|
J Biol Chem, Vol. 275, Issue 17, 12917-12925, April 28, 2000
Mechanistic Studies of the Effects of Anti-factor H
Antibodies on Complement-mediated Lysis*
Michael J.
Corey §,
Robert J.
Kinders ,
Cristina M.
Poduje¶,
Connie L.
Bruce ,
Halli
Rowley ,
Lisha G.
Brown ,
G. Michael
Hass , and
Robert L.
Vessella
From Bion Diagnostic Sciences, Redmond, Washington
98052 and the Departments of ¶ Microbiology and Urology,
University of Washington, Seattle, Washington 98195
 |
ABSTRACT |
We have recently reported that complement factor
H, a negative regulator of complement-mediated cytotoxicity, is
produced and secreted by most bladder cancers. This observation was
exploited in the development of the BTA statTM and BTA TRAKTM
diagnostic assays, both of which make use of two factor H-specific
monoclonal antibodies in sandwich format. Here we show that both
antibodies exert interesting effects on the biochemistry of complement
activation in in vitro systems. Antibody X13.2 competes
with C3b for association with factor H and strongly inhibits factor
H/factor I-mediated cleavage of C3b, thereby evidently inactivating a
negative regulator of complement; yet, the antibody strongly inhibits
complement-mediated lysis as well. Conversely, antibody X52.1, which
does not compete with C3b and has no effect on solution-phase cleavage
of C3b, is capable of enhancing complement-mediated lysis of various
cell types, including cancer cells, by over 10-fold. Our observations indicate that it is possible to deconvolute the biochemical roles of
factor H in complement by means of appropriate inhibitors, a finding
with potentially valuable implications for both basic research and
cancer therapy.
 |
INTRODUCTION |
Factor H, a soluble negative regulator of the complement system,
is produced and secreted by most transitional cell carcinomas of the
bladder (1-3). Complement factor H
(FH)1 is a 150-kDa protein
whose structure and biological roles have been well described (Refs.
4-6; for descriptions of the complement system, see Refs. 7-11). We
recently reported that a number of human cancer cell lines produce and
secrete either FH or closely related FH variants with FH biochemical
activity (1). In situ hybridization experiments have shown
that bladder tumors also produce FH message, while normal bladder
epithelium produces little or no message (12). However, the
significance of this phenomenon with regard to both biochemistry and
cancer biology remains to be established. It is not known, for example,
whether complement is able to act against bladder cancer (transitional
cell carcinoma or TCC), or whether secretion of FH enables the tumor to
ward off the attack of complement. Still, the observation of FH
expression in a high percentage of patients with even low grade TCC may
indicate that FH plays an important role in tumor survival.
FH-mediated regulation is thought to be important in controlling
inappropriate activation of the alternative pathway of complement (APC;
Refs. 13 and 14). Briefly, the classical pathway of complement
activation is generally antibody-dependent, while the alternative pathway is activated by the presence of negatively charged
macromolecules with repetitive structures, such as mannans or bacterial
cell walls. The central activating protein in both complement pathways
is C3. A normal constituent of blood, C3 can be spontaneously activated
by hydrolysis of an internal thioester bond, or can be selectively
activated by the complement cascade (7, 9, 11). The activated form is
designated C3b (or C3(H2O) for the spontaneously activated
form). Activated C3 species direct other complement proteins to an
appropriate target by associating either with specific receptors or
with certain structures that constitute recognition motifs, such as the
carbohydrates elaborated from the surfaces of yeast and bacteria (15).
Activated C3 bound to a target cell or macromolecular structure
provides both an anchoring point and a biochemical component of the
"C3 convertase," a complex of activated C3 units and Bb fragments
(16). The C3 convertase has proteolytic activity which is absent or
minimally present in the separate proteins; as a complex, the
convertase catalytically activates further C3 molecules, leading to a
cascade effect and eventually to formation of the membrane attack
complex by the downstream complement proteins. In principle, complement can lyse any cell that exhibits a C3b target, including the normal cells of the host, but the process is ordinarily held in check both by
solution-phase control of the concentration of activated C3 species and
by regulatory proteins that act to suppress the cascade even after
immobilization of activated C3. FH plays an important role in each form
of regulation; it acts with factor I in cleaving activated C3 species
to inactive forms, and it is also capable of causing dissociation of
the constituents of the C3 convertase and thereby hindering
autocatalytic activation of the APC.
There are a number of reports of up-regulation of membrane-bound
regulators of complement activation in cancer (17-22). One model of
expression of regulators of complement activation, including FH, in
cancer holds that their up-regulation could enhance the ability of
cancer cells to escape lysis by the immune system (immune surveillance;
Refs. 23 and 24). Our interest in the biological basis of FH production
and in the potential of FH as a therapeutic target has led us to
investigate the effects of anti-FH monoclonal antibodies (mAbs) on
complement activation and to probe certain biochemical details of their
mechanisms of action. In this report, we describe the effects of an
unusual anti-FH mAb on complement-mediated lysis of both erythrocytes
and cancer cell lines and analyze its mode of action using purified
complement components and other cell-free systems. A serendipitous
product of intensive hybridoma procedures, the X52.1 mAb, in addition
to serving as a critical component of a diagnostic test for
transitional cell carcinoma of the bladder, has allowed us to enhance
complement-mediated lysis by up to 15-fold. However, the mAb evidently
does not affect the solution-phase control mechanism by which FH
reverses spontaneous activation in the bloodstream; instead our
evidence indicates that X52.1 specifically protects the C3 convertase
from disruption by FH. Two other mAbs with contrasting modes of action
(X13.2, X46.3) are also described. If it proves possible to separate
the biochemical processes of complement activation with single
reagents, it is reasonable to hope for the development of new
therapeutic strategies to treat both cancer and various infectious
pathologies that take advantage of inappropriate suppression of
complement activity.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Human complement serum, factor B-depleted human
serum, zymosan, sensitized sheep erythrocytes, other miscellaneous
chemicals, and ATP assay reagent (50 mM Tricine, 10 mM MgSO4, 1 mM EDTA, 100 µM dithiothreitol, 1 mg/ml bovine serum albumin, 66 µg/ml luciferase, 590 µM luciferin as reconstituted)
were purchased from Sigma. C2-depleted serum was purchased from
Advanced Research Technologies (San Diego, CA). Rabbit erythrocytes
(RE) for activity assays of the APC were isolated from rabbit blood
which was purchased from Colorado Serum Co., Denver, CO. Immobilized
trypsin used to activate C3 was purchased from Pierce. Polyacrylamide
gels for gel electrophoresis were purchased from Novex (San Diego, CA).
