HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ricupero, D. A. Articles by Goldstein, R. H. Search for Related Content PubMed PubMed Citation Articles by Ricupero, D. A. Articles by Goldstein, R. H. Social Bookmarking                      What's this?

J Biol Chem, Vol. 275, Issue 17, 12475-12480, April 28, 2000

Des-Arg¹⁰-kallidin Engagement of the B1 Receptor Stimulates Type I Collagen Synthesis via Stabilization of Connective Tissue Growth Factor mRNA^*

Dennis A. Ricupero^§, Jose R. Romero^¶, David C. Rishikof^**, and Ronald H. Goldstein

From the  Pulmonary Center, Departments of Medicine and Biochemistry, Boston University School of Medicine and the Boston Veterans Affairs Medical Center and the ^¶ Endocrine-Hypertension Division, Department of Medicine, Harvard Medical School, Boston, Massachusetts 02118-2394

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Expression of the kinin B1 receptor is up-regulated in chronic inflammatory and fibrotic disorders; however, little is known about its role in fibrogenesis. We examined human embryonic lung fibroblasts that constitutively express the B1 receptor and report that engagement of the B1 receptor by des-Arg¹⁰-kallidin stabilized connective tissue growth factor (CTGF) mRNA, stimulated an increase in 1(I) collagen mRNA, and stimulated type I collagen production. These events were not observed in B2 receptor-activated fibroblasts. In addition, B1 receptor activation by des-Arg¹⁰-kallidin induced a rise in cytosolic Ca²⁺ that is consistent with B1 receptor pharmacology. Our results show that the des-Arg¹⁰-kallidin-stimulated increase in 1(I) collagen mRNA was time- and dose-dependent, with a peak response observed at 20 h with 100 nM des-Arg¹⁰-kallidin. The increase in CTGF mRNA was also time- and dose-dependent, with a peak response observed at 4 h with 100 nM des-Arg¹⁰-kallidin. The increase in CTGF mRNA was blocked by the B1 receptor antagonist des-Arg¹⁰,Leu⁹-kallidin. Inhibition of protein synthesis by cycloheximide did not block the des-Arg¹⁰-kallidin-induced increase in CTGF mRNA. These results suggest that engagement of the kinin B1 receptor contributes to fibrogenesis through increased expression of CTGF.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Kinins are involved in the regulation of a variety of physiological and cellular functions, including smooth muscle tone, pain perception, inflammation, and cellular proliferation (1, 2). Molecular biological and pharmacological studies have identified two G-protein-coupled kinin receptors, B1 and B2 (3-5). Activation of the B1 receptor induces cellular and physiological responses that often mimic the responses observed following activation of the B2 receptor. For instance, both receptors activate nuclear factor B in fibroblasts (6), modulate vascular tone (7), and activate phospholipase C in mesangial cells (8). However, receptor-specific physiological responses induced by the kinin receptors are demonstrated in the kinin-mediated bronchoconstriction of asthmatic airways. The B2 receptor agonists bradykinin (BK)¹ and kallidin (Lys-BK) are potent bronchoconstrictors (9), whereas the B1 receptor agonist des-Arg¹⁰-kallidin does not induce bronchoconstriction (10).

The B2 receptor, the classical bradykinin receptor, is widely expressed and binds both BK and kallidin with high affinity. In wound repair, activation of the B2 receptor induces a variety of effects, including increased neutrophil proliferation, stimulation of macrophage spreading, release of histamine from mast cells, synthesis of platelet-activating factor and prostaglandins in endothelial cells, release of tachykinin and acetylcholine from sensory nerve endings, increased microvascular permeability, and fibroblast proliferation (2).

Early studies described the B1 receptor as an inducible receptor whose expression is up-regulated following exposure to interleukin-1 or other pro-inflammatory agents (11). A recent study has identified expression of the B1 receptor by immunohistochemistry in transbronchial biopsies from patients with sarcoidosis or progressive systemic sclerosis, whereas expression of the B1 receptor was undetectable in normal subjects (12). Activation of the B1 receptor induces relaxation or contraction of various smooth muscle cell preparations, mediates chronic pain, and may be involved in chronic inflammation (1). Recent studies have demonstrated the expression of the B1 receptor in apparently healthy renal (13), intestinal (14), ocular (15), stomach (16), and pulmonary (17) tissues; however, the role of the B1 receptor in homeostasis and wound repair is not understood. Activation of the B1 receptor stimulates prostaglandin synthesis in fibroblasts, release of tumor necrosis factor  and interleukin-1 from macrophages, and prostaglandin and platelet-activating factor synthesis in endothelial cells (1).

Recently, it was proposed that TGF- stimulates fibrogenesis and proliferation in fibroblasts via a mechanism that requires de novo synthesis of a secondary factor, which has been identified as connective tissue growth factor (CTGF) (18). CTGF, a member of the CCN family, is a cysteine-rich, heparin-binding, 349-amino acid protein (19). Other members of the CCN family include Fisp12/BIGM2 (mouse ortholog of CTGF) (20), Cyr61 (and the chick ortholog Cef10) (21), Nov (human and Xenopus orthologs) (22), Elm-1 (23), CTGF-L (24), and WISP-3 (25). CCN proteins possess a secretory signal peptide and four distinct protein modules: an insulin-like growth factor-binding domain, a von Willebrand factor type C repeat, a thrombospondin type 1 repeat, and a C-terminal module. CTGF-L does not contain the C-terminal domain. The CCN family is further distinguished by the high degree of amino acid homology (50-90%) and conservation of 38 cysteine residues. TGF- (but not epidermal growth factor, fibroblast growth factor, or platelet-derived growth factor) stimulates CTGF transcription in normal rat kidney fibroblasts (26). In adult mammals, CTGF is expressed in high levels during wound repair and at sites of connective tissue formation in a variety of fibrotic disorders (27, 28). CTGF is expressed in lung fibroblasts and has been suggested to play a role in the pathogenesis of lung fibrosis (29).

