HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bayele, H. K. Articles by Towner, P. Search for Related Content PubMed PubMed Citation Articles by Bayele, H. K. Articles by Towner, P. Social Bookmarking                      What's this?

J Biol Chem, Vol. 275, Issue 19, 14217-14222, May 12, 2000

Complementation of a Glucose Transporter Mutant of Schizosaccharomyces pombe by a Novel Trypanosoma brucei Gene^*

Henry K. Bayele, Robert S. Eisenthal, and Paul Towner^§

From the Department of Biochemistry, University of Bath, Bath BA2 7AY, United Kingdom

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The African trypanosome Trypanosoma brucei has a digenetic life cycle that involves the insect vector and the mammalian host. This is underscored by biochemical switches in its nutritional requirements. In the insect vector, the parasite relies on amino acid catabolism, but in the mammalian host, it derives its energy exclusively from blood glucose. Glucose transport is facilitated, and constitutes the rate-limiting step in ATP synthesis. Here, we report the cloning of a novel glucose transporter-related gene by heterologous screening of a EMBL4 genomic library of T. brucei EATRO 164 using a rat liver glucose transporter cDNA clone. Genomic analysis shows that the gene is present as a single copy within the parasite genome. The gene encodes a protein with an estimated molecular mass of 55.9 kDa, which shares only segmental homology with members of the glucose transporter superfamily. Several potential post-translational modification sites including phosphorylation, N-glycosylation, and cotranslational myristoylation sites also punctuate the sequence. It is distinguished from classical transporter proteins by the absence of putative hydrophobic membrane-spanning domains. However, this protein was capable of complementing Schizosaccharomyces pombe glucose transporter mutants. The rescued phenotype conferred the ability of the cells to grow on a broad range of sugars, both monosaccharides and disaccharides. The kinetics of glucose uptake reflected those in T. brucei. In addition to complementation in yeast, we also showed that the gene enhanced glucose uptake in cultured mammalian cells.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The bloodstream forms of Trypanosoma brucei are absolutely dependent on peripheral glucose supply and derive their energy by glycolysis (1, 2). The glycosome is the major site for glycolysis, and most glycolytic enzymes are compartmentalized here (3). There is evidence suggesting the differential expression of glycolytic enzymes in the bloodstream forms (4). This may be indicative of a differentially expressed glucose transporter, assuming that the two systems operate in tandem. In order to be shunted into the glycolytic pathway, glucose must therefore cross the plasma membrane and then pass through the glycosomal membrane. It might appear that both compartments are equipped with glucose transporters, although it is suggested that the flagellar pocket may serve in solute uptake by endocytosis (5).

Glucose uptake by bloodstream forms is mediated by a facilitated glucose transporter (6-8). Kinetic measurements indicate that there are substantial differences between this transporter and that of the mammalian host. Some of these differences include a 20-50-fold higher rate of glucose metabolism than the mammalian host cells (9); insensitivity to cytochalasin B (unpublished observations), and the ability to transport fructose (10). Some work has shown that several glucose transporters are present in the kinetoplastids, which differ largely in the stage specificity of expression (11-14). These transporters showed apparent homology to members of the facilitative glucose transporters including the presence of putative transmembrane segments. The kinetics of glucose uptake and sensitivity to known inhibitors of transport were also similar in many respects. However, because those transporters were identified either with variant surface glycoprotein gene probes (11) or based on developmental expression (13), we reasoned that other unidentified transporters still exist in T. brucei. By heterologous probing with a rat liver glucose transporter cDNA, we isolated and cloned a trypanosome protein that is distinct from any previously reported. Although it has only residual homology to the classical glucose transporters, it was able to rescue fission yeast glucose transporter mutants by supporting growth on sugars, both disaccharides and monosaccharides. This protein may therefore belong to a new class of transporters, or it may be tightly associated with glucose uptake and metabolism.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

T. brucei clone MiTat 1.1 was grown in Wistar rats and purified from blood on a DEAE-cellulose column based on the method of Lanham (15). Oligodeoxynucleotides were synthesized on an Applied Biosystems DNA synthesizer model 318A.