Monoclonal Antibodies--
mAbs X13.2, X46.3, and X52.1 were
generated by immunization of mice with the S-300 fraction of the urine
of TCC patients and subsequent hybridoma procedures, which have been
fully described (1). Control mAb MOPC-21 was grown from a hybridoma
originally purchased from the American Type Culture Collection.
Western Blot Characterization of mAbs--
The specificities of
X52.1 and X13.2 were further characterized by Western blots of tryptic
fragments of FH, transferred to polyvinylidene difluoride membranes.
The mAbs were detected with an alkaline phosphatase-linked goat
anti-mouse polyclonal antibody (human serum-absorbed, Kierkegaard & Perry, Gaithersburg, MD) and TMB substrate, and scanned with a Bio-Rad
GelDoc densitometer. The Profile Analyst II program was used to
calculate molecular weights. Similar blots performed with other
complement proteins as targets established that X46.3 is specific for
the chain of C3.
Cell Lines--
HL-60, LS174T, Raji, HTB5, HTB9, T-24, and RT4
were obtained from the American Type Culture Collection and maintained
according to the cell line-specific protocols. Puromycin treatment of
Raji was as described previously (25), except that we treated the cells
with puromycin for only 5 h, because we found that this was
sufficient to render the cells highly susceptible to
complement-mediated lysis.
RT-PCR Analysis of Expression of Decay Accelerating Factor
(DAF)--
cDNA was prepared from 2-3 µg of total cellular RNA
of various cancer cell lines according to the kit manufacturer's
protocol (Perkin-Elmer, Foster City, CA). The reverse transcription
(RT) reaction was carried out at 42 °C for 90 min. PCR amplification of DAF message (40 cycles, 94°/15 s, 62°/30 s, 72°/90 s; 10 µl of the RT reaction into a 100-µl PCR) was performed with the
primer pair ATGATGAAGGAGAGTGGAGTGG and CTCCTTGCTCTGTTGACATTCC;
each primer was used at a final concentration of 0.3 µM in the reaction mixture. Identity of the amplicon was
confirmed by automated sequencing. RT-PCR detection of FH expression
was described previously (1).
Assays of Cofactor Activity of Factor H Using Purified Complement
Components--
These assays were performed as in Ref. 1, except that
mAbs were added as indicated to a final concentration of 2.6 or 5.2 µM. In the control experiment designed to detect protease
contamination of the X52.1 preparation that might mimic the action of
the C3 convertase, either factor I or factor H was omitted from the
reaction, and 1-50 µg of mAb X52.1 was substituted.
Preparation of Rabbit Erythrocytes--
Rabbit blood was used
less than 3 weeks after it was drawn. RE were gently resuspended,
diluted into 24 volumes of gelatin veronal buffer (GVB: 0.15 mM CaCl2 141 mM NaCl, 0.5 mM MgCl2, 0.1% gelatin, 1.8 mM
sodium barbital, 3.1 mM barbituric acid, pH 7.3-7.4), and
centrifuged for 5 min at 600 × g. The supernatant was
discarded, and the erythrocyte pellet was again diluted into the same
volume of GVB and centrifuged for 10 min at 600 × g. The pellet was diluted into the same volume of GVB for use. RE were
counted and used at 2-3 × 108/ml (prior to addition
to the complement reaction).
Hemolytic Assays--
Hemoblogin-release assays were performed
with RE (APC) or sensitized sheep erythrocytes (classical pathway). A
typical APC assay contained 1/20 volume of complement serum, 6 mM EGTA, 4 mM MgCl2, and mAbs
diluted in GVB to final volume before addition of erythrocytes, which
were added in 0.5 volume. The EGTA and MgCl2 were mixed to
a 3:2 ratio and titrated separately to pH 7.4 before dilution to a
20-fold working solution in order to avoid proton-release effects in
the complement reaction. Reactions were preincubated for 90-100 min
prior to addition of erythrocytes. Pilot studies indicated that this
preincubation enhanced the effect of X52.1 on the complement reaction,
probably by allowing formation of a pool of activated C3; additional
preincubation had little effect. The degree of enhancement was
dependent on the age of the complement preparation. In our view this
represents a reasonable model of the biochemical environment of a solid
tumor, such as a transitional cell carcinoma, where any complement
proteins present must have slowly diffused from a spatially removed
blood vessel. RE or sensitized sheep erythrocytes, previously
equilibrated in GVB at 2-3 × 108/ml, were added in
0.5 volume, and the reaction was incubated at 37 °C with mild
shaking. Absorbance was measured by removing aliquots in staggered
fashion to tubes on ice (to assure equal incubation times),
centrifugation at 1000 × g for 3 min, and removal of
cell-free supernatants to a microtiter plate, which was read at 405 or
410 nm.
Lysis of Nucleated Cells--
Nucleated cells were lysed by
addition of 10-50% complement serum (preincubated with or without mAb
as above) to cell culture media, followed by incubation at 37 °C for
50 min to 4 h. In initial experiments on the HL-60 and LS174T cell
lines, cytotoxicity was measured by exclusion of trypan blue from live
cells; live and dead cells were counted immediately after aliquots were
taken for analysis and the ratio was determined. Subsequently the rapid glyceraldehyde-3-phosphate
dehydrogenase/phosphoglycerokinase/luciferase luminescent cytotoxicity
assay, with a limit of detection of approximately 0.03 human nucleated
cell lysis, was developed (26) and used to measure lysis of Raji,
LS174T, and three bladder-cancer cell lines (HTB-5, T-24, RT4).