Our goal was to examine B1 receptor-induced fibrogenesis. Using a human embryonic lung fibroblast cell line, we report that des-Arg¹⁰-kallidin, upon binding to the B1 receptor, activates an increase in cytosolic Ca²⁺ with a different fluorescence signature using fura-2 than the B2 receptor and specifically induces dose- and time-dependent increases in 1(I) collagen mRNA and CTGF mRNA. The increase in steady-state CTGF mRNA levels involves stabilization of the message through a mechanism that is cycloheximide-insensitive and 12-O-tetradecanoylphorbol-13-acetate (TPA)-sensitive. The data suggest that the B1 receptor has a distinct function in the pathophysiology of fibrotic lung diseases.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Tissue Culture-- Human embryonic lung fibroblasts (IMR-90, Institute for Medical Research, Camden, NJ) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 0.37 g/100 ml sodium bicarbonate, 10% (v/v) fetal bovine serum (FBS), 100 units/ml penicillin, 10 µg/ml streptomycin, 0.1 mM sodium pyruvate, and 0.1 mM nonessential amino acids. Cell numbers were determined by triplicate cell counts with an electronic particle counter (Coulter Counter ZM).

Northern Blotting-- Confluent IMR-90 fibroblast cultures were incubated in DMEM supplemented with 0.4% FBS for 24 h. The culture medium was supplemented with protease inhibitors (captopril (10 µM), phosphoramidon (1 µM), and DL-2-mercaptomethyl-3-guanidinoethylthiopropanoic acid (1 µM)) and stimulated as indicated. Total cellular RNA was isolated by the single-step method employing guanidine thiocyanate/phenol/chloroform extraction as described by Chomczynski and Sacchi (30). RNA was quantified by absorbance at 260 nm. Purity was determined by absorbance at 280 and 310 nm. RNA (10 µg) was electrophoresed through a 6% formaldehyde-containing 1% agarose gel and transferred to a nylon membrane. RNA loading was assessed by ethidium bromide staining of ribosomal bands and by co-hybridization with glyceraldehyde-3-phosphate dehydrogenase. The 1(I) collagen probe is a 1.5-kilobase pair fragment of rat 1(I) collagen cDNA that specifically binds human 1(I) collagen mRNA. The CTGF probe is a 586-base pair polymerase chain reaction product generated with the forward primer gtggagtatgtaccgacggcc and the reverse primer acaggcaggtcagtgagcacgc. The filter was exposed to x-ray film for autoradiography at several different times to ensure that the bands could be quantified by densitometry within the linear range.

Bioassay for TGF- Activity-- Quantification of TGF- released by IMR-90 fibroblast cultures was determined using a TGF- bioassay based on the inhibition of growth of mink lung epithelial cells (MLECs) by TGF- (31). MLECs were maintained in DMEM supplemented with 10% FBS and passaged every 3 days. MLECs were seeded at a density of 2 × 10⁵ cells/well in 24-well plates. After 24 h, the cultures were washed twice with phosphate-buffered saline and refed with DMEM (0.5 ml/well) without FBS and supplemented with leupeptin (2 µg/ml), aprotinin (2 µg/ml), and pepstatin A (2 µg/ml). Conditioned medium from control or des-Arg¹⁰-kallidin-stimulated IMR-90 fibroblasts was centrifuged (500 × g, 10 min) to remove non-adherent cells and then added to the MLECs (0.5 ml/well). The cultures were incubated for 20 h at 37 °C and 5% CO₂ and then pulsed with [³H]thymidine (1 µCi/well; NEN Life Science Products) for 2 h. The plates were washed twice with cold phosphate-buffered saline, fixed with 1 ml of acetic acid/methanol (1:3, v/v) 1 h at room temperature, washed twice with 80% methanol, digested for 30 min with 0.5 ml of 0.05% trypsin dissolved with 0.5 ml of 0.1% SDS, and scintillation-counted. The quantification of the TGF- content of conditioned medium was interpolated from a standard curve generated by replacing conditioned medium with DMEM supplemented with TGF- (0.003-1.0 ng/ml). Inhibition of MLEC incorporation of [³H]thymidine ranged from 92% (0.25 ng/ml) to 0.3% (0.003 ng/ml), with an IC₅₀ of ~0.15 ng/ml.

