion objectives
were used. The system was equipped with an argon/krypton mixed gas laser. Image processing was done on a Silicon Graphics workstation using the image processing software "Imaris" (Bitplane AG, Zurich, Switzerland) (25). The fluorescence images of the frozen sections were
recorded on an inverted microscope (Zeiss, Oberkochen, Germany) with an
attached CCD camera (Kappa, Videotec AG, Switzerland) using an
Achrostigmat 5×/0.12 objective.
Sequence Analysis--
GenBankTM release 112.0 was
searched using the Blast program (26) at the National Center for
Biotechnology Information. Sequence alignments were performed using the
MegAlign software (DNASTAR Inc, Madison, WI). Protein motif predictions
were done with the software Motif. The EST clone AA248352 was a kind
gift of Dr. C. C. Liew (Toronto, Ontario, Canada). The nucleotide
sequences of chicken and human EH-segments have been deposited in the
GenBankTM data base with accession numbers AF185572 and
AF185573, respectively.
The Expression of Myomesin Isoform mRNA in Chicken Is Tissue-
and Developmental Stage-specific--
To study whether myomesin
isoform mRNA transcripts are expressed in a tissue- and
stage-specific manner, we performed RT-PCR analysis on total RNA
isolated from chicken heart and skeletal muscles at different
developmental stages (Fig. 2). By using the primers P1 and P2 located
in the C-terminal H-segment of myomesin (Fig.
1), a 236-bp product was amplified from
heart extracts of different embryonic stages, as well as from hatching
stage and adult hearts (Fig.
2a, lanes 1-5). By
contrast, no product was observed in RNA samples prepared from
identical stages of skeletal muscle or adult brain (Fig. 2a,
lanes 6-10). These results are consistent with earlier
findings indicating that the expression of this isoform mRNA in
chicken is restricted to the heart (8). Therefore, we will refer to
this isoform as H (heart)-myomesin, carrying the H-segment at the C
terminus.
By using a primer pair specific to the C-terminal sequence found in the
skeletal isoform of myomesin (primers P3 and P4 in Fig. 1), a product
of 434 bp was amplified from both heart and skeletal muscle samples
(Fig. 2b, lanes 1-5 and 6-9,
respectively); however, the intensity of the bands obtained from heart
samples was found to be somewhat weaker than those from the skeletal
muscle samples (Fig. 2b, lanes 1-5). Therefore,
the isoform mRNA transcript previously termed "skeletal
muscle-specific" (8) is expressed in both types of striated muscle in
chicken, but its expression level is lower in the heart. This isoform
is referred to as S (skeletal)-myomesin because it is mainly found in
chicken skeletal muscle, and the short sequence added to the C terminus
by alternative splicing is referred to as S-segment (see Fig. 1).
The analysis of cDNA and genomic sequences of mouse myomesin has
shown that alternative splicing of an exon located between fibronectin
type III domains My6 and My7 gives rise to another isoform that has
been termed skelemin (12, 18). However, no such isoform had been
previously reported in chicken (8) or human myomesin (27). To check
this, we designed the primers P5 and P6, located in domains My6 and My7
of myomesin, which flank the alternatively spliced segment (Fig.
1a). Surprisingly, we found that the isoform mRNA
containing the alternatively spliced segment is not only present in
chicken but that its expression is developmentally regulated. At early
embryonic stages a product of 636 bp, corresponding to the transcript
that includes the alternatively spliced exon, was observed in heart,
and a product of 327 bp was found at later stages (Fig. 2c).
The size of the latter product corresponds to a myomesin isoform
mRNA lacking the alternatively spliced segment between domains My6
and My7 as described previously (8). In the hearts of hatching stage
embryos and in adult chicken, the 636-bp product was completely
replaced by the 327-bp product (Fig. 2c). In order to
confirm the presence of the alternatively spliced segment, the 636-bp
product was cloned and sequenced, revealing a sequence stretch of 103 amino acids that was inserted between domains My6 and My7 of chicken
myomesin. Sequence comparison with the alternatively spliced exon 17a
of mouse skelemin (12) showed a high homology (see below and Fig. 10),
thus confirming the presence of this alternative splice variant in
chicken. Interestingly, RT-PCR analysis of chicken skeletal muscle
samples of different stages using the primer pair P5 and P6 gave rise
to the 327-bp product only (Fig. 2c). Neither product could
be amplified from adult brain (Fig. 2c). Thus, the
alternatively spliced domain between My6 and My7 is only included in
myomesin that is expressed in pre-natal stages of chicken heart. We
therefore termed this isoform EH (embryonic heart)-myomesin, since it
contains the EH-insertion.
Generation of Isoform-specific Antibodies--
In order to
investigate the expression of different myomesin isoforms in chicken at
the protein level, we generated isoform-specific polyclonal antibodies
in rabbits. The following parts of myomesin were used as immunogens:
the S- and H-segments at the C terminus of myomesin and the EH-segment.
Accordingly, the antibodies were named anti-S, anti-H, and anti-EH (see
Fig. 1). The specificity of the antibodies was checked by immunoblot
analysis of chicken tissue extracts (Fig.
3). The anti-H antibody recognized a
protein with a molecular mass of about 190 kDa in extracts of adult
chicken heart and did not react with extracts of skeletal muscle (Fig. 3a). The anti-S antibody recognized a protein of about 180 kDa in skeletal muscle extracts but did not react with heart extracts (Fig. 3b). Although the RT-PCR analysis indicated that some
amounts of the S-myomesin isoform mRNA are indeed accumulated in
chicken heart, no protein product was detected suggesting that
expression of S-myomesin protein in the heart is too low to be detected
by immunoblotting if normal exposure times are used. The anti-EH antibody recognized a protein of almost 200 kDa in extracts of embryonic chicken heart and did not react with skeletal muscle extracts
(Fig. 3c). The molecular weights of the myomesin isoforms determined by immunoblotting are in good agreement with the calculated sizes for S- (174 kDa), H- (182 kDa) and EH-myomesin (192 kDa) (8).
Note that the expression of all three myomesin isoforms is restricted
to striated muscle and that none of the antibodies reacted with smooth
muscle (gizzard extract) or non-muscle tissue (brain extract).
To confirm further their specificities, the antibodies were tested by
immunofluorescence staining of cultured chicken embryonic cardiomyocytes (Fig. 4, a-f)
and skeletal muscle cells (Fig. 5, g-l). All three isoform-specific antibodies label the
M-band of the sarcomeres as demonstrated by the antiperiodic staining
obtained with a monoclonal antibody against sarcomeric
The anti-S antibody specifically stains chicken skeletal myotubes (Fig.
4i) and, although more weakly, also cardiomyocytes (Fig.
4c). We believe that this staining is specific because the RT-PCR results already pointed to an expression of S-myomesin in
chicken heart (see Fig. 2a). The staining obtained with the anti-S antibody on cardiomyocytes was very weak, so that the signal had
to be amplified by image processing resulting in some nonspecific background (e.g. weak nuclear staining in Fig.
4c).