EIA--
mAbs were conjugated with alkaline phosphatase,
yielding an average of two AP molecules per mAb molecule (1), and the
conjugates were detected by measuring hydrolysis of
p-nitrophenyl phosphate at 405 nm after performance of EIA
by techniques previously described (1). In the "homologous" EIA
format, intended to detect multiple sites of association for each mAb,
the same mAb was used for both coating and detection (the latter with
the mAb-alkaline phosphatase conjugate).
Measurement of Kd(app)--
Apparent dissociation
constants of mAb-FH complexes were measured by direct titration in
sandwich EIA (sEIA) format and the data were reduced by Equation 1 or
2, as described previously (27). Because of the possibility that
directly immobilized FH would be structurally distorted and would not
yield accurate results, measurement of
Kd(app) for X52.1 was determined by
immobilizing X13.2 for capture of FH, and vice versa. To
measure the Kd(app) of X52.1, the
X52.1-alkaline phosphatase conjugate was added in 2-fold serial
dilutions over the concentration range 0-2.5 nM to a
microtiter plate coated with 1 µg/ml X13.2, which had been preincubated for 4 h with 2 µg/ml FH. The
Kd(app) of X13.2 was measured by adding
the X13.2-alkaline phosphatase conjugate (0-2.5 nM) to
immobilized X52.1 (0.11 µg/ml) and FH as above. The lowest
concentrations of coating antibodies that yielded a reliable signal
were used to minimize ligand depletion. Nevertheless, such measurements
cannot be assumed to yield accurate dissociation constants for the
solution-phase complexes, for several reasons: 1) the alkaline
phosphatase conjugate may not bind as well as the free molecule; 2) the
dissociation constants of the two antibodies are convoluted in the
result, since dissociation of either the X13.2-FH or X52.1-FH complex
leads to loss of signal in each case; 3) the antigen immobilized in a
microtiter well and "displayed" by a coating antibody may be
sterically hindered from forming the strongest possible association
with the detection antibody. However, the actual Kd
is likely to be stronger than the
Kd(app) measured by these methods, since
all of these effects tend to weaken the association. It is therefore
fairly safe to assume that the measured
Kd(app) is an upper bound on the
Kd of the weaker of the two associations. [FH] in
the equations is the effective concentration of immobilized FH (which
can be fit as a disposable parameter under ligand-depletion conditions), A0 is the observed absorbance value
(or rate of change of absorbance-see below) with no added conjugate,
and Amax is the fit asymptote of the absorbance data.
Two equations were used for reduction of the association data. Equation 1 is the Michaelis-Menten equation with an adjustment for the
zero-ligand value. Equation 2 is similar, but contains a quadratic
correction to account for the difference between the known, total
quantity of added ligand (mAb conjugate) and the actual concentration
of free ligand. There is a significant difference between the two only
if the quantity of active, captured target (FH) is not negligible with
regard to the size of the free-ligand pool and the
Kd (see Ref. 27 for more detail). In the data sets
used for measurement of Kd(app),
non-linear regression to Equation 2 yielded a fit target concentration
that was indistinguishable from zero in all cases, indicating that ligand depletion was negligible.
|
(Eq. 1)
|
|
(Eq. 2)
|
We therefore used Equation 1 to calculate the reported
Kd(app). The
Kd(app) of X13.2 was determined either with single ELISA readings at 405 nm, or by taking readings at six time
points and using the slope of the linear fit as the signal. The latter
is slightly superior in terms of accuracy, but involves much more data
reduction (27). The Kd of X52.1 was determined by
combining three runs, using the latter method. mAb X52.1 was
immobilized at 0.35 µg/ml for capture of FH with or without C3b and
subsequent titration with AP-conjugated X13.2. In contrast to these
experiments, the experiments using varying FH concentrations that led
to Fig. 5 were performed with larger concentrations (5 µg/ml) of
coating mAb, and much better fits were obtained with the
ligand-depletion equation (Equation 2), indicating that the amount of
active, immobilized target was not negligible with respect to the
concentration of ligand (FH) under these conditions.
In separate experiments designed to detect multiple sites of
association with FH, each mAb was coated on the plate at 2 µg/ml (100 µl/well), then probed with its own alkaline phosphatase conjugate (0-100 nM) in the presence of saturating FH
("homologous" format). For X52.1, this experiment was also
performed with and without competing unlabeled X13.2 (0-3
µM) to examine the possibility that the secondary site of
X52.1 might overlap one of the X13.2 sites.
Kd(app) in these experiments was
calculated with Equation 1.
Zymosan Fixation Assays--
Zymosan (a component of yeast cell
walls that strongly activates the APC) was incubated with complement
and 6 mM EGTA, 4 mM MgCl2
(separately titrated to pH 7.4) with or without added mAb for various
lengths of time. The zymosan was then pelleted, washed twice with GVB,
and resuspended in Laemmli buffer for SDS-PAGE; these gels were
silver-stained, and the C3 chain was identified by comparison with
literature data (7). The supernatant was analyzed by Western blots,
using an mAb (X46.3) specific for the C3 chain (1).
Statistical Analysis--
While the effect of X52.1 on T-24
lysis was robust from day to day, position effects were observed on the
ELISA plates used for growth of the cells. We therefore used proximate
pairs of wells to measure lysis ± X52.1, and the data were
analyzed by two-tailed, paired t test. Linear regression was
performed with CricketGraph 1.3. Non-linear regression to Equations 1
and 2 was performed with JMP 3.1 (SAS Institute, Inc., Cary, NC).
 |
RESULTS |
Antibody Specificity--
EIAs performed in the process of
screening the antibody panels showed that mAb X46.3 was specific for
the C3 chain and exhibited no detectable cross-reactivity with FH.
The specificity of X52.1 and X13.2 was previously determined (1); these
mAbs do not cross-react with C3, C3-derived fragments or other
complement proteins. They appear to be specific for human FH.