Measurements of Cytosolic Calcium-- Steady-state and agonist-stimulated levels of cytosolic Ca²⁺ in IMR-90 fibroblasts were determined with the fluorescent probe fura-2. Briefly, IMR-90 cells were grown to confluence on glass coverslips. The cells were then loaded with fura-2/AM (5 µM) for 30 min at 37 °C in physiological saline solution containing 140 mmol/liter NaCl, 5 mmol/liter KCl, 10 mmol/liter HEPES (pH 7.4), 1 mmol/liter NaHPO₄, 1 mmol/liter CaCl₂, 1 MgSO₄, and 5 mmol/liter glucose. Cells were washed twice with physiological saline solution without fura-2. The cell-containing coverslips were then placed diagonally in a quartz cuvette that contained physiological saline solution (37 °C), and cytosolic Ca²⁺ was monitored in real time for ~15 min as described by Fajtova et al. (32) with modifications (33). Fura-2 fluorescence was recorded at 510 nm emission wavelength with excitation monochrometers centered at 350 and 380 nm (in a PTI spectrofluorometer). Stable values were obtained for periods of up to 20 min. Cell fluorescence was corrected for autofluorescence, and the contribution of dye leakage was estimated at <2% with Mn²⁺.

Assay for Collagen Synthesis-- Confluent quiescent fibroblast cultures were stimulated with 100 nM des-Arg¹⁰-kallidin, 100 nM bradykinin, or 1 ng/ml TGF- as indicated for 16 h in serum-free DMEM supplemented with [³H]proline (2 µCi/ml) and ascorbate (50 µg/ml). The cultures were scraped into phosphate-buffered saline with EDTA (2 mM), phenylmethylsulfonyl fluoride (100 µM), and hydoxymercuribenzoate (10 µM). The lysates were dialyzed at 4 °C for 48 h, lyophilized, digested with pepsin (10 µg/ml) in 0.5 N acetic acid for 16 h at 4 °C, dialyzed for 48 h at 4 °C, and lyophilized (34). The digests were separated on a 6% polyacrylamide gel. Autoradiography was performed as described (35).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Embryonic human lung fibroblasts (IMR-90) constitutively express both the B1 and B2 receptors (36). Since activation of the B1 or B2 receptor activates phospholipase C and induces a rise in cytosolic Ca²⁺ in a number of cell types (37, 38), we monitored cytosolic Ca²⁺ levels in kinin-stimulated fibroblasts. To activate the B2 receptor, we employed BK or kallidin, both of which are nearly indistinguishable pharmacologically and physiologically. To activate the B1 receptor, we used des-Arg¹⁰-kallidin (39). We found that activation of the B1 receptor by des-Arg¹⁰-kallidin induced a dose-dependent increase in cytosolic Ca²⁺ in human lung fibroblasts (Fig. 1). Increases in cytosolic Ca²⁺ were detected at the threshold concentration of 1 nM des-Arg¹⁰-kallidin. The maximal increase in cytosolic Ca²⁺ induced by des-Arg¹⁰-kallidin was observed at 100 nM (EC₅₀ = 1.9 nM; r² = 0.9871). Activation of the B2 receptor induced an increase in cytosolic Ca²⁺ that was also dose-dependent (EC₅₀ = 0.7 nM; r² = 0.9763) (data not shown). To examine the pharmacology of the kinin receptors, we monitored cytosolic Ca²⁺ concentrations in kinin-stimulated fibroblasts. In fibroblasts stimulated with the B1 receptor agonist des-Arg¹⁰-kallidin, the cytosolic Ca²⁺ increased gradually and returned to base-line levels (Fig. 2A). The B1 receptor antagonist des-Arg¹⁰,Leu⁹-kallidin did not induce an increase in cytosolic Ca²⁺, but did block the increase in cytosolic Ca²⁺ stimulated by des-Arg¹⁰-kallidin. However, the kallidin-stimulated increase in cytosolic Ca²⁺ was not affected by des-Arg¹⁰,Leu⁹-kallidin (Fig. 2B). In fibroblasts stimulated with 1 nM kallidin, cytosolic Ca²⁺ levels increased sharply and remained elevated (Fig. 2C). The B2 receptor-specific antagonist (HOE 140) did not stimulate an increase in cytosolic Ca²⁺ or interfere with the Ca²⁺ movement induced by des-Arg¹⁰-kallidin. Conversely, the kallidin-stimulated increase in cytosolic Ca²⁺ was blocked by 1 µM HOE 140 (Fig. 2D). We conclude that des-Arg¹⁰-kallidin stimulates an increase in cytosolic Ca²⁺ via exclusive engagement of the B1 receptor.

View larger version (19K): [in this window] [in a new window]   Fig. 1.   Ca2+ transients in des-Arg10-kallidin-stimulated fibroblasts. IMR-90 fibroblasts were grown on glass coverslips, incubated in DMEM supplemented with 0.4% FBS for 24 h, and loaded with fura-2 as described under "Materials and Methods." The fibroblasts were stimulated with the concentrations of des-Arg10-kallidin as indicated. The maximal 340/380 nm emission ratio increases are presented. Results are representative of three independent experiments.

View larger version (12K): [in this window] [in a new window]   Fig. 2.   Effect of B1 receptor antagonist. IMR-90 fibroblasts were grown on glass coverslips, incubated in DMEM supplemented with 0.4% FBS for 24 h, and loaded with fura-2 as described under "Materials and Methods." The 340/380 nm emission ratios are presented. A, the fibroblasts were stimulated with 10 nM des-Arg10-kallidin (arrow). Results are representative of three independent experiments. B, the fibroblasts were stimulated with 1 µM des-Arg10,Leu9-kallidin (), 10 nM des-Arg10-kallidin (arrow), and 1 nM kallidin (). Results are representative of three independent experiments. C, the fibroblasts were stimulated with 1 nM kallidin (). Results are representative of three independent experiments. D, the fibroblasts were stimulated with 1 µM HOE 140 (), 1 nM kallidin (), and 10 nM des-Arg10-kallidin (arrow). Results are representative of three independent experiments.