The anti-EH antibody reacts exclusively with embryonic chicken
cardiomyocytes (Fig. 4e) but not with embryonic chicken
skeletal muscle cells (Fig. 4k).
These stainings confirm that all antibodies specifically recognize the
respective myomesin isoforms in the M-band. In addition, it can be
concluded that in cultured skeletal muscle cells only S-myomesin is
present, whereas all three different isoforms are co-expressed in
cultured embryonic cardiomyocytes. Since sarcomeric The Isoform Expression Pattern in the Chicken Embryo Is
Tissue-specific--
By having established the specificity of the
generated antibodies and the localization of their corresponding
antigens, we analyzed the distribution of myomesin isoforms in
situ during embryonic development. Cryosections of stage 29 chicken embryos were stained with isoform-specific antibodies in
combination with antibodies against sarcomeric The Expression of H-myomesin Is a Characteristic Feature of Avian
Cardiac Tissue--
H-myomesin is expressed in the heart of chicken
throughout all stages of development. To investigate whether the
presence of this distinct isoform in heart is a common feature of avian species, we performed immunoblotting on heart and skeletal muscle extracts of goose, pigeon, and ostrich with antibodies against chicken
myomesin isoforms (Fig. 6). Of these
three species the goose is the closest, the pigeon is more distant, and
the ostrich is the most distant species (among currently living birds)
from the chicken in the evolutionary tree (28). The anti-H and anti-S antibodies were used together with the antibody B4 that recognizes an
epitope in the domain My12 (see Fig. 1b) and therefore
cross-reacts with all myomesin isoforms. Surprisingly, the anti-H
antibody does not react with the heart extracts of the majority of the birds that were tested, with the notable exception of a weak reaction visible in the extract from goose, which is closely related to chicken
(Fig. 6). In contrast, the anti-S antibody reacts with the skeletal
muscle extracts of all birds investigated, indicating that among avian
species, the S-segment is much more conserved than the H-segment.
However, the fact that the anti-S antibody does not react with any of
the heart extracts clearly shows that the C terminus of avian
H-myomesin differs from that of S-myomesin. This observation is
confirmed by immunoblots with the B4 antibody showing that the
mobilities between heart and skeletal muscle myomesin differ in all
avian species investigated (Fig. 6). These results indicate that all
birds seem to express an isoform of higher molecular weight in the
heart and that the higher molecular weight is probably due to the
presence of an alternatively spliced domain at the C terminus.
Nevertheless, the sequence of this H-segment is not conserved between
distantly related avian species as shown by the lack of
cross-reactivity with the anti-H antibodies.
Only One Myomesin Isoform Can Be Detected in Striated Muscle of
Adult Mammals and Reptiles--
The finding that a heart-specific
isoform of myomesin is present in all avian species that we
investigated raises the question whether such an isoform may also be
present in the hearts of mammalian species. We consequently analyzed
the reactivity of heart and skeletal muscle extracts of several
vertebrates using all available antibodies against myomesin (Fig.
7). Of these extracts, only chicken heart
showed a specific reaction with the anti-H antibody (data not shown).
This was to be expected since the epitope is not conserved between
birds of different species (see Fig. 6). In contrast, the anti-S
antibody reacts strongly with both heart and skeletal extracts of
several mammals and a reptile species (lizard), yielding bands of the
same apparent molecular weight (Fig. 7). From these results, we
conclude that in these species, only one isoform appears to be
expressed in both adult heart and skeletal muscle. We also tested two
lower vertebrates, frog and fish, but no specific staining was observed
when using the anti-S antibody (data not shown). Obviously, these
species have C termini that differ from those found in higher
vertebrates. For the study of evolutionary distantly related species,
the antibody My190-Nrt, which was generated against the head domain of
human myomesin (21), proved to be more effective. Despite the fact that
the head domain sequence is rather heterogeneous between vertebrates (8), the antibody My190-Nrt recognizes myomesin in all vertebrate muscle extracts tested, although very weakly in fish (Fig. 7). In heart
and skeletal muscle extracts of mammals and reptiles, the My190-Nrt
antibody recognized the same bands of identical molecular weight as the
anti-S antibody, which suggests that these species express only the
S-myomesin isoform in their heart and skeletal muscles. However, in
skeletal muscle extracts of chicken, frog, and trout, the myomesin
isoform detected was apparently smaller than in the corresponding heart
extracts. Since none of the antibodies generated against the
alternatively spliced segments of myomesin reacts with extracts of
these species, we do not know whether the difference in mobility is due
to a splicing event or due to a posttranslational modification of
myomesin. Despite the fact that the C-terminal sequence appears to be
variable among lower vertebrates, the molecular weight of myomesin
remains roughly the same from fish to mammalian muscles.
The Expression of EH-myomesin in Heart Is Developmentally
Regulated--
The results of our RT-PCR analysis indicate that there
is a change in myomesin isoform expression during embryonic heart
development. In order to confirm that this is also the case at the
protein level, we performed immunoblots on chicken heart and skeletal muscle tissue of different developmental stages using our
isoform-specific antibodies (Fig. 8).
With the anti-H antibody, we detected a shift of molecular weight for
H-myomesin in heart extracts of different stages of development. In
embryonic hearts a high molecular weight band was predominant, and at
hatching stage, it becomes replaced by a lower molecular weight band
(Fig. 8, row H, lanes 1-6). A similar shift in molecular
weight of S-myomesin is detected by the anti-S antibody on heart
extracts (Fig. 8, row S, lanes 1-6). Thus, at early stages, H-myomesin and S-myomesin are co-expressed in the developing heart, with the level of S-myomesin being significantly lower since the immunoblot had to be overexposed in order to reveal the
signal for S-myomesin. A rough comparison of the band intensities obtained from heart and skeletal extracts indicates that the expression level of S-myomesin in heart is at least 1 order of magnitude lower
than in skeletal muscle (data not shown). In skeletal muscle S-myomesin
is the only isoform expressed at every developmental stage. Also, there
is no transition in molecular weight (Fig. 8, row S, lanes
8-11).
Immunoblots with the anti-EH antibody reveal that, at the early
developmental stages, the upper band of the doublet is due to an
inclusion of the EH-segment. Because of the low abundance of the
S-myomesin only the H-myomesin containing the EH-segment is visible on
the blot (Fig. 8, row EH, lanes 1-6). At the time of birth
the reactivity with the anti-EH antibody decreases, and only a very
weak signal can be detected in the adult heart (Fig. 8, row EH,
lane 7). Comparison of rows H, S, and EH
suggests that the co-expressed isoforms, the high abundant H-myomesin
as well as the low abundant S-myomesin, include the EH-segment during early embryonic heart development but that this segment is spliced out
at the time of hatching. No signal can be detected with the anti-EH
antibody in skeletal muscle at any stage (Fig. 8, row EH, lanes
8-11). Immunoblots with the general My190-Nrt antibody confirm
these results, since a similar transition to lower molecular weight was
detected in the same heart extracts (Fig. 8, row My-N, lanes
1-7) but not in skeletal muscle (lanes 8-11). Note
that this antibody only reveals the H-myomesin but not S-myomesin in the heart, since its expression is too low to be detected at this exposure time. Therefore, the inclusion of the EH-segment into the
different myomesin isoforms, referred to as EH-myomesin, seems to be
characteristic for embryonic chicken heart.