Mapping of Sites of Antibody Association--
According to data
from Western blots, mAb X52.1 associated with the 120-kDa and 48-kDa
fragments of trypsinized FH, consistent with assignment of its primary
site of association to SCR domains 15-20 of FH. mAb X13.2 associated
with the same fragments, and also with the 38-kDa fragment reported to
contain SCRs 1-5, as well as the factor I cofactor activity of FH
(28). No secondary site of association for X52.1 was seen in Western
blot experiments.
RT-PCR--
Results of RT-PCR detection of FH (1) and DAF messages
are presented in Table I.
View this table:
[in this window]
[in a new window]
|
Table I
Enhancement of lysis of various cell types by X52.1
Correlations of expression of DAF and/or FH with enhancement of lysis
by X52.1 are shown. Reactions contained 6 mM EGTA, 4 mM MgCl2.
|
|
Lysis of Nucleated Cells--
In our initial complement tests with
nucleated cells, we studied the effects of X52.1 on lysis of the
promyelocytic leukemia line HL-60, using a dye-exclusion assay to
measure cell death. The presence of X52.1 (22 nM) enhanced
complement-mediated lysis of this cell line by 73%. Subsequently we
developed an ultra-sensitive luminescent assay for cell death and
membrane damage, which we used to observe an 11-fold enhancement of
complement-mediated killing of puromycin-treated Raji cells by X52.1
versus the complement-only background (26). Untreated Raji
cells were much less sensitive to complement-mediated lysis than
puromycin-treated Raji, but X52.1 still enhanced the rate of lysis by
approximately 12-fold (Table I). We also wished to extend the results
to TCC cell lines. HTB-5, which expresses no detectable FH (1) and low
levels of DAF (Table I), was very readily killed by complement, but no
effect of X52.1 was seen, probably because the cells' poor defense
against complement leads to such a rapid rate of lysis that any
enhancement is not quantifiable. RT-4, which expresses very high levels
of FH, exhibited a variable response to complement, and again, it was
not possible to identify a separate effect of X52.1 on lysis. However,
T-24, which expresses intermediate levels of FH, was lysed by
complement, and the effect was enhanced by X52.1. Table I presents a
summary of the lysis data and effects of X52.1 by cell type.
Effects of Monoclonal Antibodies on FH/Factor I-mediated Cleavage
of C3b in Purified System--
Fig. 1
shows the effects of various monoclonal antibodies on the cleavage
reaction in a purified system. In this system, factor I and FH form a
complex that cleaves the C3b -chain to the iC3b fragments of 68 kDa and 43 kDa (lane 2 versus
lane 1). X13.2 (anti-FH), X46.3 and X87.2
(anti-C3 antibodies) strongly inhibit this process at 5.2 µM, as shown by the strong "C3b, " bands and the
low levels of the two iC3b bands in lanes 10,
4, and 8, respectively. 2.6 and 5.2 µM mAb X52.1 did not inhibit FH/factor I-mediated
cleavage (lanes 5 and 6).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 1.
Effects of mAbs on FH cofactor activity.
mAbs were added as indicated to measure the extent to which they
inhibited FH cofactor activity in cleaving C3b (30 min at 37 °C.)
Lane 1, 1.1 µM C3b, 1.5 µM
factor I; lane 2, 1.1 µM C3b, 1.5 µM factor I, 178 nM FH; lane
3, 1.1 µM C3b, 1.5 µM factor I,
178 nM FH, 2.6 µM X46.3; lane
4, 1.1 µM C3b, 1.5 µM factor I,
178 nM FH, 5.2 µM X46.3; lane
5, 1.1 µM C3b, 1.5 µM factor I,
178 nM FH, 2.6 µM X52.1; lane
6, 1.1 µM C3b, 1.5 µM factor I,
178 nM FH, 5.2 µM X52.1; lane
7, 1.1 µM C3b, 1.5 µM factor I,
178 nM FH, 2.6 µM X87.2; lane
8, 1.1 µM C3b, 1.5 µM factor I,
178 nM FH, 5.2 µM X87.2; lane
9, 1.1 µM C3b, 1.5 µM factor I,
178 nM FH, 2.6 µM X13.2; lane
10, 1.1 µM C3b, 1.5 µM factor I,
178 nM FH, 5.2 µM X13.2.
|
|
Hemolytic Assays--
Results using both X13.2 and X52.1 with RE
at the lysis target (29, 30) were in sharp contrast to those observed
with purified complement components. X13.2 was seen to be a strong inhibitor of complement-mediated hemolysis. However, X52.1 enhanced hemolysis by as much as 15-fold (Fig. 2),
although titration to higher concentrations revealed that the effects
of this mAb were biphasic, with inhibition of cell lysis observed at
higher concentrations. We subsequently performed a number of control
experiments to rule out trivial explanations of the phenomena (listed
in Table II).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 2.
Enhancement of complement-mediated hemolysis
by X52.1. Concentration and time dependence of enhancement by
X52.1 were determined by measuring hemoglobin release. 1/20 volume of
complement serum was incubated in GVB with 6 mM EGTA/4
mM MgCl2 (separately titrated to pH 7.4) and
varying concentrations of X52.1 for 96 min before addition of 0.5 volume of rabbit erythrocytes in GVB (2.0 × 108/ml).
60-µl aliquots from which the erythrocytes had been removed by
centrifugation were read at 410 nm. , 45 min; , 88 min. Data were
taken in duplicate; error bars are S.D.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
Summary of hemolysis results and control procedures
Effects on classical and alternative pathways were separated by using
factor B-depleted serum (classical only), C2-depleted serum
(alternative only), or 6 mM EGTA, 4 mM
MgCl2, separately titrated to pH 7.4 (alternative only). Rabbit
erythrocytes were used to measure alternative activity,
antibody-activated sheep erythrocytes for classical.
|
|
To investigate in detail the slight time-dependent shift in
hemolytic enhancement seen in Fig. 2, we performed an experiment in
which the profile of hemolytic rates versus X52.1
concentration was measured at five time points (Fig.