To study the effect of kinin receptor activation on the production of type I collagen, fibroblasts were stimulated with the B1 receptor agonist des-Arg¹⁰-kallidin, the B2 receptor agonist BK, or TGF- (Fig. 3). BK did not stimulate type I collagen production, whereas des-Arg¹⁰-kallidin stimulated an increase in type I collagen production. As previously reported, TGF- is a potent stimulus of type I collagen production (36). Type I collagen is composed of two 1(I) collagen peptides and one 2(I) collagen peptide. Presented in Fig. 3 are radiolabeled 1(I) and 2(I) collagen peptides resolved by polyacrylamide gel electrophoresis. We determined that des-Arg¹⁰-kallidin stimulated an increase in both 1(I) and 2(I) collagen peptides proportionally.

View larger version (21K): [in this window] [in a new window]   Fig. 3.   Type I collagen production. IMR-90 fibroblasts were grown to confluence in 150-mm dishes; incubated in DMEM supplemented with 0.4% FBS for 24 h; and stimulated with 100 nM BK, 100 nM des-Arg10-kallidin (DAK), or 1 ng/ml TGF- or unstimulated (Control) for 16 h. Type I collagen was prepared as described under "Materials and Methods." Results are representative of two independent experiments.

View larger version (43K): [in this window] [in a new window]   Fig. 4.   1(I) collagen mRNA in kinin-stimulated fibroblasts. Confluent IMR-90 fibroblasts were incubated in DMEM supplemented with 0.4% FBS for 24 h. Total RNA was harvested and Northern-blotted (10 µg/lane) with probes for 1(I) collagen mRNA and GAPDH mRNA as described under "Results." A, fibroblasts were stimulated with 100 nM des-Arg10-kallidin (DAK) or 100 nM BK or were unstimulated (Control) for 20 h. The location of the ribosomal RNA (28 S) is indicated. Results are representative of three independent experiments. B, fibroblasts were stimulated with concentrations of des-Arg10-kallidin ranging from 1012 to 106 M for 20 h as indicated. Results are representative of three independent experiments. C, fibroblasts were stimulated with 100 nM des-Arg10-kallidin. Total RNA was isolated at the indicated times. Results are representative of three independent experiments.

We examined the modulation of steady-state 1(I) collagen mRNA levels by kinins. BK did not stimulate an increase in 1(I) collagen mRNA. However, in fibroblasts stimulated with des-Arg¹⁰-kallidin, there was an increase in 1(I) collagen mRNA (Fig. 4A). Variations in RNA loading were monitored by expression of GAPDH mRNA.

A narrow dose-response relationship was found for the des-Arg¹⁰-kallidin-stimulated increase in 1(I) collagen mRNA (Fig. 4B). At concentrations <1 nM des-Arg¹⁰-kallidin, we did not detect any changes in 1(I) collagen mRNA. Maximal stimulation occurred at concentrations >10 nM. Kinetic studies detected increases in 1(I) collagen mRNA beginning at 4 h, with a maximum response at 24 h (Fig. 4C). In contrast, neither des-Arg¹⁰-kallidin nor kallidin induced an increase in fibronectin mRNA (data not shown).

TGF- mediates increases in collagen synthesis induced by other G-protein-coupled receptor agonists, including angiotensin II (40) and thromboxane (41). We determined the amount of active TGF- present in the culture medium from untreated and des-Arg¹⁰-kallidin-treated fibroblasts using the bioassay in which MLEC growth was inhibited in a dose-dependent manner by active TGF-. The medium from des-Arg¹⁰-kallidin-stimulated fibroblasts was added to MLEC cultures, and [³H]thymidine incorporation was monitored (Table I). The medium from untreated and des-Arg¹⁰-kallidin-stimulated fibroblasts contained small but similar amounts of TGF-. The values were interpolated from a TGF- inhibition standard curve. The amount of active TGF- in the medium from des-Arg¹⁰-kallidin-stimulated fibroblasts (0.38 ± 0.053 ng/ml) was not statistically different from the control values (p > 0.05). Des-Arg¹⁰-kallidin (1 µM) did not alter MLEC growth, nor did the presence of des-Arg¹⁰-kallidin (1 µM) alter TGF--mediated growth inhibition (data not shown).

View this table: [in this window] [in a new window]   Table I TGF- content of conditioned media Confluent quiescent IMR-90 fibroblasts were washed with phosphate-buffered saline and incubated in serum-free DMEM with or without 100 nM des-Arg10-kallidin for 24 h. The medium was removed, centrifuged to remove non-adherent cells, and stored at 70 °C. The TGF- content of the conditioned medium was determined in triplicate as described under "Results" and reported as the mean ± S.D. for 10 independent experiments.