To determine whether the EH-myomesin isoform is also expressed in
embryonic hearts of mammalian species, we analyzed mouse hearts of
different developmental stages by RT-PCR (Fig.
9a) and immunoblotting (Fig.
9b). In embryonic mouse heart two amplification products
were observed with primers located in domains My6 and My7 of myomesin
(Fig. 9a, lanes 1 and 2). The upper band
completely disappears at the time of birth and at adult stages (Fig.
9a, lanes 3 and 4, respectively) and also cannot
be detected in skeletal muscles of any stage. Immunoblot analysis
confirms that the upper band is due to the inclusion of the EH-segment.
In embryonic mouse heart a high molecular weight band is recognized
both by the antibody My190-Nrt and the anti-EH antibody (Fig. 9b,
lanes 1 and 2). Around birth, a second band of lower
molecular weight appears (Fig. 9b, lane 3). In adult heart,
as well as in skeletal muscle, this is the only detectable isoform
(Fig. 9b, lanes 4 and 5-7). This isoform does
not contain the EH-segment since it is not recognized by the anti-EH
antibody. Thus, we conclude that the presence of an embryonic isoform
of myomesin in heart, termed EH-myomesin, is characteristic for avian
as well as for mammalian species and is therefore a universal marker
for embryonic heart.
By searching the EST data base (29) using the sequence of the mouse
EH-segment, we were able to identify one human EST clone (GenBankTM accession number AA248352) which was originally
isolated from a cDNA library of human fetal heart. Sequencing
indicates that this clone represents the complete sequence of the human
EH-segment. The deduced amino acid sequence is aligned with the mouse
and chicken EH-segment (Fig. 10). The
highest homology occurs between the human and mouse EH sequences (65%
identity and 76% similarity), whereas the chicken sequence is more
divergent (36% identity and 48% similarity compared with mouse). The
presence of the EH-segment in a human EST clone originating from a
fetal heart library clearly confirms our RT-PCR and immunoblot data for
chicken and mouse and suggests that the expression of EH-myomesin can
indeed serve as a marker for embryonic heart.
The spatio-temporal expression pattern of different myomesin
isoforms in birds as well as in mammals was established using RT-PCR,
immunofluorescence, and immunoblot analysis. Our results indicate that
the smallest myomesin isoform namely S-myomesin seems to be able to
fulfil the basic function of the myomesin molecule, since it is the
only myomesin isoform expressed in striated muscle of adult mammals,
reptiles, and also in avian skeletal muscle. The alternatively spliced
H-segment at the C terminus gives rise to H-myomesin which represents
the major myomesin species in avian cardiac muscle. Inclusion of the
EH-segment in the central part of the myomesin molecule leads to the
EH-myomesin isoform, which is characteristic for the embryonic heart of
mammals and birds.
We find that the C-terminal splice variant H-myomesin is expressed in
hearts of all tested bird species. This isoform has a higher molecular
weight and does not react with the anti-S antibody that could detect
S-myomesin in skeletal muscle extracts from the same species. Quite
surprisingly, the anti-H antibody did not react with other H-myomesins
except with the closely related goose protein. Thus the primary
sequence of the H-segment is not conserved between different avian
species, but the heart specificity of the splice machinery must remain
intact and thus allow the successful splicing. We speculate that the
presence of the H-segment determines mechanical or biochemical
properties of myomesin in avian cardiac muscle that are preserved in
the diverging primary sequences. A similar observation was made in the
case of the myomesin head domain. According to biochemical data the
head domain contains a myosin-binding site (13, 31), but at the same
time its sequence differs significantly from one species to another
(8).
At present it is still not clear whether H-myomesin is accumulated in
other vertebrate species. In the closest relatives of birds, reptiles,
and mammals, only S-myomesin is expressed in both heart and skeletal
muscles. Thus, the appearance of H-myomesin may be part of adaptive
mechanisms that arose after birds evolved from reptiles. However, going
further down the evolutionary tree we find that myomesin isoforms of
heart and skeletal muscle in amphibian and fish differ in their
apparent molecular masses. In this case we could not establish whether
this difference is due to an additional C-terminal segment because
neither the anti-S antibody nor the anti-H antibody reacted with
extracts of these species. Different mobility might also be due to
other splicing events or to posttranslational modifications such as
phosphorylation. To clarify whether the difference in molecular weight
is indeed due to an additional C-terminal segment, the sequences of the myomesins of reptiles, amphibian, or fish species have to be compared. In addition to H-myomesin, minor amounts of S-myomesin can be detected
in chicken heart; however, we believe that this is due to the leakage
of the splicing mechanism and that S-myomesin does not play a major
functional role in cardiac muscle of the chicken.
During embryonic development a specific myomesin isoform is expressed
in heart that is characterized by the inclusion of the EH-segment.
Sequence comparison showed that EH-myomesin corresponds exactly to a
mouse splice variant of myomesin, previously called "skelemin" (12,
17), including a serine/proline-rich sequence between domains My6 and
My7, which we have termed EH-segment. We could now show that this
splice variant exists also in chicken and man. However, we were unable
to detect myomesin isoforms containing the EH-segment either by RT-PCR
or by immunoblotting in skeletal muscle at any developmental stage,
which is in contradiction with the fact that the mouse skelemin
cDNA was cloned from adult skeletal muscle (18). A possible
explanation might be the insufficient sensitivity of our RT-PCR
analysis to detect minor amounts of EH-segment containing transcripts
present in skeletal muscle or that there is some expression of
EH-myomesin in regenerating muscles.
Several functions have been proposed for skelemin as follows: first it
was suggested that it might act as a linker between intermediate
filaments and the M-band (18); second an interaction of skelemin and
In contrast to H-myomesin, which was found only in avian cardiac
muscle, the EH-isoform of myomesin is present in the developing heart
of both mammals and birds. Therefore, EH- myomesin could serve as an
invaluable marker for the embryonic vertebrate heart, because no other
myofibrillar protein expression is restricted to embryonic heart in
such a tightly controlled manner (4). Sequence analysis showed that the
EH-segments of mouse and human are rather similar, whereas the chicken
EH-segment amino acid sequence is more divergent with only 36%
identity and 48% similarity between the chicken and mouse EH-segments.
This is a relatively small value as opposed to the 75% identity of the
rod portion of myomesin, consisting of immunoglobulin and fibronectin
domains (8). Both mouse and human EH-segments are rich in
serine/proline residues, hence the original name serine/proline rich
domain, but this feature does not seem to be essential since the
chicken counterpart contains fewer serine and proline residues, making it resemble an immunoglobulin-like domain much more closely. Despite the rather low sequence homology between mammals and birds, analysis of
the secondary structure of all three sequences (Karplus-Schulz algorithm) predicts an increased flexibility of the EH-segment with
regard to the immunoglobulin domains that make up the larger part of
the molecule. In agreement with this prediction, we found that the
circular dichroism spectrum of recombinant chicken EH-segment shows the
characteristics of a largely unfolded protein with residual secondary
structure (data not shown). Therefore, this segment could function as
an additional flexible elastic stretch in the middle part of the
myomesin molecule. The structure of EH-myomesin resembles in this
aspect the structure of titin, which is also made up of two principally
distinct regions, stretches of Ig modules separated by a unique segment
of elusive secondary structure, the PEVK domain (36). The elasticity of
this PEVK-segment allows titin to extend fully reversibly at
physiological forces, without the need to unfold the Ig domains, which
would be catastrophic in beating cardiomyocytes (37, 38).