3). Rates are reported both directly and
as corrected (normalized) to the quantity of intact RE remaining in the
reaction (determined by complete lysis of the RE in
H2O).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 3.
Time-dependent shift in
concentration of maximum enhancement of hemolysis by X52.1. The
experiment of Fig. 2 was repeated with two modifications; five time
points were taken, and the data are shown as average rates of hemolysis
over the indicated intervals, plotted at the midpoint of the interval
between the two actual time points. Data in normalized curves have been
corrected for the number of erythrocytes remaining.
|
|
EIA--
EIA in sandwich assay format very similar to that
employed in the commercial diagnostic kits based on FH yielded the
following results. C3b competes with X13.2 for association with FH
(Fig. 4). Measured values of
Kd(app) of FH-mAb complexes are as
follows: X13.2, 325 ± 76 pM; X52.1, 181 ± 37 pM; X13.2 in the presence of 11.3 nM C3b,
1.21 ± 0.21 nM. Using a higher coating concentration
of X13.2, it was also possible to observe a >5-fold increase in the
apparent affinity of X52.1 for FH in the presence of C3b
(Kd(app) = 202 ± 87 pM
versus 1.172 ± 0.424 nM; Fig.
5), despite the fact that C3b competes
for FH with X13.2. Because of the larger concentration of coating
antibody, these data required a three-parameter fit to Equation 2
instead of the two-parameter fit permitted by use of Equation 1.
Further studies conducted during initial characterization of the mAbs
showed that immobilized C3b and the X52.1-AP conjugate form a very
strong "sandwich" for FH (Kd(app) < 1 nM), while the X13.2-AP conjugate in the same system
yields a 20-fold weaker signal at a 4-fold greater
concentration.2

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of C3b on apparent dissociation
constant of X13.2-FH complex. Two-fold serial dilutions of
X13.2-alkaline phosphatase conjugate were added to the immobilized
X52.1-FH complex with or without 11.3 nM C3b and detected
after washing by addition of p-nitrophenyl phosphate
substrate and measurement of A540. Measurements
were taken over a period of 60 min, and linear fits determined the rate
of substrate hydrolysis; the slopes, corrected for a very small
no-ligand rate, were used as input to non-linear regression to Equation 1. Errors are S.D. of three runs. , C3b; , +C3b.
|
|

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 5.
Increase in X52.1-FH affinity attributable to
C3b. ELISA was performed with X13.2 coating mAb (5 µg/ml), FH
titrated as indicated, and finally 15 nM X52.1-alkaline
phosphatase conjugate (added with or without 50.8 nM C3b).
, C3b; , +C3b.
|
|
Secondary sites of association with FH were demonstrated for each mAb
by sEIA performed in an homologous configuration, in which a single mAb
is used along with its AP conjugate as both capture and detection
reagent. These experiments were repeated with competition by varying
concentrations of the other mAb (X52.1 for the X13.2 homologous format,
and vice versa). Kd(app) was
found to be in the range of 10 nM in each case (30-50-fold weaker than the primary sites). Competition by 93 nM or
higher concentrations of X13.2 completely abolished association of
X52.1 with its secondary site, indicating that this site is proximate to one of the X13.2 sites (see "Discussion"). Both mAbs exhibited strong affinity for FH captured by immobilized C3b.
Acceleration of Zymosan Fixation of C3b--
A second documented
biological role of FH, apart from its cofactor activity, is disruption
of the C3 convertase (15). If X52.1 were capable of protecting this
convertase from FH, then it should be possible to observe an increase
in the rate of appearance of C3-related fragments on zymosan particles
in the presence of X52.1, concomitant with more rapid disappearance of
C3 and/or C3b from solution. Figs. 6 and
7 show the increased rate of
disappearance of C3b from solution with X52.1 present and the
concomitant appearance of a 70-kDa fragment corresponding to the C3b
chain on zymosan particles (7).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6.
Acceleration of disappearance of C3 from
solution by X52.1. Zymosan (5 mg/ml) was incubated with 40%
complement in GVB at 37 °C with or without added X52.1 (100 nM). Aliquots were pelleted, washed twice with GVB, and
resuspended in Laemmli buffer for SDS-PAGE and silver staining (Fig.
7). Supernatant was run on SDS-PAGE for transfer to polyvinylidene
difluoride and Western blotting using X46.3 (anti-C3 chain).
Lane 1, 5 min, no X52.1; lane 2, 5 min, 100 nM X52.1; lane 3, 30 min, no
X52.1; lane 4, 30 min, 100 nM X52.1;
lane 5, C3 standard.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 7.
Acceleration of fixation of C3b on zymosan by
X52.1. Silver-stained zymosan pellets (see Fig. 6 legend).
Lane 1, 10 min, no X52.1; lane 2, 10 min, 100 nM X52.1; lane 3, 15 min, no
X52.1; lane 4, 15 min, 100 nM X52.1;
lane 5, 20 min, no X52.1; lane
6, 20 min, 100 nM X52.1 .
|
|
 |
DISCUSSION |
The results of lysis studies with human cancer-derived cell lines
were both promising and informative. Of the six cell lines studied, two
(T-24, RT4) express both DAF and large amounts of FH, two (HL-60,
LS174T) express DAF but not FH, and two (Raji, HTB5) express no DAF or
FH. Ease of complement-mediated lysis was inversely correlated with
expression of both DAF and FH (Table I), but it proved possible to
enhance lysis with the anti-FH mAb X52.1 in one line from each group
(T-24, HL-60, Raji). In sharp contrast, the X13.2 mAb, although an
effective inhibitor of solution phase FH activity, was ineffective
against cellular targets.
mAbs X52.1 and X13.2 were tested further in various ways, including
studies of cleavage of C3b using purified components, hemolytic assays
with rabbit erythrocytes, EIA, and analysis of zymosan-induced
complement fixation. The rather surprising finding that X13.2, which
strongly inhibits solution-phase cleavage of C3b (Figs. 1 and
8A), actually inhibited
complement-mediated hemolysis was soon followed by the observation that
X52.1, which has no effect on cleavage of C3b in the purified system,
was a strong enhancer of hemolysis at concentrations as low as 3.3 nM (using 1:20 complement). These results strongly suggest
that X52.1 acts by a mechanism other than preventing solution-phase
cleavage of activated C3, and this hypothesis is further supported by
the fact that the serum concentration of FH is >2 µM
(31), or >100 nM at the 1:20 dilution employed in the
hemolysis experiments. It is unlikely that a 13 nM antibody
could inactivate a large enough fraction of a 100 nM
soluble FH pool to lead to a 15-fold enhancement of lysis (Fig. 2).