Cloning and Sequencing of the Gene-- A genomic EMBL4 library of T. brucei EATRO 164 was used to infect Q359 cells and plated on 20 × 20-cm agar dishes to yield a confluent lawn of plaques. Plaque lifts were performed according to standard techniques (16) using Hybond N⁺ (Amersham Pharmacia Biotech). The immobilized bacteriophage DNA was screened with a rat liver glucose transporter cDNA (17) labeled with [-³²P]dATP by random priming using the Multiprime DNA labeling system as directed (Amersham Pharmacia Biotech). Hybridizations were performed in 50% deionized formamide, 1% SDS, 5× Denhardt's solution, 5× SSC, 5 mM EDTA, pH 7.5, 50 mM sodium phosphate, pH 7.0, and 200 µg/ml salmon sperm DNA, at 42 °C for 18 h. Posthybridization treatment included a moderate stringency wash at 55 °C for 1 h in 1× SSC, 0.1% SDS. The membranes were exposed overnight to Fuji film for autoradiography. Positive isolates were purified by two cycles of screening at decreasing plaque densities. DNA was purified from the positive clones and restriction mapped by Southern blotting and hybridization with the rat cDNA probe. A single strongly hybridizing EcoRI/HindIII fragment from clone LT-10 was gel-purified and directionally cloned into pUC18 to give pTGT-4. Transformants of pTGT-4 in TG1 cells were selected on agar/ampicillin plates. Plasmid DNA for sequencing was isolated from large scale cultures by alkaline lysis and CsCl equilibrium centrifugation. The gene was also cloned into the EcoRI/HindIII sites in M13mp18 and M13mp19 and sequenced (18) using Sequenase (U. S. Biochemical Corp.). DNA sequences were analyzed using the Staden software program (19). Multiple sequence alignments were performed using the HOMED program of Stockwell (20). Data bases were searched using the FASTP program of Lipman and Pearson (21).

Genomic Organization-- Genomic DNA was digested to completion with restriction endonucleases that have only one recognition site within or flanking the gene. Restriction fragments were electrophoresed on 0.8% agarose gels and blotted onto Hybond N⁺. The insert from pTGT-4 was random-primed and used to probe the blot. Hybridization conditions were similar to the above except that a final high stringency wash at 65 °C with 1× SSC, 0.05% SDS was included.

Northern Blot Analysis-- Total RNA was isolated from bloodstream forms of the parasite according to the method of Chomczynski and Saachi (22). Approximately 10 µg was electrophoresed on a 1% formaldehyde agarose gel and transferred to Hybond N⁺. The blot was probed with pTGT-4 as described above. Hybridization and posthybridization conditions were similar to those employed above.

Determination of 5'-End of the Gene-- mRNA was isolated from the parasite using the Poly(A) Quik mRNA isolation kit (Stratagene). 2 µg of mRNA was annealed to 10 pmol of [-³²P]ATP-labeled oligonucleotide C4 (AATTCCAGTGCCTAACCCCTA), complementary to nucleotides 853-873. Primer extension was performed using the avian myeloblastosis virus primer extension system as instructed (Promega). Oligonucleotide C4 was also used to sequence pTGT-4. Both sequencing reaction and primer extension products were co-electrophoresed on 8% polyacrylamide gel (National Diagnostics).

Functional Expression in a Mammalian Cell Line-- The EcoRI and HindIII cloning sites of the gene were filled in with the Klenow fragment of DNA polymerase and cloned into the SmaI site of the eukaryotic expression vector pSVL to give pSVL2.5. Insert orientation was determined by restriction mapping and confirmed by sequencing. DNA was isolated from the appropriate clone. COS-7 cells were grown in Dulbecco's minimal essential medium (Life Technologies, Inc.) in 3.5-cm dishes at 37 °C, 5% CO₂. At 80-90% confluence, the cells were transfected separately with 10 µg each of pSVL2.5 and pSVL, using Lipofectin (Life Technologies, Inc.) according to the manufacturer's instructions. After 72 h, the cells were washed twice with Krebs-Ringer-Hepes (KRH)¹ buffer, pH 7.6 (10 mM Hepes, 140 mM NaCl, 2 mM KCl, 1 mM MgCl₂, 2 mM KH₂PO₄, 1 mM CaCl₂) equilibrated at 37 °C. They were preincubated for 30 min at 37 °C in 500 µl of fresh KRH. This was replaced with a 500-µl mixture of 100 µM D-glucose and 2 µCi of [³H]2-deoxy-D-glucose (6.6 Ci/mmol; Amersham Pharmacia Biotech). After an appropriate incubation time, glucose uptake was terminated by adding 2 ml of ice-cold KRH containing 100 µg/ml phloridzin, which was then aspirated. The cells were washed two more times. To control for background or nonspecific binding, the stopping buffer was added to the cells before adding the radiolabeled 2-deoxyglucose. L-[³H]leucine (166 Ci/mmol; Amersham Pharmacia Biotech) uptake control assays were also performed as above, and uptake was terminated with ice-cold KRH. All time points were run in duplicate. The cells were then solubilized in 500 µl 1% SDS at room temperature for 30 min and transferred to a vial containing 10 ml of scintillation mixture and counted in an LKB Wallac counter.