What can be the physiological need for additional elasticity of the
M-bands in embryonic heart? Embryonic cardiomyocytes differ in
principle from skeletal muscle cells and adult cardiomyocytes by their
ability to divide although already possessing all the contractile
machinery. Presently, it is not clear what happens exactly to the
myofibrillar apparatus during cell division, although there are some
indications of partial disassembly of myofibrils, particularly the
Z-disks (39). However, it was unequivocally demonstrated that some
sarcomeres within isolated cardiomyocytes persist throughout mitosis
(40, 41). Moreover, a recent study indicates that most myosin filaments
remain bundled with myomesin in mitotic myocytes (42). This suggests
that the M-bands in sarcomeres may be exposed to rather strong
mechanical stress during the formation of the cleavage furrow and
separation of the dividing cells. The additional elastic element in the
middle of the myomesin molecule would therefore serve as a safety
device, analogous to the PEVK domain of titin, thus preventing the
irreversible unfolding of Ig domains.
Although our understanding of the functional significance of
EH-myomesin is still incomplete, electron microscopic studies of the
developing heart provide interesting insights. They reveal that heart
sarcomeres acquire their characteristic morphology including an
electron-dense M-band and stringently aligned thick filaments only
around birth (43). The electron-dense M-band has been ascribed to the
presence of muscle creatine kinase (44). Indeed, the appearance of
muscle creatine kinase is correlated with the appearance of an
electron-dense M-line in electron microscopic preparations, but muscle
creatine kinase does not seem to play an essential structural role in
the M-band since the muscle creatine kinase-deficient mouse exhibits no
obvious abnormalities in sarcomeric structure (45). The increasing
order leading to a perfect register of the thick filaments may,
however, be explained by the replacement of the more flexible
EH-myomesin isoform by the adult myomesin, reducing the imprecision of
the thick filament alignment in the M-band. This hypothesis is
corroborated by studies of developing chicken skeletal muscle where no
EH-myomesin is expressed, and perfectly aligned thick filaments in
sarcomeres were observed in muscle of day 12 embryos (46)
The re-expression of embryonic or fetal genes was used as a molecular
marker for hypertrophy (47). Cardiomyocytes from hypertrophic hearts
are often characterized by myofibril disarray, and the sarcomeres are
not as strictly registered as they are in the healthy heart, possibly
indicating the reversion to more embryonic sarcomeric structures.
Preliminary experiments have shown re-expression of EH-myomesin in
cardiomyocytes from muscle LIM protein knock-out mice and from
tropomodulin-overexpressing
mice.2 Interestingly, both
mouse strains show a phenotype of dilated cardiomyopathy (48, 49).
However, future investigations will have to show to what extent the
re-expression of EH-myomesin can be associated with myofibrillar
disarray during other types of pathological hypertrophy.
We are grateful to Dr. Hans M. Eppenberger
for continuing support and to the members of our group for stimulating
discussions. We thank Evelyne Perriard for the primary cultures of
embryonic chicken myocytes and Dr. C. Andreoli for help in expressing
the myomesin fragments in E. coli. The donation of the
polyclonal antibody My-190 Nrt by Dr. Mathias Gautel (EMBL Heidelberg),
Cy5 phalloidin by Prof. Faulstich (EMBL Heidelberg), and the EST clone AA248352 by Dr. C. C. Liew (University of Toronto) is gratefully acknowledged.
*
This work was supported in part by Swiss National Science
Foundation Grant 31.52417/97.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF185573 and AF185572.
§
To whom correspondence should be addressed. Tel.: 0041-1-6333359;
Fax 0041-1-6331069; E-mail jcp@cell.biol.ethz.ch.
2
I. Agarkova, E. Ehler, and J. C. Perriard,
unpublished data.
The abbreviations used are:
S-myomesin, skeletal
muscle myomesin;
H-myomesin, heart myomesin;
EH-myomesin, embryonic
heart-myomesin;
RT-PCR, reverse transcriptase-polymerase chain
reaction;
HH, Hamburger-Hamilton stage;
PBS, phosphate-buffered saline;
bp, base pair..
A Novel Marker for Vertebrate Embryonic Heart, the
EH-myomesin Isoform*
,
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-tubulin were used to standardize the amount of
RNA used in the RT-PCR.
-actinin antibody (clone EA-53) was obtained from Sigma. The polyclonal rat anti-myomesin My190 Nrt antibody (21) was a kind gift of
Dr. Mathias Gautel (Heidelberg, Germany). For immunoblotting, horseradish peroxidase-conjugated anti-mouse Igs (Dako, Zug,
Switzerland), anti-rat Igs (Dako), and anti-rabbit Igs (Calbiochem)
were used as secondary antibodies. For immunofluorescence, secondary
antibodies were fluorescein isothiocyanate-conjugated goat anti-rabbit
IgG (Cappel, West Chester, PA) and Cy3-conjugated goat anti-mouse IgG
(Jackson ImmunoResearch, West Grove, PA). Cy5-conjugated phalloidin was
a generous gift of Prof. H. Faulstich (Heidelberg, Germany).
-mercaptoethanol; 4%
glycerol, and 6 mg/100 ml bromphenol blue (22)), and boiled for 1 min.
SDS samples were run on 6% polyacrylamide minigels (Bio-Rad) together
with broad range molecular weight standards (Bio-Rad). Equal amounts of
protein were loaded for the different tissue extracts as judged by
Coomassie Blue staining of a twin gel. Blotting was carried out
overnight onto nitrocellulose Hybond-C extra (Amersham Pharmacia
Biotech). Unspecific binding sites were blocked with 5% non-fat dry
milk (w/v) in washing buffer (PBS, pH 7.4, 0.3% Tween 20) for 1 h
at room temperature. Primary and secondary antibodies were diluted in
washing buffer supplemented with 1% non-fat milk powder and incubated
for 1 h, respectively, with intermittent washing in washing
buffer. Chemiluminescence reaction was performed according to the
manufacturer's instructions (Amersham Pharmacia Biotech and Pierce)
and visualized on Fuji Medical X-ray films.
4 mol/liter phenylephrine (Sigma)). To reduce the
number of contaminating fibroblasts, glutamine was left out, and
cytosine arabinoside (10 µmol/liter, Sigma) was added to the culture media.
70 °C
until sectioning. 10-µm thick sagittal sections through the whole
embryos were cut on a cryostat (Reichert, Vienna, Austria) and
collected on gelatin-coated glass slides. For immunofluorescence
experiments, the sections were fixed, stained, and mounted as described above.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (9K):
[in a new window]
Fig. 1.