To determine whether des-Arg¹⁰-kallidin amplifies the TGF- signaling mechanism, we employed the luciferase reporter p3TP-LUX, which is activated by TGF- via Smad signaling (42). In fibroblasts that were transiently transfected with p3TP-LUX, TGF- stimulated transcription from p3TP-LUX, as indicated by increased luciferase activity. Des-Arg¹⁰-kallidin did not stimulate an increase in luciferase activity. In cultures stimulated with both TGF- and des-Arg¹⁰-kallidin, the luciferase activity was comparable to the luciferase activity in cultures stimulated with TGF- alone (Fig. 5). We conclude that the des-Arg¹⁰-kallidin-stimulated increase in 1(I) collagen mRNA is mediated through a mechanism that does not increase the amount of active TGF- or amplify the intracellular signal generated by TGF-. At this time, we do not exclude the possibility that des-Arg¹⁰-kallidin amplifies non-SMAD-mediated TGF- signaling.

View larger version (13K): [in this window] [in a new window]   Fig. 5.   Luciferase activity. IMR-90 fibroblasts were transfected with p3TP-LUX as described under "Results." The cultures were stimulated with 100 nM des-Arg10-kallidin (DAK), 1 ng/ml TGF- (T), or 1 ng/ml TGF- plus 100 nM des-Arg10-kallidin (T+DAK) for 8 h as indicated. The luciferase activity was assayed as described under "Results" and is reported as mean ± S.D. of triplicates. Results are representative of three independent experiments. C, control.

In human lung fibroblasts, des-Arg¹⁰-kallidin stimulates proliferation (36) and increased levels of 1(I) collagen mRNA (Fig. 4A). Since TGF- stimulates extracellular matrix protein synthesis and proliferation in fibroblasts through de novo synthesis of CTGF (26), we examined the effects of kinins on the steady-state levels of CTGF mRNA (Fig. 6A). TGF- stimulated an increase in CTGF mRNA, and activation of the B2 receptor did not induce a change in CTGF mRNA levels. In contrast, activation of the B1 receptor by des-Arg¹⁰-kallidin stimulated an increase in CTGF mRNA. As with 1(I) collagen mRNA, the des-Arg¹⁰-kallidin-stimulated increase in CTGF mRNA was dose-dependent (Fig. 6B). For the dose-response studies, fibroblasts were stimulated with des-Arg¹⁰-kallidin ranging from 10 pM to 1 µM. Maximal increases in CTGF mRNA were observed at concentrations of des-Arg¹⁰-kallidin >10 nM. The des-Arg¹⁰-kallidin response was further characterized in a time course study. Total RNA was harvested at various time points (2-24 h). Increases in CTGF mRNA levels were detected at 2 h, with a maximum response at 4 h (Fig. 6C). At 24 h, the level of CTGF mRNA returned to basal levels.

View larger version (55K): [in this window] [in a new window]   Fig. 6.   CTGF mRNA levels in kinin-stimulated fibroblasts. Confluent IMR-90 fibroblasts were incubated in DMEM supplemented with 0.4% FBS for 24 h. Following stimulation, total RNA was harvested and Northern-blotted (10 µg/lane) with probes for CTGF and GAPDH as described under "Results." A, the cultures were stimulated with 100 nM des-Arg10-kallidin (DAK), 100 nM kallidin (K), or 1 ng/ml TGF- or were unstimulated (Control) for 4 h as indicated. Location of the ribosomal RNA (18 S) is indicated. Results are representative of three independent experiments. B, des-Arg10-kallidin stimulated a dose-dependent increase in CTGF mRNA. The cultures were stimulated with des-Arg10-kallidin (ranging from 1011 to 106 M) for 4 h. Results are representative of three independent experiments. C, confluent IMR-90 fibroblasts were stimulated with 100 nM des-Arg10-kallidin for the indicated time points. Results are representative of three independent experiments.

As demonstrated with the des-Arg¹⁰-kallidin-stimulated increase in cytosolic Ca²⁺, the B1 receptor antagonist des-Arg¹⁰,Leu⁹-kallidin attenuated the des-Arg¹⁰-kallidin-induced increase in CTGF mRNA. In contrast to des-Arg¹⁰-kallidin, des-Arg¹⁰,Leu⁹-kallidin did not induce an increase in CTGF mRNA (Fig. 7A). However, when the fibroblasts were preincubated with the B1 receptor antagonist des-Arg¹⁰,Leu⁹-kallidin (1 µM) and then stimulated with des-Arg¹⁰-kallidin (100 nM), the increase in CTGF mRNA was reduced.

View larger version (64K): [in this window] [in a new window]   Fig. 7.   Modulators of des-Arg10-kallidin-stimulated increases in CTGF mRNA. Confluent IMR-90 fibroblasts were incubated in DMEM supplemented with 0.4% FBS for 24 h. Following stimulation, total RNA was harvested and Northern-blotted (10 µg/lane) with probes for CTGF and GAPDH as described under "Results." A, the B1 receptor antagonist attenuated the des-Arg10-kallidin-stimulated increase in CTGF mRNA. The fibroblasts were incubated with 1 µM des-Arg10,Leu9-kallidin (DALK) for 10 min and then stimulated with 100 nM des-Arg10-kallidin (DAK) or 1 ng/ml TGF- for 4 h as indicated. Results are representative of three independent experiments. B, the cultures were pretreated with actinomycin D (5 µg/ml) for 10 min and then stimulated with 100 nM des-Arg10-kallidin or 1 ng/ml TGF- or unstimulated for 4 h. Results are representative of three independent experiments. C, the cultures were pretreated with 1 µM cycloheximide for 30 min and then stimulated with 100 nM des-Arg10-kallidin or 1 ng/ml TGF- or were unstimulated for 6 h. Results are representative of three independent experiments. D, the cultures were pretreated with 100 nM TPA for 10 min and then stimulated with 100 nM des-Arg10-kallidin or 1 ng/ml TGF- were or unstimulated for 4 h. Results are representative of three independent experiments.