This unusual stoichiometry implied that there was a subset of the FH
pool for which X52.1 had much higher affinity. Mapping of the sites of
association of the mAbs by Westerns against tryptic fragments of FH
demonstrated that both the X52.1 high affinity site and a low affinity
site for X13.2 lie within domains 15-20 of FH; the high affinity site
for X13.2 is probably within domains 1-5. Structural and biochemical evidence has shown that there are three sites of association for C3b on
the FH molecule. Each of the sites may play a distinct role in
complement control (32); it is therefore not surprising that antibodies
which bind to different parts of the FH molecule appear to affect
different modes of FH activity.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 8.
Proposed modes of action of mAbs in
complement activation and control. A, solution-phase
effects. X13.2 inhibits solution-phase cleavage of activated C3
(represented here by C3b); X52.1 has no effect. FI,
complement factor I. B, schematic depiction of
decay-accelerator activity of FH against the C3 convertase.
C, in the presence of X52.1, FH still associates with C3b
but evidently does not dissociate the convertase. The inhibitory modes
of the mAbs are not shown.
|
|
Since the activities of X52.1 are difficult to explain by invoking
solution-phase mechanisms alone, and since the phenomena are not seen
when FH is absent (Table II), the biochemically effective target of
X52.1 in the lysis experiments may be the specific subclass of the FH
population which is in association with activated C3 at the cell
surface (i.e. as part of the C3 convertase). This could
explain the unusual stoichiometry of the X52.1 lysis enhancement, especially if the mAb were found to have higher affinity for FH that is
associated with C3b than for FH alone (modulation by long range
interactions of the affinity of C3b for other ligands has been
reported; Refs. 31-33). In fact a number of lines of evidence suggest
that the target of X52.1 activity is FH associated with the C3
convertase. 1) X52.1 has no effect on solution-phase cleavage of C3b,
yet accelerates complement-mediated lysis of diverse cell types by a
mechanism which depends on the presence of FH. Apart from the
FH-factor I-mediated cleavage reaction, FH is not known to have a role
in complement other than its decay-accelerator activity in regulation
of the C3 convertase (and the related C5 convertase). 2) X52.1 strongly
accelerates activation of the APC, but has no effect on the classical
pathway. This is consistent with identity of the C3 convertase as the
X52.1 target, since it is specific to the APC, whereas the cofactor
activity of FH may also involved in regulation of the classical pathway
(13). 3) X52.1 accelerates both disappearance of C3b from solution
(Fig. 6) and deposition of C3b fragments on zymosan particles (Fig. 7).
The C3 convertase is the only known entity regulated by FH that would be expected to accelerate the fixation step specifically. 4)
sEIA has demonstrated that the presence of C3b leads to an increase of
at least 5-fold in the affinity of X52.1 for FH, despite the fact that
C3b competes with FH for the coating mAb (Fig. 5). The actual magnitude
of the affinity increase may be greater, because, first, EIA
immobilization of a protein is an imperfect model for the cell surface,
and second, the FH-C3b association is relatively weak by EIA standards
(34); some of the C3b may therefore be lost during washing steps. This
enhancement of X52.1-FH affinity by C3b explains how X52.1 could block
the decay-accelerator activity of FH even at mAb concentrations too low
to be effective against the pool of free FH. 5) Finally, under the
hypothesis that the biochemically effective target of X52.1 is FH in
association with the C3 convertase, and given that X52.1 has an
additional, uncharacterized inhibitory mode at a weaker site of
association (descending limbs in Figs. 2 and 3, homologous format data
above), one might expect to see a time-dependent shift in
the kinetics of X52.1-assisted lysis as the population of the
convertase increases (via well described mechanisms; Ref. 16), causing
a shift in binding of X52.1 from the weaker, inhibitory site to the
strong site on convertase-associated FH. Fig. 2 indicated to us that it
should be possible to observe such a shift: between the 45- and 88-min
time points, the ratio of aggregate lysis at 13 nM to that
at 33 nM changes from 2.14 to 1.15, and it is clear from inspection that the progress curve is shifting to higher
concentrations of X52.1.
We investigated the kinetics of X52.1 enhanced lysis in a further
experiment in which five time points were taken. These data are
presented in Fig. 3, before and after normalization to the number of
intact RE remaining to illustrate the point that no important effects
can be attributed to exhaustion of the "substrate" of lysis (RE),
although the 312-min time point shows clear evidence that some other
critical component is being exhausted at 20 nM, perhaps C3.
The concentration of maximum enhancement of lysis by X52.1 has shifted
to higher mAb concentrations at each time point. This is highly
consistent with a model in which competition between the "enhancer"
site and the weak inhibitory site is gradually resolved in favor of
enhancement as the target of the enhancement mode, presumably the C3
convertase, increases in concentration. Fig. 8B portrays our
proposed model of the complement-enhancing effects of X52.1.
The experimental results shown in Fig. 3 allow us to perform a rough
calculation of the number of X52.1 target molecules present on a rabbit
erythrocyte, yielding an estimate of ~480,000 fixed C3b molecules per
RE during rapid activation.3
This number agrees reasonably well with the measurement made by
Fishelson et al. of 380,000 deposited C3b molecules per RE under similar conditions (35).