Schematic representation of myomesin
isoforms. a, scheme of the myomesin cDNA. The
position of the alternative EH exon, corresponding to the previously
described Ser/Pro domain of mouse skelemin, is marked by a
triangle. The alternatively spliced S- and H-exons giving
rise to chicken skeletal- and heart-specific myomesin isoforms are
shown at the 3' end. Positions of P1-P6 PCR primers that were used in
this study are indicated by half-arrows. b,
diagram of the myomesin protein. Myomesin is mainly composed of
immunoglobulin-like (ellipses) and fibronectin type III
domains (rectangles). The N-terminal domain has no
homologies to other known proteins. Chicken S- and H-myomesin isoforms
differ in their C terminus; the S-isoform has a short C-terminal
sequence, which is very homologous to the mammalian variant of
myomesin, whereas the H-isoform is characterized by a unique H-segment.
The EH-isoform has an additional EH-segment inserted in the center of
the molecule. Arrows indicate the positions of the epitopes
of the antibodies, which were used in this study.
View larger version (43K):
[in a new window]
Fig. 2.
Expression of myomesin isoform mRNAs in
chicken is tissue- and developmental stage-specific. RT-PCR
analysis of total RNA extracted from chicken tissues of different
developmental stages was performed. Different sets of primers (see Fig.
1) were used to detect H-myomesin (a, primers P1 and P2),
S-myomesin (b, primers P3 and P4), and EH-myomesin
(c, primers P5 and P6). Lanes 1-5, heart
extracts of HH stages 17, 29, 38, hatching, and adult; lanes
6-9, skeletal muscle extracts of HH stages 29, 38, hatching, and
adult; lane 10, brain from hatching stage chicken. Fragment
sizes are indicated on the left in bp. A single product of
236 bp is amplified in heart but not in skeletal muscle tissue using
heart-specific primers (a), whereas skeletal muscle specific
primers give a single product of 434 bp in both kinds of striated
muscle at all stages of development (b). By using primers
specific for the domains flanking the optional domain in the central
part of myomesin, a product of 636 bp corresponding to the EH(+) splice
variant can be amplified in embryonic heart but not in adult heart or
skeletal muscle of any stage (c). Although EH(+) is the only
isoform found in heart at the earliest stages, it is rapidly replaced
around birth by the EH( ) isoform; the latter is represented by the
band of 327 bp. In skeletal muscle a product of 327 bp corresponding to
EH() RNA is amplified at all developmental stages. No product is
amplified from brain of hatching chicken with all sets of primers
specific for chicken myomesin (a-c, lane 10).
The amount of the total RNA loaded on the each line was normalized by
RT-PCR using primers specific for chicken -tubulin (data not
shown).
View larger version (8K):
[in a new window]
Fig. 3.
Specificity of polyclonal antibodies raised
to different myomesin isoforms. Antibodies specific for chicken
H-myomesin (a), S-myomesin (b), and EH-myomesin
(c) isoforms were tested on SDS samples of adult
(a and b) and HH stage 45 embryonic
(c) chicken tissues. Lane H, heart; lane
S, skeletal muscle; lane G, gizzard; lane B,
brain. Molecular mass markers are indicated in kDa. The anti-H antibody
recognizes a band of about 190 kDa in the adult heart extract but not
in skeletal muscle, gizzard, or brain extracts. The anti-S antibody
recognizes a band of about 180 kDa in skeletal muscle extracts but not
in heart, gizzard, and brain extract. The anti-EH antibody recognizes a
band of about 200 kDa in the embryonic heart extract only; it does not
react with embryonic skeletal muscle, gizzard, brain, or any adult
tissue extracts.
-actinin,
which is located in the Z-disc of the sarcomere (Fig. 4,
insets). The anti-H antibody reacts strongly with the M-band
of embryonic chicken cardiomyocytes (Fig. 4a), but an
extremely weak M-band staining is also observed in skeletal muscle
cells (Fig. 4g), possibly due to a cross-reaction of the
heart-specific antibody with S-myomesin which is too weak to be
observed in immunoblots (see Fig. 3). The possibility that the faint
signal in skeletal muscle cells is due to weak cross-reactivity is also
supported by RT-PCR results where no H-isoform mRNA could be
detected in skeletal muscle. Sequence comparisons between the H-segment
and the S-segment identified several short elements consisting of three
or four amino acids that occur in both sequences and that may lead to
cross-reacting epitopes (8).
View larger version (58K):
[in a new window]
Fig. 4.
Immunofluorescent detection of myomesin
isoforms in cultured chicken cardiomyocytes and skeletal muscle
cells. Confocal images of cultured embryonic chicken
cardiomyocytes (a-f) and embryonic chicken skeletal muscle
myocytes (g-l) double-stained with anti-H (a and
g), anti-S (c and i), or anti-EH
(e and k) antibodies and an antibody against
sarcomeric -actinin (b, d, f,
h, j, and l). As shown by the
superimposition of both signals in insets a, c,
e, g, i, and k, all
polyclonal antibodies specifically stain the M-band. The anti-H
antibody reacts specifically with the chicken cardiomyocytes
(a). A weak M-band staining can be seen in skeletal muscle
cells (g) indicating a weak cross-reaction of anti-H
antibody with S-myomesin isoform possibly due to a shared epitope. The
anti-S antibody reacts strongly with skeletal myocytes (i)
and weakly with cardiomyocytes (c). The anti-EH antibody
reacts exclusively with embryonic cardiomyocytes (e) and not
with embryonic skeletal muscle cells (k). The
insets are two times magnified. Bar, 10 µm.
View larger version (66K):
[in a new window]
Fig. 5.
The expression of myomesin isoforms is
tissue-specific in chicken embryos. Charged-coupled device camera
images of HH stage 29 chicken embryo cryosections triple-stained with
anti-H (a), anti-S (d), or anti-EH (g)
antibodies together with antibodies to sarcomeric -actinin
(b, e and h) and phalloidin to
visualize F-actin (c, f, and i).
Arrowheads indicate the position of the heart;
arrows indicate the position of the skeletal muscle anlage
in the vicinity of the heart. The anti-H antibody specifically stains
the heart and no other tissue (a), and the anti-S antibody
strongly stains the first skeletal muscle anlagen and to a smaller
extent the heart (d). The anti-EH antibody specifically
stains the heart and does not react with skeletal muscle or other
tissues (g). Bar, 100 µm.
-actinin is
present in Z-discs throughout the sarcomere, it is also possible to
investigate whether any of the myomesin isoforms is incorporated only
in a subset of sarcomeres within a given cell by comparing the staining
of sarcomeric -actinin with that of the isoform-specific antibodies.
Comparison of the two stainings in Fig. 4 shows that regardless of the
expression level, all three isoform-specific antibodies uniformly stain
the M-bands of all myofibrils in cultured cardiomyocytes. Thus, as
judged by light microscopy, all myomesin isoforms appear to be
incorporated equally well into the M-bands of myofibrils.