We previously reported that TGF- stimulates transcription of CTGF (43). When transcription was blocked with actinomycin D, there were reduced basal levels of CTGF mRNA, indicating that CTGF mRNA was constitutively transcribed in quiescent fibroblasts (Fig. 7B). As previously reported, actinomycin D blocks the TGF--stimulated transcription of CTGF (43). However, the des-Arg¹⁰-kallidin-stimulated increase in CTGF mRNA was not blocked by actinomycin D, indicating that the des-Arg¹⁰-kallidin-induced increase in CTGF mRNA is due to stabilization of the message.

Studies on the granulocyte-macrophage colony-stimulating factor (GM-CSF) mRNA indicated that inhibition of protein synthesis with cycloheximide (CHX) or short-term treatment with TPA induces stabilization of GM-CSF mRNA (44). We characterized the des-Arg¹⁰-kallidin response by blocking protein synthesis with CHX. TGF- signaling was not affected by inhibition of protein synthesis. In fibroblasts incubated with either CHX or des-Arg¹⁰-kallidin, there was an increase in CTGF mRNA. Furthermore, in fibroblasts stimulated with both CHX and des-Arg¹⁰-kallidin, CTGF mRNA levels increased in an additive manner, suggesting that the des-Arg¹⁰-kallidin response does not involve inhibition of protein synthesis (Fig. 7C). We further characterized the des-Arg¹⁰-kallidin-induced stabilization of CTGF mRNA by pretreating the fibroblasts with TPA (100 nM, 10 min). TPA alone did not alter the basal levels of CTGF mRNA or alter the TGF- response. However, TPA attenuated the des-Arg¹⁰-kallidin response (Fig. 7D).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

In vivo, the B1 receptor is detected in low abundance in normal tissues and is up-regulated following exposure to pro-inflammatory agents via nuclear factor B activation. In the studies presented here, we utilized human embryonic lung fibroblasts that constitutively express the B1 receptor. Our results do not require up-regulation of B1 receptor number since treatment with actinomycin D or CHX does not inhibit the des-Arg¹⁰-kallidin-induced increase in CTGF mRNA. Since each of these agents prevents de novo synthesis of the B1 receptor, it appears that the number of receptors constitutively expressed by the fibroblasts is sufficient for signaling

Exogenous administration of B1 and B2 receptor agonists in vivo and in vitro generates responses that appear qualitatively similar. For example, both the B1 and B2 receptors mediate pain perception (45); both receptors activate phospholipase C in mesangial cells (46); and both receptors stimulate mitogenesis in fibroblasts (36). In addition, the structural similarities of the B1 and B2 receptor agonists suggest that the kinin receptors may be isoforms. However, our Ca²⁺ studies clearly demonstrate that the physiological effects mediated by the B1 and B2 receptor systems are distinct. These findings, together with the low homology between the receptors (36% at the amino acid level) and the patterns of expression, indicate that the kinin receptors have distinct physiological and cellular responses.

Engagement of the B1 or B2 receptor affects extracellular matrix deposition, but in different ways. Activation of the B2 receptor stimulates synthesis of nitric oxide and prostaglandins in fibroblasts (47), release of histamine from mast cells (48), and release of substance P and neurokinin A from sensory neurons (49), processes that can be considered anti-fibrotic. Our data demonstrate that activation of the B2 receptor does not stimulate collagen or CTGF synthesis. However, activation of the B1 receptor by des-Arg¹⁰-kallidin stimulates type I collagen protein synthesis, increases 1(I) collagen mRNA, and stabilizes CTGF mRNA. TGF- and now des-Arg¹⁰-kallidin are the only known stimulators of CTGF production.

The rate of mRNA degradation is determined, for the most part, by the activity of destabilizing sequences, although stabilizing sequences have been reported (50). Destabilizing sequences have been found in the 5'-untranslated region (51) and in the coding sequences (52). However, cytokine mRNA degradation is mediated through increased exonuclease activity, which appears to be regulated through adenine/uridine-rich elements found in the 3'-untranslated region (53). GM-CSF mRNA stabilization is well characterized. The GM-CSF 3'-untranslated region contains several elements consisting of core AUUUA pentamers. Proteins bind to AUUUA pentamers and appear to recruit other proteins, resulting in increased exonuclease activity. Inhibition of protein synthesis by CHX induces an increase in GM-CSF mRNA stability, presumably by inhibiting synthesis of destabilizing proteins (54).

The CTGF 3'-untranslated region (996 nucleotides) contains three AUUUA pentamers that potentially bind proteins involved in message destabilization. Each AUUUA pentamer forms the core for nonamers that are highly homologous to UUAUUU(U/A)(U/A), which is reported to destabilize mRNA (55).