It is encouraging that X52.1 is able to enhance complement-mediated
killing of several types of cancer cells, and the observation that the
mAb evidently acts against inhibition of the C3 convertase, but has no
effect on the solution-phase reaction, implies that several steps of
complement activation may be accessible to the biochemist who wishes to
manipulate these pathways for either therapeutic or research purposes.
It also bodes well for complement-dependent therapy in
general, since it establishes the possibility that rapid activation may
be enhanced without profound and undesirable effects on solution-phase
control in the bloodstream. However, there is reason to believe that
still better reagents may be found. Since the inhibitory activity of
X52.1 at high concentration is likely to be due to association at a
separate site on FH, it may be possible to develop an antibody or other
reagent which shows even greater specificity for the "enhancer"
site. Alternatively, phage display (36-38) or polysome selection (39,
40) in a site-subtractive mode might be used to improve the specificity
of X52.1 itself. Nevertheless, our data have shown that the feasibility
of using anti-FH reagents in cancer therapy may depend critically on
the presence or absence of complement regulators other than FH in the
targeted cells. It may in fact be desirable to develop panels of mAbs
against several of the cell-surface complement regulators in hopes of
identifying reagents capable of isolating other steps within the
activation pathways. The most likely choices of an initial therapeutic
mode using X52.1 or a similar reagent are either intravesicular therapy
of bladder cancer or localized therapy of a fatal condition such as
pancreatic cancer.
 |
ACKNOWLEDGEMENT |
We thank Dr. Michael Pangburn for helpful discussions.
 |
FOOTNOTES |
*
This work was funded by Bion Diagnostic Sciences.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Bion Diagnostic
Sciences, 12277 134th Ct. N.E., Redmond, WA 98052. Tel.: 425-814-1534; Fax: 425-814-1520; E-mail: michael_corey@biondiagnostics.com.
2
R. J. Kinders, unpublished observations.
3
The calculation entails several assumptions. It
seems reasonable to assume that early in the reaction, before
substantial cell lysis has occurred, most of the C3 convertase
complexes are associated with complement receptor molecules on the
erythrocyte surface. We must also assume that the concentration of
maximum lytic enhancement at the early time points (7-20
nM) reflects the quantity of the hypothetical target
available. This assumption also seems reasonable, since the apparent
dissociation constant (<300 pM) is far lower than this
observed maximum; the mAb is likely to saturate a limiting target under
these conditions. Division of the number of erythrocytes present into
the population of X52.1 indicates that at the 25.5- and 68.5-min time
points, roughly 60,000 and 130,000 FH target molecules, respectively,
are present for each erythrocyte. This rises to ~220,000 at the
115-min time point, but by this time substantial lysis has occurred
(~20% at maximum), and we cannot rule out the possibility that high
affinity X52.1 target complexes have been released into solution from
dying RE. Given the strong-binding assumption of a 1:1 X52.1-FH complex and the substantially greater affinity for X52.1 for FH in complex with
C3b, we can proceed from these numbers to approximate the number of C3b
molecules/RE involved in the X52.1 target. If the observation by Ollert
et al. of 0.27 immobilized FH molecules per fixed C3b in a
classical system (11) is applicable, then 130,000 target molecules per
cell yield an estimate of ~480,000 fixed C3b molecules per RE.
 |
ABBREVIATIONS |
The abbreviations used are:
FH, complement
factor H;
TCC, transitional cell carcinoma;
mAb, monoclonal antibody;
RE, rabbit erythrocytes;
DAF, decay accelerating factor;
PCR, polymerase chain reaction;
RT, reverse transcription;
APC, alternative
pathway of complement;
GVB, gelatin veronal buffer;
EIA, enzyme
immunoassay;
sEIA, sandwich enzyme immunoassay;
Kd(app), apparent dissociation constant;
AP, alkaline phosphatase;
ELISA, enzyme-linked immunosorbent assay;
PAGE, polyacrylamide gel electrophoresis;
Tricine, N-tris (hydroxymethyl)methylglycine.
 |
REFERENCES |
| 1.
|
Kinders, R. J.,
Jones, T.,
Root, R.,
Bruce, C.,
Murchison, H.,
Corey, M. J.,
Williams, L.,
Enfield, D.,
and Hass, G. M.
(1998)
Clin. Cancer Res.
4,
2511-2520[Abstract/Free Full Text]
|
| 2.
|
Ellis, W. J.,
Blumenstein, B. A.,
Ishak, L. M.,
and Enfield, D. L.
(1997)
Urology
50,
882-887[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Sarosdy, M. F.,
Hudson, M. A.,
Ellis, W. J.,
Soloway, M. S.,
deVere White, R. W.,
Sheinfeld, J.,
Jarowenko, M. V.,
Schellhammer, P. F.,
Schervish, E. W.,
Patel, J. V.,
Chodak, G. W.,
Lamm, D. L.,
Johnson, R. D.,
Henderson, M.,
Adams, G.,
Blumenstein, B. A.,
Thoelke, K. D.,
Pfalzgraff, R. D.,
Murchison, H. A.,
and Brunelle, S. L.
(1997)
Urology
50,
349-353[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Vik, D. P.,
Munoz-Canoves, P.,
Chaplin, D. D,
and Tack, B. F.
(1989)
Curr. Top. Immunol.
153,
147-162
|
| 5.
|
Sim, R. B.,
Day, A. J.,
Moffatt, B. E.,
and Fontaine, M.
(1993)
Methods Enzymol.
223,
13-35[Medline]
[Order article via Infotrieve]
|
| 6.
|
Sharma, A. K.,
and Pangburn, M. K.
(1996)
Proc. Natl. Acad. Sci., U. S. A.
93,
10996-11001[Abstract/Free Full Text]
|
| 7.
|
Austyn, J. M.,
and Wood, K. J.
(1993)
Principles of Cellular and Molecular Immunology
, Oxford University Press, New York
|
| 8.
|
Vyse, T. J.,
Bates, G. P.,
Walport, M. J.,
and Morley, B. J.
(1994)
Genomics
24,
90-96[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Fishelson, Z.
(1991)
Mol. Immunol.
28,
545-552[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Sahu, A.,
and Pangburn, M. K.