Complementation of Schizosaccharomyces pombe Glucose Transporter Mutant-- This was performed according to Milbradt and Höfer (23). The insert from pTGT-4, previously cloned into the HindIII/EcoRI site of pGEM7 to give pGEM2.5, was subcloned as a HindIII/XhoI fragment into the yeast shuttle vector pCMVL predigested with HindIII and XhoI. Recombinants were identified and verified by restriction analysis. The new construct, pCMVLTGT, was used to transform the fission yeast glucose transporter mutant YGS-5 (leu1-32 ght1 h⁺), by the lithium acetate/PEG method (24). Transformants were selected on synthetic minimal medium, pH 4.5 (0.67% yeast nitrogen base, 4.7% gluconic acid (potassium salt), 1.5% agar supplemented with leucine drop-out medium (Bio 101, Inc.)) after 2-3 days of growth at 30 °C. These were replica-plated on minimal agar medium lacking gluconic acid but supplemented with 3% glucose, fructose, and maltose or 0.05% 2-deoxyglucose/gluconic acid, with or without leucine. Alternatively, the cells were also grown on YES/agar medium (0.5% yeast extract, 1.5% agar supplemented with 0.01% each of uracil, adenine, leucine, lysine, and histidine) also containing each of the above sugars. Cultures were incubated at 30 °C for 2-3 days to assess growth. YGS-5 cells and SP-Q01 (wild type; (leu1-32 h) Stratagene) were used as negative and positive controls, respectively.

Glucose Transport Assay-- Yeast cells were grown at 30 °C in YES medium and harvested at midlog phase. The culture was centrifuged for 10 min at 10,000 rpm in a Sorvall centrifuge. They were washed twice with PBS and then resuspended in the same buffer at 2-3 A₆₀₀ units. Glucose uptake was initiated using 2 ml of cell suspension in universal polystyrene tubes (Bibi Sterilin) by adding 5 µCi of [³H]2-deoxy-D-glucose (8.8 Ci/mmol; Amersham Pharmacia Biotech) and rapidly mixed by pipetting. Aliquots of 200 µl were taken at various time intervals and rapidly centrifuged through spin filters (Qiagen) at 13,000 rpm (10-20 s). Radioactivity was measured in an LKB Wallac liquid scintillation counter.

Kinetics of Growth in Sugar Medium-- Logarithmic phase cultures of YGS-5 cells and Tgtrep-transformed cells were diluted to an A₆₀₀ of 0.2 in minimal medium supplemented with 25 mM sugars. For YGS-5, leucine was also added to the medium. The cultures were grown at 30 °C, and optical densities of these cultures were measured at various time points at 600 nm. A permissive growth medium, YEL/gluconate (0.5% yeast extract, 0.2% casamino acids, 4.7% gluconate, pH 4.5) was also used to ensure that both cultures had equivalent growth rates.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Molecular Cloning of the Gene-- To identify the putative glucose transporter, we used the rat liver glucose transporter cDNA to screen a genomic library of T. brucei EATRO 164 in EMBL4. A single strongly hybridizing clone (LT-10) was selected for further characterization. Restriction mapping coupled with Southern blotting using the cDNA probe identified a 2.5-kilobase pair EcoRI/HindIII insert (Fig. 1). This was subcloned into pUC18 to yield pTGT-4 and sequenced by dideoxy chain termination. One open reading frame with a coding capacity of 55.9 kDa was identified.

View larger version (49K): [in this window] [in a new window]   Fig. 1.   Restriction fragment analysis of genomic clone. Southern blot hybridization of EMBL4 genomic clone LT-10 with rat glucose transporter cDNA probe. DNA was digested with EcoRI (lane 1), EcoRI/BamHI (lane 2), and EcoRI/HindIII (lane 3). Fragment identification is detailed under "Experimental Procedures." kbp, kilobase pairs.