The mechanism that induces stabilization of GM-CSF mRNA appears to be distinct from the mechanism that stabilizes CTGF mRNA. In the studies presented here, CHX induces an increase in CTGF mRNA levels at 6 h. The CHX-induced increase in CTGF mRNA is not sensitive to inhibition of transcription by actinomycin D (data not shown), suggesting that CHX induces an increase in CTGF mRNA stability by inhibiting synthesis of destabilizing proteins. CHX could inhibit specific RNases; however, GAPDH mRNA was not altered by CHX. Co-stimulation with CHX and des-Arg¹⁰-kallidin further increased the amount of CTGF mRNA, suggesting that the mechanisms by which CHX and des-Arg¹⁰-kallidin induced an increase in CTGF mRNA are distinct. Furthermore, TPA differentially regulates the stabilization of CTGF mRNA and GM-CSF mRNA. Human lung fibroblasts (WI38) exposed to TPA for 10 min exhibit increased GM-CSF mRNA stability (44). In our system, TPA did not stabilize CTGF mRNA. In fact, TPA attenuated the B1 receptor-mediated stabilization of CTGF mRNA. It is possible that the divergent TPA effects are cell type-specific.

The data presented are consistent with the interpretation that CTGF mRNA is destabilized through labile destabilizing protein(s) that binds to the AUUUA elements and that recruits RNases and other cytoplasmic proteins. CHX blocks synthesis of the putative destabilizing protein(s), thus attenuating destabilization. Des-Arg¹⁰-kallidin induces stabilization of CTGF mRNA through post-translational modifications of the existing destabilizing proteins. The des-Arg¹⁰-kallidin-mediated post-translational modifications may reduce the RNA binding affinity of the destabilizing proteins or sterically hinder the complex formation of destabilizing proteins with other cytosolic proteins. The net result of stimulation with des-Arg¹⁰-kallidin is an increase in the message stability.

Activation of the B2 receptor by BK and kallidin is an integral part of the early events of wound repair, mediating such processes as edema, pain perception, and release or synthesis of pro-inflammatory factors (3). When the possible contribution of the B2 receptor to fibrogenesis was examined, it was found that activation of the B2 receptor does not stimulate an increase in type I collagen production (36). Now it appears that the B1 receptor system plays a distinct role in wound repair, causing a rise in cytosolic Ca²⁺, stabilizing CTGF mRNA, stimulating an increase in 1(I) collagen mRNA, and stimulating collagen production. The potential pathophysiological role of the B1 receptor in the development of fibrosis is intriguing. The B1 receptor is up-regulated at sites of inflammation and appears to be refractory to desensitization (1). These characteristics, together with the pro-fibrotic effects reported here, suggest that activation of the B1 receptor may contribute to the excess collagen deposition associated with chronic inflammatory conditions such as asthma and pulmonary fibrosis.

	FOOTNOTES

^* This work was supported in part by NHLBI Grant P50HL56386 from the National Institutes of Health and by the Veterans Affairs Medical Center Merit Review Research Program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported by NIDDK Grant R03DK53538 from the National Institutes of Health.

^** Boston Veterans Affairs Medical Center Research Enhancement Awards Program Fellow.

^§ To whom correspondence should be addressed: Pulmonary Center, Boston University School of Medicine, 715 Albany St., R3, Boston, MA 02118-2394. Tel.: 617-638-4860; Fax: 617-536-8093l; E-mail: ricupero@ bu.edu.

	ABBREVIATIONS

The abbreviations used are: BK, bradykinin; TGF-, transforming growth factor ; CTGF, connective tissue growth factor; TPA, 12-O-tetradecanoylphorbol-13-acetate; FBS, fetal bovine serum; DMEM, Dulbecco's modified Eagle's medium; MLEC, mink lung epithelial cell; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GM-CSF, granulocyte-macrophage colony-stimulating factor; CHX, cycloheximide.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				D. Westermann, T. Walther, K. Savvatis, F. Escher, M. Sobirey, A. Riad, M. Bader, H.-P. Schultheiss, and C. Tschope Gene Deletion of the Kinin Receptor B1 Attenuates Cardiac Inflammation and Fibrosis During the Development of Experimental Diabetic Cardiomyopathy Diabetes, June 1, 2009; 58(6): 1373 - 1381. [Abstract] [Full Text] [PDF]

				J. Klein, J. Gonzalez, J. Duchene, L. Esposito, J. P. Pradere, E. Neau, C. Delage, D. Calise, A. Ahluwalia, P. Carayon, et al. Delayed blockade of the kinin B1 receptor reduces renal inflammation and fibrosis in obstructive nephropathy FASEB J, January 1, 2009; 23(1): 134 - 142. [Abstract] [Full Text] [PDF]

				S. Helske, M. Laine, M. Kupari, J. Lommi, H. Turto, L. Nurmi, I. Tikkanen, K. Werkkala, K. A. Lindstedt, and P. T. Kovanen Increased expression of profibrotic neutral endopeptidase and bradykinin type 1 receptors in stenotic aortic valves Eur. Heart J., August 1, 2007; 28(15): 1894 - 1903. [Abstract] [Full Text] [PDF]

				S. B. Phagoo, K. Reddi, B. J. Silvallana, L. M. F. Leeb-Lundberg, and D. Warburton Infection-Induced Kinin B1 Receptors in Human Pulmonary Fibroblasts: Role of Intact Pathogens and p38 Mitogen-Activated Protein Kinase-Dependent Signaling J. Pharmacol. Exp. Ther., June 1, 2005; 313(3): 1231 - 1238. [Abstract] [Full Text] [PDF]