-actinin and
phalloidin (Fig. 5). The distribution and relative amounts of different
myomesin isoforms can be estimated here directly by comparing the
staining intensities of heart (arrowheads) and skeletal
muscle anlagen (arrows). The anti-H and anti-EH antibodies
exclusively stain embryonic heart (Fig. 5, a and
g), respectively, whereas the anti-S antibody strongly stains skeletal muscle tissue and, to a weaker extent, the heart (Fig.
5d). No difference in the intensity in which the different types of striated muscles were stained is observed with the antibody against sarcomeric -actinin (Fig. 5, b, e, and
h) or with F-actin staining (Fig. 5, c, f, and
i). These findings confirm the conclusions drawn from the
RT-PCR analysis and the stainings of isolated myocytes, namely that in
embryonic skeletal muscle cells only one myomesin isoform is expressed,
whereas all splice variants of myomesin can be detected in the
embryonic chicken heart.
View larger version (15K):
[in a new window]
Fig. 6.
Different bird species express the H-isoform
of myomesin. Striated muscle extracts of different avian species
were probed by immunoblot with either anti-H (H), anti-S (S)
antibodies, or with an antibody that recognizes all myomesin isoforms
(B4). Equal amounts of muscle proteins from chicken
(lane 1), goose (lane 2), pigeon (lane
3), and ostrich (lane 4) were loaded on an SDS gel. The
chicken anti-H antibody does not react with the heart extracts of other
birds with the exception of goose with which they react, albeit very
weakly (row H). The anti-S antibody reacts with skeletal
muscle extracts of all tested birds, indicating that the skeletal
epitope is conserved to a much higher degree than the heart epitope
among avian species (row S). The general antibody against
myomesin B4 reacts with both myomesin isoforms in all avian species; it
shows that the mobility of the heart and skeletal myomesin isoforms is
different. Thus, it seems that all birds have the C-terminal heart
domain, but its sequence is not conserved between distantly related
avian species.
View larger version (20K):
[in a new window]
Fig. 7.
The H-myomesin isoform is not present in all
vertebrates. Striated muscle samples of different vertebrate
species were probed by immunoblot with anti-S antibody (S)
or an antibody My190-Nrt that recognizes all myomesin isoforms
(My-N). H, proteins extracted from heart;
Sk, proteins extracted from skeletal muscle. In contrast to
birds, only one myomesin isoform can be found in mammalian and
reptilian tissues because the anti-S antibody recognizes myomesin in
both heart and skeletal extracts of mammals and reptiles (row
S). The analysis of the heart and skeletal extracts of different
animals with the general myomesin antibody My190-Nrt (row
My-N) shows that mammals and reptiles have only one myomesin
isoform in the heart and skeletal muscle, whereas the heart myomesin in
birds, amphibians, and fishes has a lower mobility than the skeletal
myomesin from the same species. This suggests that also some lower
vertebrates may possess a heart-specific C-terminal domain
View larger version (24K):
[in a new window]
Fig. 8.
The expression of myomesin isoforms in
chicken is regulated in a tissue- and stage-specific manner.
Striated muscle extracts of chicken at different developmental stages
were probed by immunoblot with either anti-H (H), anti-S
(S), anti-EH (EH) or with the antibody My190-Nrt
that recognizes all myomesin isoforms (My-N). Lanes
1-7, heart extracts of HH stages 17, 29, 34, 38, 44, hatching and
adult; lanes 8-11, skeletal muscle extracts of HH stages
29, 38, hatching, and adult. Note that the H- and S-isoforms are
co-expressed in the heart but that the S-isoform is expressed at a much
lower level. The panel S for the heart (lanes 1-7,
row S) was exposed much longer than panel S for
skeletal muscle (lanes 8-11, row S) in order to visualize a
weak expression of the S-myomesin isoform. Comparison of the rows
(H) and (S) shows that at early stages only the
EH(+) variant is present (lanes 1-3) and that the
double line corresponding to the alternative splicing event
appears simultaneously in H- and S-isoforms (lanes 5-6).
Thus, the splicing of the EH domain is independent from the C-terminal
extensions. After hatching, the EH(+)-isoforms become down-regulated,
and in the adult heart only the EH( )-isoforms are expressed
(lane 7). In contrast, in skeletal muscle only the
S-isoform, which lacks the optional EH exon, is expressed throughout
development and in adult stages (lanes 8-11). In agreement
with these conclusions, the antibody against the EH domain shows the
strong expression of EH-isoform in the embryonic heart but only traces
of the protein in the adult heart, and it does not react with skeletal
muscle extracts (row EH). Note that the EH and general
myomesin antibody My190-Nrt detect only the heart isoform but not the
skeletal muscle isoform because the latter is expressed at a much lower
level in the heart (row EH and My-N).
View larger version (23K):
[in a new window]
Fig. 9.
The inclusion of the EH-segment in the
central part of the myomesin molecule characterizes the embryonic heart
of mammals also. a, RT-PCR analysis of total RNA from
different mouse tissues with primers derived for the domains flanking
the embryonic heart-specific domain. Lanes 1-4, heart of
embryonic stages 14.5, 18.5, newborn, and adult; lanes 5-7,
skeletal muscle of embryonic stage 18.5, newborn, and adult; lane
8, brain of newborn stage. Fragment sizes are indicated on the
left in bp. The upper product of 687 bp, corresponding to
the EH(+) splice variant, is predominant at early stages in embryonic
mouse heart (lane 1) but is rapidly replaced around birth by
the EH( )-isoform represented by a product of 395 bp (lanes
2 and 3). Only the lower band, corresponding to the
EH()-isoform, can be amplified in adult heart and skeletal muscle
extracts of all developmental stages (lanes 4-7). No signal
was amplified from brain of newborn mouse (lane 8). The
amount of the total RNA loaded on each line was checked by RT-PCR using
primers specific for mouse -tubulin (data not shown). b,
striated muscles of mouse at different developmental stages were probed
by immunoblot with anti-S or anti-EH antibody (EH). The
lanes are the same as in a. In accordance with the RT-PCR
analysis the chicken skeletal myomesin-specific antibody recognizes the
upper band, corresponding to EH(+)-isoform at early stages in heart
(lane 1), and then the doublet of both bands can be seen in
the heart around birth (lanes 2 and 3), and
finally, only the lower band, corresponding to the EH()-isoform,
appears in adult heart and in skeletal muscle extracts at all
developmental stages (lanes 4-7). The anti-EH antibody
recognizes only the upper band of embryonic heart extracts (lanes
1-3). This confirms the suggestion that the upper band in
panel My-N corresponds to the mouse EH(+)-myomesin isoform.
Both antibodies do not react with brain tissue from newborn mouse
(lane 8).
View larger version (34K):
[in a new window]
Fig. 10.
Comparison of mouse, human, and chicken
EH-segments sequences. The deduced amino acid sequences of the
human (GenBankTM accession number AF185573), mouse
(fragment of the myomesin/skelemin sequence available under accession
number AJ012072), and chicken (GenBankTM accession number
AF185572) EH-segments were aligned using the Clustal W method.