Genomic Organization and Transcriptional Regulation of the Gene-- A Kozak consensus sequence and clusters of purine residues, which are the basic requirements for efficient mRNA translation, flank the translation initiation codon (25). No in-frame methionines were identified upstream of this codon. Using this gene to probe Southern blots of genomic fragments generated with enzymes that have unique restriction sites within the gene, single bands were observed in all cases. Similar results were obtained using restriction sites that flank the gene. A unique band corresponding in size to the fragment from LT-10 was also detected in a HindIII/EcoRI digest (Fig. 2). These results probably suggest that the gene is present as a single copy within the parasite genome. To further confirm that the gene was trypanosome-derived, primers based on the nucleotide sequence of the gene were synthesized and used to amplify genomic and cDNA fragments by polymerase chain reaction. DNA sequencing showed that the genomic and cDNA clones were identical both to the EMBL4 clone and to a clone obtained from an enriched genomic library (data not shown). Northern blot analysis using the gene as a probe showed a transcript of about 6.2 kilobase pairs (Fig. 3A). This is larger than the coding capacity of the gene but the size may be due to the presence of untranslated sequences or to the transcript being part of a polycistron. To identify the 5'-end of the mRNA, we performed primer extension. The putative transcription start site (+1) was located within a PvuII site 19 base pairs from the translation start codon (Fig. 3, B and C).

View larger version (64K): [in this window] [in a new window]   Fig. 2.   Genomic organization of the putative transporter gene. Genomic DNA was digested to completion with various restriction enzymes and combinations thereof to determine the organization of the gene in the parasite genome and its copy number. The restriction fragments were transferred to Hybond N+ and probed with random-primed pTGT-4. Lane 1, EcoRI/HindIII; lane 2, SacI; lane 3, KpnI; lane 4, ApaI. The last three enzymes each have one recognition site within the gene, while EcoRI and HindIII flank the gene. kbp, kilobase pairs.

View larger version (58K): [in this window] [in a new window]   Fig. 3.   Transcription analysis of the gene. A, 10 µg of total RNA from bloodstream forms were electrophoresed on a 1% formaldehyde-agarose gel and transferred to Hybond N+. The gene transcript was then detected by probing the blot with random-primed pTGT-4. The position and estimated size of the transcript are indicated; B, primer extension product (115 nucleotides) resolved on 8% polyacrylamide gel separately or co-resolved with sequencing reactions using oligonucleotide C4. C, the putative cap site is marked by +1. The direction of the open reading frame is indicated by an angled arrow, and the first ATG (translation start codon) is shown by an open rectangle. Lane 1, negative control (yeast tRNA); lane 2, trypanosome mRNA. kb, kilobases.

Structural Organization and Comparison with Glucose Transporter Superfamily-- At the amino acid level, there is poor homology between the encoded protein and the glucose transporter superfamily. This homology improves if conservative substitutions are taken into account. These are grouped as follows: Ala and Gly; Val, Leu, Ile, and Met; Phe, Tyr, and Trp; Lys and Arg; Glu and Asp; Gln and Asn; and Ser and Thr. However, five of the six most highly conserved motifs (26) are represented (Fig. 4, A-C). This suggests that although the sequences are divergent, there are diagnostic motifs in the trypanosome sequence that may be used to identify it with related members of the family. We also compared the sequence of this protein with glucose transporters that have been isolated from T. brucei and a developmentally regulated glucose transporter gene in Leishmania but found very little sequence homologies. In both cases, multiple isoforms of the transporter have been found (11-14), in marked contrast to the single copy gene identified for Tgtrep. Hydrophobicity analysis based on the Kyte-Doolittle algorithm (27) showed that the protein lacks typical membrane-spanning domains, due to a preponderance of charged residues punctuating the sequence. Only four potential -helix nucleation sites could be identified, and a significant -sheet component is also indicated (data not shown). Several potential post-translational modification sites also punctuate the sequence, notably N-glycosylation and phosphorylation, and cotranslational myristoylation sites (data not shown).

View larger version (59K): [in this window] [in a new window]   Fig. 4.   A, nucleic acid and deduced amino acid sequences of Tgtrep. Domains of potential diagnostic significance or proximate homology to the glucose transporter superfamily are underlined. B, schematic presentation of domain organization in a representative facilitated glucose transporter and the proximate sequences in Tgtrep. C, note the serine insertion (S.) in domain IV and a deletion in domain II of Tgtrep. Dashes show spacer residues.