				I. Liesmaa, A. Kuoppala, N. Shiota, J. O. Kokkonen, K. Kostner, M. Mayranpaa, P. T. Kovanen, and K. A. Lindstedt Increased expression of bradykinin type-1 receptors in endothelium of intramyocardial coronary vessels in human failing hearts Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2317 - H2322. [Abstract] [Full Text] [PDF]

				J. R. Romero, A. Rivera, V. Lanca, M. D. P. Bicho, P. R. Conlin, and D. A. Ricupero Na+/Ca2+ Exchanger Activity Modulates Connective Tissue Growth Factor mRNA Expression in Transforming Growth Factor {beta}1- and Des-Arg10-kallidin-stimulated Myofibroblasts J. Biol. Chem., April 15, 2005; 280(15): 14378 - 14384. [Abstract] [Full Text] [PDF]

				L. M. F. Leeb-Lundberg, F. Marceau, W. Muller-Esterl, D. J. Pettibone, and B. L. Zuraw International Union of Pharmacology. XLV. Classification of the Kinin Receptor Family: from Molecular Mechanisms to Pathophysiological Consequences Pharmacol. Rev., March 1, 2005; 57(1): 27 - 77. [Abstract] [Full Text] [PDF]

				A Del Rosso, O Distler, A F Milia, C Emanueli, L Ibba-Manneschi, S Guiducci, M L Conforti, S Generini, A Pignone, S Gay, et al. Increased circulating levels of tissue kallikrein in systemic sclerosis correlate with microvascular involvement Ann Rheum Dis, March 1, 2005; 64(3): 382 - 387. [Abstract] [Full Text] [PDF]

				G. Morissette, J.-P. Fortin, S. Otis, J. Bouthillier, and F. Marceau A Novel Nonpeptide Antagonist of the Kinin B1 Receptor: Effects at the Rabbit Receptor J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 1121 - 1130. [Abstract] [Full Text] [PDF]

				D. Iwanciw, M. Rehm, M. Porst, and M. Goppelt-Struebe Induction of Connective Tissue Growth Factor by Angiotensin II: Integration of Signaling Pathways Arterioscler. Thromb. Vasc. Biol., October 1, 2003; 23(10): 1782 - 1787. [Abstract] [Full Text] [PDF]

				M. Utsugi, K. Dobashi, T. Ishizuka, K. Masubuchi, Y. Shimizu, T. Nakazawa, and M. Mori C-Jun-NH2-Terminal Kinase Mediates Expression of Connective Tissue Growth Factor Induced by Transforming Growth Factor-{beta}1 in Human Lung Fibroblasts Am. J. Respir. Cell Mol. Biol., June 1, 2003; 28(6): 754 - 761. [Abstract] [Full Text] [PDF]

				C. R. Harlow, L. Davidson, K. H. Burns, C. Yan, M. M. Matzuk, and S. G. Hillier FSH and TGF-{beta} Superfamily Members Regulate Granulosa Cell Connective Tissue Growth Factor Gene Expression in Vitro and in Vivo Endocrinology, September 1, 2002; 143(9): 3316 - 3325. [Abstract] [Full Text] [PDF]

				S. C. Christiansen, J. Eddleston, K. M. Woessner, S. S. Chambers, R. Ye, Z. K. Pan, and B. L. Zuraw Up-Regulation of Functional Kinin B1 Receptors in Allergic Airway Inflammation J. Immunol., August 15, 2002; 169(4): 2054 - 2060. [Abstract] [Full Text] [PDF]

				J. HEUSINGER-RIBEIRO, M. EBERLEIN, N. A. WAHAB, and M. GOPPELT-STRUEBE Expression of Connective Tissue Growth Factor in Human Renal Fibroblasts: Regulatory Roles of RhoA and cAMP J. Am. Soc. Nephrol., September 1, 2001; 12(9): 1853 - 1861. [Abstract] [Full Text] [PDF]

				S. KONDO, S. KAGAMI, H. KIDO, F. STRUTZ, G. A. MULLER, and Y. KURODA Role of Mast Cell Tryptase in Renal Interstitial Fibrosis J. Am. Soc. Nephrol., August 1, 2001; 12(8): 1668 - 1676. [Abstract] [Full Text] [PDF]

				A. Hahn, J. Heusinger-Ribeiro, T. Lanz, S. Zenkel, and M. Goppelt-Struebe Induction of Connective Tissue Growth Factor by Activation of Heptahelical Receptors. MODULATION BY Rho PROTEINS AND THE ACTIN CYTOSKELETON J. Biol. Chem., November 22, 2000; 275(48): 37429 - 37435. [Abstract] [Full Text] [PDF]

				K. Suzuma, K. Naruse, I. Suzuma, N. Takahara, K. Ueki, L. P. Aiello, and G. L. King Vascular Endothelial Growth Factor Induces Expression of Connective Tissue Growth Factor via KDR, Flt1, and Phosphatidylinositol 3-Kinase-Akt-dependent Pathways in Retinal Vascular Cells J. Biol. Chem., December 22, 2000; 275(52): 40725 - 40731. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ricupero, D. A. Articles by Goldstein, R. H. Search for Related Content PubMed PubMed Citation Articles by Ricupero, D. A. Articles by Goldstein, R. H. Social Bookmarking                      What's this?