(1993)
Mol. Immunol.
30,
679-684[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Ollert, M. W.,
David, K.,
Bredehorst, R.,
and Vogel, C.-W.
(1995)
J. Immunol.
155,
4955-4972[Abstract]
|
| 12.
|
Corey, M. J.,
Kinders, R. J.,
Brown, L.,
Rowley, H.,
and Vessella, R.
(1998)
Proc. Am. Assoc. Cancer Res.
39,
263
|
| 13.
|
Meri, S.,
and Pangburn, M. K.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
3982-3986[Abstract/Free Full Text]
|
| 14.
|
Meri, S.,
and Pangburn, M. K.
(1994)
Biochem. Biophys. Res. Commun.
198,
52-59[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Fishelson, Z.
(1991)
Mol. Immunol.
28,
545-552
|
| 16.
|
Muller-Eberhard, H. J.,
and Gotze, O.
(1972)
J. Exp. Med.
135,
1003[Abstract]
|
| 17.
|
Seya, T.,
Hara, T.,
Matsumoto, M.,
and Hitoshi, A.
(1990)
J. Immunol.
145,
238-245[Abstract]
|
| 18.
|
Yamakawa, M.,
Yamada, K.,
Tsuge, T.,
Ohrui, H.,
Ogata, T.,
Dobashi, M.,
and Imai, Y.
(1994)
Cancer
73,
2808-2817[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Simpson, K. L.,
Jones, A.,
Norman, S.,
and Holmes, C. H.
(1997)
Am. J. Pathol.
151,
1455-1467[Abstract]
|
| 20.
|
Bjorge, L.,
Hakulinen, J.,
Wahlstrom, T.,
Matre, R.,
and Meri, S.
(1997)
Int. J. Cancer
70,
14-25[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Niehans, G. A.,
Cherwitz, D. L.,
Staley, N. A.,
Knapp, D. J.,
and Dalmasso, A. P.
(1996)
Am. J. Pathol.
149,
129-142[Abstract]
|
| 22.
|
Jarvis, G. A.,
Li, J.,
Hakulinen, J.,
Brady, K. A.,
Nordling, S.,
Dahiya, R.,
and Meri, S.
(1997)
Int. J. Cancer
71,
1049-1055[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Penn, I.
(1989)
in
CRC Critical Reviews in Oncogenesis
(Pimentel, E., ed)
, pp. 27-52, CRC Press, Boca Raton, FL
|
| 24.
|
Penn, I.
(1982)
Curr. Prob. Cancer
6,
1-64
|
| 25.
|
Schreiber, R. D.,
Pangburn, M. K.,
Medicus, R. G.,
and Muller-Eberhard, H. J.
(1980)
Clin. Immunol. Immunopathol.
15,
384-396[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Corey, M. J.,
Kinders, R. J.,
Brown, L. G.,
and Vessella, R. L.
(1997)
J. Immunol. Methods
207,
43-51[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Corey, E.,
Wegner, S. K.,
Stray, J. E.,
Corey, M. J.,
Arfman, E. W.,
Lange, P. H.,
and Vessella, R. L.
(1997)
Int. J. Cancer
71,
1019-1028[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Alsenz, J.,
Lambris, J. D.,
Schulz, T. F.,
and Dierich, M. P.
(1984)
Biochem. J.
224,
389-398[Medline]
[Order article via Infotrieve]
|
| 29.
|
Platts-Mills, T. A.,
and Ishizaka, K.
(1974)
J. Immunol.
113,
348-358[Abstract/Free Full Text]
|
| 30.
|
Fearon, D. T.,
and Austen, K. F.
(1977)
J. Exp. Med.
146,
22-33[Abstract/Free Full Text]
|
| 31.
|
Pangburn, M. K.,
and Muller-Eberhard, H. J.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
2416-2420[Abstract/Free Full Text]
|
| 32.
|
Brown, E. J.,
Joiner, K. A.,
Gaither, T. A.,
Hammer, C. H.,
and Frank, M. M.
(1983)
J. Immunol.
131,
409-415[Abstract]
|
| 33.
|
Fearon, D. T.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
1971-1975[Abstract/Free Full Text]
|
| 34.
|
Pangburn, M. K.,
and Muller-Eberhard, H. J.
(1983)
Biochemistry
22,
178-185[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Fishelson, Z.,
Pangburn, M. K.,
and Muller-Eberhard, H. J.
(1984)
J. Immunol.
132,
1430-1434[Abstract]
|
| 36.
|
Feng, S.,
Kasahara, C.,
Rickles, R. J.,
and Schreiber, S. L.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
12408-12415[Abstract/Free Full Text]
|
| 37.
|
Vanadon, P.,
Nussbaum, G.,
Boyd, L. F.,
Margulies, D. H.,
and Scharff, M. D.
(1996)
J. Mol. Biol.
261,
11-22[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Yamanaka, H. I.,
Inoue, T.,
and Ikeda, T. O.
(1996)
J. Immunol.
157,
1156-1162[Abstract]
|
| 39.
| Kawasaki, G. (November 29, 1991) U.S. Patent 5,658,754
|
| 40.
|
Gersuk, G. M.,
Corey, M. J.,
Corey, E.,
Stray, J. E.,
Kawasaki, G. H.,
and Vessella, R. L.
(1997)
Biochem. Biophys. Res. Commun.
232,
578-582[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
V. P. Ferreira, A. P. Herbert, H. G. Hocking, P. N. Barlow, and M. K. Pangburn
Critical Role of the C-Terminal Domains of Factor H in Regulating Complement Activation at Cell Surfaces
J. Immunol.,
November 1, 2006;
177(9):
6308 - 6316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-Z. Cheng, M. J. Corey, M. Parepalo, S. Majno, J. Hellwage, P. F. Zipfel, R. J. Kinders, M. Raitanen, S. Meri, and T. S. Jokiranta
Complement Factor H as a Marker for Detection of Bladder Cancer
Clin. Chem.,
May 1, 2005;
51(5):
856 - 863.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|