Expression of Transporter Activity-- COS-7 cells were transfected with the gene by lipofection. RNA analysis of the transfected cells by primer extension using oligonucleotide C4 as described above showed that the gene was efficiently transcribed (data not shown). Glucose uptake assays showed that the gene enhanced glucose accumulation up to 4-fold above background endogenous transport (Fig. 5A). The pattern of uptake showed rapid initial rates and sensitivity to phloridzin. As a control for specific glucose transport, the activity of the L-amino acid transporter system (28) was measured in cells transfected with the pSVL2.5 and pSVL using L-[³H]leucine. In this instance, there was no difference in L-amino acid uptake (Fig. 5B). Specific glucose uptake assays were also performed in the yeast mutant YGS-5. Cells transformed with the gene also showed enhanced uptake compared with the YGS-5 background (Fig. 5C). The uptake profile showed very high initial rates, consistent with glucose uptake in trypanosomes or reconstituted trypanosome membrane vesicles.²

View larger version (10K): [in this window] [in a new window]   Fig. 5.   Expression of transporter activity. A, glucose uptake was measured in COS-7 cells transfected with pSVL2.5 () or pSVL vector () as a function of time. The level of glucose uptake is expressed in cpm. Duplicates were run for each time point. B, activity of L-amino acid transporter was measured in cells transfected with pSVL () or pSVL2.5 (). C, glucose transport assay in S. pombe. YGS-5 cells () or cells transformed with Tgtrep () were assayed for glucose uptake using [3H]2-deoxyglucose. The level of uptake is represented by the amount of trapped substrate (in cpm per 107 cells). All time points were run in duplicates. Graphs are representative of at least three independent experiments.

Complementation Analysis in S. pombe Glucose Transporter Mutants-- The ability of the gene to reconstitute glucose transport in the fission yeast YGS-5, which is defective in sugar uptake, was assessed by cloning it into the yeast shuttle expression vector pCMVL. YGS-5 cells transformed with the gene were monitored on their ability to grow on monosaccharides and disaccharides. The gene was able to confer growth on gluconic acid, glucose, fructose, and maltose minimal medium (Fig. 6, A-D). Growth was rapid (within 24 h) and profuse. YGS-5 was able to grow only on gluconic acid but not on the other sugars. Dead-end nonmetabolizable substrates such as 2-deoxyglucose could not support the growth of Tgtrep-transformed YGS-5 cells on minimal medium (data not shown).

View larger version (44K): [in this window] [in a new window]   Fig. 6.   Expression of Tgtrep in S. pombe YGS-5 rescues the ability to utilize sugars for growth. Transformed cells were replica-plated on YES agar medium supplemented with gluconate (A), glucose (B), fructose (C), and maltose (D). Q01 is SP-Q01 (wild-type positive control) described under "Experimental Procedures."

Growth Kinetics in Sugar Medium-- To assess the ability of Tgtrep-transformed cells to utilize various sugars for growth, diluted logarithmic phase cultures were monitored for increase in growth/optical density over time. Whereas YGS-5 cells showed a prolonged lag phase of growth (>6 h), transformed cells showed a diminished lag phase (<2 h). Growth in these cells was relatively more rapid. The kinetics of growth were similar for all sugars tested, with both monosaccharides and disaccharides (Fig. 7, A-D). Similar profiles of growth were also observed when the cultures were grown in glycerol (3%) or 25 mM rhamnose, arabinose, galactose, xylose, sorbitol, or glucosamine (data not shown). To ensure that the observed differences in growth rates were not due to an altered growth cycle in YGS-5, a permissive medium was used for both sets of cultures. In this instance, the growth rate was equal in both cases (Fig. 7E).