Black boxes indicate identical residues, and dotted
boxes indicate conservative exchanges.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-integrin was proposed, based on an interaction between these
proteins in a yeast two-hybrid assay (32). Thus, it was suggested that
the function of skelemin in the M-band might be different from that of
myomesin. Here, we provide strong evidence that skelemin, or
EH-myomesin, is the only isoform of myomesin that is present in the
M-band of early embryonic heart. Therefore, the principal role of
EH-myomesin must be the same as of conventional myomesin,
e.g. the maintenance of an ordered thick filament lattice in
the M-band. Confusingly, the anti-skelemin antibody used by Reddy and
co-workers (32) recognizes a protein not only in muscle tissue but also
in Chinese hamster ovary cells, platelets, and even endothelial cells.
A possible explanation for these conflicting results may be the binding
of the antibody to a cross-reacting antigen. Indeed, their antibody
recognizes a protein with a molecular mass of 205-210 kDa (32), which
is in contradiction to the calculated molecular mass of 174 kDa and the
mobility of myomesin as observed in previous studies (8, 15, 27, 33,
34). A cross-reacting antibody would also explain the detection of
skelemin in smooth muscle (17). Previous investigations on myomesin
expression by several laboratories have characterized myomesin as a
sarcomeric protein and also reported its expression exclusively in
striated muscle (8, 12, 15, 27, 31, 34, 35). In the present study we
confirm by the means of RT-PCR and immunodetection that the expression
of all myomesin isoforms is restricted to heart and skeletal muscle.
ACKNOWLEDGEMENTS
FOOTNOTES
Supported by the Stipendienkommission of the ETH.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Gregorio, C. C.,
Trombitas, K.,
Centner, T.,
Kolmerer, B.,
Stier, G.,
Kunke, K.,
Suzuki, K.,
Obermayr, F.,
Herrmann, B.,
Granzier, H.,
Sorimachi, H.,
and Labeit, S.
(1998)
J. Cell Biol.
143,
1013-1027 2.
Squire, J. M.
(1975)
Annu. Rev. Biophys. Bioeng.
4,
137-163[CrossRef][Medline]
[Order article via Infotrieve]
3.
Small, J. V.,
Fürst, D. O.,
and Thornell, L. E.
(1992)
Eur. J. Biochem.
208,
559-572[Medline]
[Order article via Infotrieve]
4.
Schiaffino, S.,
and Reggiani, C.
(1996)
Physiol. Rev.
76,
371-423 5.
Weydert, A.,
Daubas, P.,
Lazaridis, I.,
Barton, P.,
Garner, I.,
Leader, D. P.,
Bonhomme, F.,
Catalan, J.,
Simon, D.,
and Guenet, J. L.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
7183-7187 6.
Nadal-Ginard, B.,
Smith, C. W.,
Patton, J. G.,
and Breitbart, R. E.
(1991)
Adv. Enzyme Regul.
31,
261-286[Medline]
[Order article via Infotrieve]
7.
Helfman, D. M.,
Berthier, C.,
Grossman, J.,
Leu, M.,
Ehler, E.,
Perriard, E.,
and Perriard, J. C.
(1999)
J. Cell Sci.
112,
371-380[Abstract]
8.
Bantle, S.,
Keller, S.,
Haussmann, I.,
Auerbach, D.,
Perriard, E.,
Muhlebach, S.,
and Perriard, J.-C.
(1996)
J. Biol. Chem.
271,
19042-19052 9.
Kolmerer, B.,
Olivieri, N.,
Witt, C. C.,
Herrmann, B. G.,
and Labeit, S.
(1996)
J. Mol. Biol.
256,
556-563[CrossRef][Medline]
[Order article via Infotrieve]
10.
Periasamy, M.,
Strehler, E. E.,
Garfinkel, L. I.,
Gubits, R. M.,
Ruiz-Opazo, N.,
and Nadal-Ginard, B.
(1984)
J. Biol. Chem.
259,
13595-13604 11.
Sutherland, C. J.,
Esser, K. A.,
Elsom, V. L.,
Gordon, M. L.,
and Hardeman, E. C.
(1993)
Dev. Dyn.
196,
25-36[Medline]
[Order article via Infotrieve]
12.
Steiner, F.,
Weber, K.,
and Furst, D.
(1999)
Genomics
56,
78-89[CrossRef][Medline]
[Order article via Infotrieve]
13.
Obermann, W. M. J.,
Gautel, M.,
Weber, K.,
and Furst, D. O.
(1997)
EMBO J.
16,
211-220[CrossRef][Medline]
[Order article via Infotrieve]
14.
Ehler, E.,
Rothen, B. M.,
Hammerle, S. P.,
Komiyama, M.,
and Perriard, J. C.
(1999)
J. Cell Sci.
112,
1529-1539[Abstract]
15.
Grove, B. K.,
Cerny, L.,
Perriard, J. C.,
and Eppenberger, H. M.
(1985)
J. Cell Biol.
101,
1413-1421 16.
Kenny, P. A.,
Liston, E. M.,
and Higgins, D. G.
(1999)
Gene (Amst.)
232,
11-23[CrossRef][Medline]
[Order article via Infotrieve]
17.
Price, M. G.
(1987)
J. Cell Biol.
104,
1325-1336 18.
Price, M. G.,
and Gomer, R. H.
(1993)
J. Biol. Chem.
268,
21800-21810 19.
Hamburger, V.,
and Hamilton, H. L.
(1992)
Dev. Dyn.
195,
231-272[Medline]
[Order article via Infotrieve]
20.
Harlow, E.,
and Lane, D.
(1988)
Antibodies: A Laboratory Manual
, 2nd Ed.
, pp. 53-138, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
21.
Obermann, W. M. J.,
Gautel, M.,
Steiner, F.,
van der Ven, P. F. M.,
Weber, K.,
and Furst, D. O.
(1996)
J. Cell Biol.
134,
1441-1453 22.
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
23.
Sen, A.,
Preston, D.,
Henderson, S. A.,
Gerard, R. D.,
and Chien, K. R.
(1988)
J. Biol. Chem.
263,
19132-19136 24.
Messerli, M.,
Eppenberger, M. E.,
Rutishauser, B.,
Schwarb, P.,
von Arx, P.,
Koch-Schneidemann, S.,
Eppenberger, H. M.,
and Perriard, J.-C.
(1993)
Histochemistry
100,
193-202[CrossRef][Medline]
[Order article via Infotrieve]
25.
Messerli, J. M.,
van der Voort, H. T. M.,
Rungger-Brändle, E.,
and Perriard, J.-C.
(1993)
Cytometry
14,
725-735[CrossRef][Medline]
[Order article via Infotrieve]
26.
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410[CrossRef][Medline]
[Order article via Infotrieve]
27.
Vinkemeier, U.,
Obermann, W.,
Weber, K.,
and Fürst, D. O.
(1993)
J. Cell Sci.
106,
319-330[Abstract]
28.
Remane, A.,
Storch, V.,
and Welsch, U.
(1979)
Systematische Zoologie, Staemme des Tierreichs
, 2nd Ed.
, pp. 571-591, Gustav Fischer Verlag, Stuttgart
29.