View larger version (15K): [in this window] [in a new window]   Fig. 7.   Kinetics of growth. Tgtrep-transformed YGS-5 () and YGS-5 () were grown as described above, and optical densities (OD) were recorded at various time points. Growth rates were determined in glucose (A), maltose (B), fructose (C), sucrose (D), and YEL/gluconate medium (E).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The working assumption in our approach to use a rat liver glucose transporter probe to isolate the trypanosome homologue was that the two transporters would be structurally similar. Due to the evolutionary distance between the rat and the trypanosome, however, the genomic library was screened at a low to moderate stringency. Subsequent hybridization with isolated clones was performed at increasing stringency until a single hybridizing clone was picked and characterized. The structure of the gene contained within this clone is typical of trypanosome genes in terms of nucleotide content, codon usage, and dinucleotide frequencies (29). The sequence composition also shares local homologies with the cDNA probe. An additional feature includes polypyrimidine tracts and oligo(dT)-rich sequences, which have been implicated in trans-splicing in the kinetoplastids and higher eukaryotes (30, 31). A putative transcription initiation site was also identified, but this may be a result of artifactual termination of transcription possibly due to mRNA secondary structure. It may also suggest that this mRNA is processed by a novel mechanism that is yet to be identified. Because of the polycistronic nature of transcription in trypanosome genes (32, 33), this finding is treated conservatively until further information is available.

The poor global homology between this protein and the glucose transporter superfamily may suggest a weak evolutionary parsimony, consistent with the evolutionary distance between trypanosomes and other organisms (29). This notwithstanding, the presence of highly conserved modules and residues within the protein, both in sequence content and spatial arrangement, establishes some functional relatedness. This is supported by two lines of evidence. The gene enhanced glucose transport when transfected into COS-7 cells. Because there was a possibility that endogenous glucose transporters in the COS-7 cells could confound our observations, we sought another heterologous expression system to confirm our results. We therefore chose the fission yeast S. pombe YGS-5, which is defective in glucose transport. The rationale for the use of S. pombe was based on a number of factors. In both T. brucei and S. pombe, transport or uptake is the rate-limiting step in glucose metabolism. Like T. brucei, S. pombe is a unicellular eukaryote and historically has been used successfully in gene complementation (34, 35). S. pombe also has only one sugar transporter; therefore, complementation for glucose uptake should be all-or-nothing. Our data show that expression of Tgtrep in the yeast mutant could rescue the glucose transporter phenotype. Transformed cells could utilize both monosaccharides and disaccharides for growth. The rate of growth of these transformants in sugar medium (except gluconate medium) was faster than the mutants. Because S. pombe has a separate transporter for gluconate (36), the mutant was able to grow on this medium but not on the other sugars. Glucose uptake in complemented cells showed very high initial rates, consistent with observations in transport using trypanosomes or reconstituted trypanosome membrane vesicles.³ The differences in kinetics of transport reflected the growth differences in various sugars. The prolonged lag phase in the mutant compared with the complemented cells may be attributed to a lower affinity of the transporter for the sugar and therefore a lower rate of transport or may be due to a slower rate of metabolism. However, since the activity of hexokinase in the mutant is comparable with the wild type (23), it is unlikely that different rates of metabolism accounted for the differences in growth kinetics. Therefore, the more plausible reason is a difference in the rate of sugar transport.

Our failure to identify putative transmembrane domains using the prediction algorithms suggests that this protein is structurally distinct. On the other hand, a narrower running window may be required to identify short -helices. In other words, it is possible that the protein has shorter transmembrane segments not identifiable by using the present criteria for assignment. Since these algorithms were derived mainly from x-ray crystal structures of soluble proteins, it is uncertain whether they apply to all (membrane) proteins, and indeed their validity is questionable (37). For example, some putative membrane-spanning domains in fact contain helix-breaking residues such as proline. The archetypal polytopic glucose transporter of the red blood cell has its -helices oriented perpendicular to the plane of the lipid bilayer, i.e a significant proportion of the transporter (30-50%) lies outside the membrane. It has also been shown to contain a substantial -sheet component (38, 39). There is also evidence that an effective lipid-interacting amphipathic -helix needs only 8-10 residues in length (37, 40, 41). A criterion other than -helicity or hydrophobicity may need to be applied in order to rationalize the structure of Tgtrep, such as -segments. In particular, it has been shown that a stretch of six residues in -sheet structure can span the membrane (42). It is also possible that charged residues are spatially arranged in such a way as to form salt bridges to confer stability to the protein within the membrane. This is a strong possibility if viewed within the context of the seven putative myristoylation signals within Tgtrep. It is known that clusters of basic residues enhance the localization of myristoylated proteins to the plasma membrane. This is the proposed mechanism for membrane association of the Src family and other related membrane proteins (43). The presence of potential myristoylation sites within Tgtrep may therefore indicate membrane association, although there is no evidence to suggest that these sites may be myristoylated in vivo. An alternative proposition is that the protein is probably located elsewhere other than the plasma membrane such as the flagellar pocket, where it may participate in solute or substrate sensing and uptake. In this regard, it is worth adding that this protein shares identities at its N terminus with the N-terminal sequence of GLUT4 (data not shown), which has been implicated as the targeting signal for its localization to cytoplasmic vesicles (44). This motif is homologous to the endocytic signal of cell surface receptors (44, 45). Considering that GLUT4 is normally sequestered in intracellular compartments and only translocated or recruited in response to insulin, it is tempting to speculate that a similar mechanism may hold true for the trypanosome protein. It is also not clear whether the predictions of membrane protein topology would apply if the protein is on the glycosomal membrane, which is surrounded by the cytosol. Since the enzymes of glycolysis are compartmentalized within the glycosome, it is probable that this organelle has its own glucose transporter.

Another plausible proposition for this protein's structural uniqueness is that it may be a regulatory protein that acts upstream or downstream of the transport step; i.e. it may act as a glucose sensor or rheostat for glucose uptake and/or metabolism rather than being directly involved in sugar uptake by itself. In this regard, it is remarkable that there are several potential protein kinase C, cyclic AMP-dependent, casein kinase II, and tyrosine kinase phosphorylation sites within the protein. The idea of a glucose sensor is appealing in so far as it underscores the exquisite nature of trypanosome reliance on glucose and the coupling of its energy metabolism to its life cycle. It is also probably informative that the rat GLUT2 probe used to isolate Tgtrep has been proposed as a glucose sensor in pancreatic -cells (17, 46). The global effect of glucose on cellular metabolism suggests that glucose transporters may interact with a plethora of other proteins, especially the glycolytic enzymes. Thus, Tgtrep may form an integral part of a multiprotein complex, where it may contribute to glucose homeostasis in the parasite.

We have shown in this report the presence of a unique protein in T. brucei, which is encoded by a single copy gene that appears to be related to the glucose transporter superfamily. Although it was capable of rescuing yeast glucose transporter mutants and restoring growth on a variety of sugars, it is distinct from classical glucose transporters by the absence of canonical membrane-spanning domains. Differences between biochemical targets in parasite and host are often exploited in drug design. The structural uniqueness of this putative transporter or sensor may therefore be invaluable for the rational design and targeting of potent trypanocides.

	ACKNOWLEDGEMENTS

We thank Professor Harvey F. Lodish (Whitehead Institute for Biomedical Research and Department of Biology, MIT, Cambridge, MA) for the rat liver glucose transporter cDNA; Dr. David Barry for the T. brucei EATRO 164 EMBL4 genomic library; Dr. Adrian Wolstenholme for helpful discussions; and Dr. Phil Harris for oligodeoxynucleotide synthesis. We are also grateful to Sylvia Heiland, University of Bonn, for sharing pCMVL vector and YGS-5 cells.

	FOOTNOTES

^* This work was supported in part by the Wellcome Trust.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AJ012572.

Recipient of a scholarship from the Sir Harold Hyam Wingate Foundation. To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, Royal Free and University College Medical School, Rowland Hill St., London NW3 2PF, United Kingdom. Tel.: 44 207 794 0500 (ext. 4941); Fax: 44 207 794 9645; E-mail: h.bayele@rfc.ucl.ac.uk.

^§ Present address: Dept. of Haematology, King's College Hospital, London SE5 9RS, United Kingdom.

² H. K. Bayele, R. S. Eisenthal, and P. Towner, unpublished observations.

³ H. K. Bayele, R. S. Eisenthal, and P. Towner, unpublished data.

	ABBREVIATIONS

The abbreviations used are: KRH, Krebs-Ringer-Hepes; YES, yeast extract and supplements; Tgtrep, trypanosome glucose transporter-related protein.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. Fang, M. Sullivan, and T. F. McCutchan The Effects of Glucose Concentration on the Reciprocal Regulation of rRNA Promoters in Plasmodium falciparum J. Biol. Chem., January 2, 2004; 279(1): 720 - 725. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bayele, H. K. Articles by Towner, P. Search for Related Content PubMed PubMed Citation Articles by Bayele, H. K. Articles by Towner, P. Social Bookmarking                      What's this?