Boguski, M. S.,
Lowe, T. M.,
and Tolstoshev, C. M.
(1993)
Nat. Genet.
4,
332-333[CrossRef][Medline]
[Order article via Infotrieve]
30.
van der Ven, P. F. M.,
Ehler, E.,
Perriard, J.-C.,
and Fürst, D. O.
(1999)
J. Muscle Res. Cell Motil.
20,
569-579[CrossRef][Medline]
[Order article via Infotrieve]
31.
Auerbach, D.,
Bantle, S.,
Keller, S.,
Hinderling, V.,
Leu, M.,
Ehler, E.,
and Perriard, J. C.
(1999)
Mol. Biol. Cell
10,
1297-1308 32.
Reddy, K. B.,
Gascard, P.,
Price, M. G.,
Negrescu, E. V.,
and Fox, J. E. B.
(1998)
J. Biol. Chem.
273,
35039-35047 33.
Obermann, W. M.,
Plessmann, U.,
Weber, K.,
and Furst, D. O.
(1995)
Eur. J. Biochem.
233,
110-115[Medline]
[Order article via Infotrieve]
34.
Grove, B. K.,
Kurer, V.,
Lehner, C.,
Doetschman, T. C.,
Perriard, J. C.,
and Eppenberger, H. M.
(1984)
J. Cell Biol.
98,
518-524 35.
Auerbach, D.,
Rothen-Ruthishauser, B.,
Bantle, S.,
Leu, M.,
Ehler, E.,
Helfman, D.,
and Perriard, J. C.
(1997)
Cell Struct. Funct.
22,
139-146[Medline]
[Order article via Infotrieve]
36.
Labeit, S.,
and Kolmerer, B.
(1995)
Science
270,
293-296 37.
Tskhovrebova, L.,
Trinick, J.,
Sleep, J. A.,
and Simmons, R. M.
(1997)
Nature
387,
308-312[CrossRef][Medline]
[Order article via Infotrieve]
38.
Linke, W. A.,
Ivemeyer, M.,
Mundel, P.,
Stockmeier, M. R.,
and Kolmerer, B.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
8052-8057 39.
Goode, D.
(1975)
Cytobiologie
11,
203-229
40.
Kelly, A. M.,
and Chacko, S.
(1976)
Dev. Biol.
48,
421-430[CrossRef][Medline]
[Order article via Infotrieve]
41.
Rumyantsev, P. P.
(1977)
Int. Rev. Cytol.
51,
186-273[Medline]
[Order article via Infotrieve]
42.
Li, F.,
Wang, X.,
Bunger, P. C.,
and Gerdes, A. M.
(1997)
J. Mol. Cell. Cardiol.
29,
1541-1551[CrossRef][Medline]
[Order article via Infotrieve]
43.
Smolich, J. J.
(1995)
Reprod. Fertil. Dev.
7,
451-461[CrossRef][Medline]
[Order article via Infotrieve]
44.
Wallimann, T.,
and Eppenberger, H. M.
(1985)
Cell Muscle Motil.
6,
239-285[Medline]
[Order article via Infotrieve]
45.
van Deursen, J.,
Heerschap, A.,
Oerlemans, F.,
Ruitenbeek, W.,
Jap, P.,
ter Laak, H.,
and Wieringa, B.
(1993)
Cell
74,
621-631[CrossRef][Medline]
[Order article via Infotrieve]
46.
Fischman, D. A.
(1967)
J. Cell Biol.
32,
557-575 47.
Komuro, I.,
and Yazaki, Y.
(1993)
Annu. Rev. Physiol.
55,
55-75[CrossRef][Medline]
[Order article via Infotrieve]
48.
Arber, S.,
Hunter, J. J.,
Ross, J. J.,
Hongo, M.,
Sansig, G.,
Borg, J.,
Perriard, J. C.,
Chien, K. R.,
and Caroni, P.
(1997)
Cell
88,
393-403[CrossRef][Medline]
[Order article via Infotrieve]
49.
Sussman, M. A.,
Welch, S.,
Cambon, N.,
Klevitsky, R.,
Hewett, T. E.,
Price, R.,
Witt, S. A.,
and Kimball, T. R.
(1998)
J. Clin. Invest.
101,
51-61[Medline]
[Order article via Infotrieve]
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  G. M. Conover, S. N. Henderson, and C. C. Gregorio A Myopathy-linked Desmin Mutation Perturbs Striated Muscle Actin Filament Architecture Mol. Biol. Cell, February 1, 2009; 20(3): 834 - 845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Krishnan, P. Ahuja, S. Bodenmann, D. Knapik, E. Perriard, W. Krek, and J.-C. Perriard Essential Role of Developmentally Activated Hypoxia-Inducible Factor 1{alpha} for Cardiac Morphogenesis and Function Circ. Res., November 7, 2008; 103(10): 1139 - 1146. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kruger, T. Kohl, and W. A. Linke Developmental changes in passive stiffness and myofilament Ca2+ sensitivity due to titin and troponin-I isoform switching are not critically triggered by birth Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H496 - H506. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Somi, A. T. J. Klein, A. C. Houweling, J. M. Ruijter, A. A.M. Buffing, A. F.M. Moorman, and M. J.B. van den Hoff Atrial and Ventricular Myosin Heavy-chain Expression in the Developing Chicken Heart: Strengths and Limitations of Non-radioactive In Situ Hybridization J. Histochem. Cytochem., June 1, 2006; 54(6): 649 - 664. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Ahuja, E. Perriard, J.-C. Perriard, and E. Ehler Sequential myofibrillar breakdown accompanies mitotic division of mammalian cardiomyocytes J. Cell Sci., July 1, 2004; 117(15): 3295 - 3306. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Camelliti, G. P Devlin, K. G Matthews, P. Kohl, and C. R Green Spatially and temporally distinct expression of fibroblast connexins after sheep ventricular infarction Cardiovasc Res, May 1, 2004; 62(2): 415 - 425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Opitz, M. C. Leake, I. Makarenko, V. Benes, and W. A. Linke Developmentally Regulated Switching of Titin Size Alters Myofibrillar Stiffness in the Perinatal Heart Circ. Res., April 16, 2004; 94(7): 967 - 975. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Politi, M. Szabolcs, P. Fisher, A. Kljuic, T. Ludwig, and A. Efstratiadis A Mouse Model of Uterine Leiomyosarcoma Am. J. Pathol., January 1, 2004; 164(1): 325 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Porter, A. P. Merriam, B. Gong, S. Kasturi, X. Zhou, K. F. Hauser, F. H. Andrade, and G. Cheng Postnatal suppression of myomesin, muscle creatine kinase and the M-line in rat extraocular muscle J. Exp. Biol., September 1, 2003; 206(17): 3101 - 3112. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. H. Andrade, A. P. Merriam, W. Guo, G. Cheng, C. A. McMullen, K. Hayess, P. F. M. van der Ven, and J. D. Porter Paradoxical absence of M lines and downregulation of creatine kinase in mouse extraocular muscle J Appl Physiol, August 1, 2003; 95(2): 692 - 699. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |