|
J Biol Chem, Vol. 275, Issue 19, 14541-14549, May 12, 2000
Overproduction in Escherichia coli and
Characterization of Yeast Replication Factor C Lacking the Ligase
Homology Domain*
Xavier V.
Gomes ,
Sonja L.
Gary, and
Peter M. J.
Burgers§
From the Department of Biochemistry and Molecular Biophysics,
Washington University School of Medicine,
St. Louis, Missouri 63110
 |
ABSTRACT |
Eukaryotic replication factor C (RF-C) is a
heteropentameric complex that is required to load the replication clamp
proliferating cell nuclear antigen onto primed DNA. Saccharomyces
cerevisiae RF-C is encoded by the genes RFC1-RFC5.
The RFC1 gene was cloned under control of the strong
inducible bacteriophage T7 promoter, yet induction did not yield
detectable Rfc1p. However, a truncated form of RFC1 deleted
for the coding region for amino acids 3-273, rfc1- N,
did allow overproduction. The other four RFC genes were cloned into the latter plasmid to yield a single plasmid that overproduced RF-C to moderate levels. Overproduction of the complex was
further enhanced when the Escherichia coli argU gene
encoding the rare arginine tRNA was also overproduced. The enzyme thus produced in E. coli was purified to homogeneity through
three column steps, including a proliferating cell nuclear antigen
affinity column. This enzyme, as well as the enzyme purified from
yeast, is prone to aggregation and inactivation, and therefore, light scattering was used to determine conditions stabilizing the enzyme and
preventing aggregation. Broad-range carrier ampholytes at about 0.05%
were found to be most effective. In some assays, the Rfc1- N
containing RF-C from E. coli showed an increased activity compared with the full-length enzyme from yeast, likely because the
latter enzyme exhibits significant nonspecific binding to single-stranded DNA. Replacement of RFC1 by
rfc1- N in yeast shows essentially no phenotype with
regard to DNA replication, damage susceptibility, telomere length
maintenance, and intrachromosomal recombination.
 |
INTRODUCTION |
DNA replication in eukaryotes is a complex process involving a
large number of proteins. In yeast, processive DNA synthesis is
performed by DNA polymerase (Pol
)1 and DNA polymerase .
Two accessory factors are also required for processivity, the
proliferating cell nuclear antigen (PCNA) and replication factor C
(RF-C) (1, 2). Yeast PCNA is a ring-shaped homotrimer with a monomer
mass of 29 kDa (3). It functions by encircling the DNA and interacting
with Pol or Pol to maintain highly processive DNA replication
(4-7). PCNA also interacts with several other replication and repair
proteins, including the replication inhibitor p21, the flap-specific
endonuclease FEN-1, and DNA ligase 1 (reviewed in Ref. 8).
RF-C is a multisubunit complex that binds preferentially to the 3'-end
of template-primer junctions and is essential for loading PCNA onto DNA
(9). RF-C has an associated single-stranded DNA-dependent ATPase activity that is stimulated by the presence of primer termini and PCNA (9-11). The mechanism by which RF-C loads PCNA onto DNA is
not well understood. RF-C may recognize and bind to template-primer junctions and subsequently load PCNA in an ATP-dependent
manner (12). Alternatively, RF-C may form an ATP-dependent
complex with PCNA, open the trimeric ring, and, upon binding a
template-primer junction, close the ring around the DNA with hydrolysis
of ATP (13).
Yeast RF-C consists of a large subunit with a molecular mass of 95 kDa
and four smaller subunits of 36-40 kDa (10, 11). The genes encoding
all five subunits have been cloned, and all are essential (14-19). All
five subunits show sequence similarity to each other, and in fact, the
sequences of all Rfc subunits are conserved among eukarya. This
homology is localized in seven regions known as RF-C boxes II-VIII
(Fig. 1A) (reviewed in Ref. 18). RF-C boxes III and V
contain sequences that show homology to nucleotide-binding proteins
(20). RFC1 contains an additional box (I) in the N-terminal
region that shows homology to prokaryotic DNA ligases and
poly(ADP)-ribose polymerases (21). The role of the other RF-C boxes
is unknown. The C termini of all five subunits are unique and are
required for complex formation (22, 23).
Deletion studies with human Rfc1 (p140) have identified at least two
DNA-binding domains, one in an N-terminal domain of the protein (amino
acids 369-480, analogous to Saccharomyces cerevisiae Rfc1p
amino acids 150-230) that contains the ligase homology box I and one
broadly mapped to the C-terminal half of the protein between homology
box IV and the C terminus (Fig. 1A) (23, 24). Although
binding to double-stranded DNA by the C-terminal domain is much weaker
than that by the N-terminal domain, only the C-terminal activity is
required for RF-C function in vitro. In fact, deletion of
the N-terminal domain (amino acids 1-555, approximately analogous to
S. cerevisiae amino acids 1-275) results in a human RF-C
preparation with increased replication activity, indicating an
inhibitory contribution of the N-terminal domain, perhaps by
nonspecific binding to non-template-primer junctions (23, 25).
The role of the N-terminal domain remains unclear. Substrate
specificity binding studies with human Rfc1(1-555) show that this
domain preferentially binds to partially double-stranded DNA substrates
in which at least one of the 5'-ends is phosphorylated and the
phosphate is either recessed or at a blunt end, suggesting functional
significance of this domain in Okazaki fragment maturation or at DNA
ends (26). Human Rfc1 shows a significant binding preference to
5'-phosphorylated double-stranded human telomeric repeat DNA, and a
deletion analysis implicates homology domain I in this activity, again
suggesting the possible importance of this domain for DNA end
metabolism (27).
In this paper, we describe the overexpression in Escherichia
coli of yeast RF-C lacking the ligase homology domain of Rfc1p. Optimization of the overproduction conditions allowed us to obtain, after purification, 1 mg of pure RF-C from 1 liter of cells, as well as
5 mg of the four-subunit Rfc2-5p subcomplex lacking the large subunit.
In addition, we have analyzed the phenotype of a yeast mutant carrying
the truncated RFC1 gene as the only source of
RFC1. Our in vitro data are in agreement with
those obtained by others for human RF-C, but, surprisingly, no
significant DNA metabolic defect could be ascribed to the lack of the
ligase homology domain in vivo.
 |
EXPERIMENTAL PROCEDURES |
Enzymes and DNA--
Wild-type RF-C and Pol were purified
from yeast overproduction strains, and PCNA and replication protein A
were purified from E. coli overproduction strains as
described (13, 28, 29). E. coli SSB was a gift from Dr.
T. Lohman of this department. All other enzymes and oligonucleotides
were obtained commercially. Single-stranded mp18 DNA was singly primed
with a synthetic 36-mer (position 6330-6294). Plasmid pSBETa
(pA15-ori, kanR, ArgU) was a gift from Dr. Hans-Henning Steinbiss (30).
dAMP-PNP was a gift from Dr. Bruce Alberts.
Plasmids--
The proper sequences of all plasmids obtained by
ligation of PCR products or synthetic oligonucleotides were confirmed
by DNA sequence analysis. Plasmid pBL472 (colE1-ori, AmpR,
T7-RFC2, T7-RFC3, T7-RFC4,
T7-RFC5) was assembled from four plasmids (pBL456, pBL555,
pBL565, and pBL609), each of which has a small RFC gene
cloned into expression vector pPY55 (colE1-ori, AmpR, T7
promoter-leader sequence cassette) in such a way that the native amino
acid sequence was maintained and the methionine was optimally located
behind a cassette containing a tandem repeat of the bacteriophage T7
gene 10 promoter followed by a single copy of the gene 10 ribosome
binding site and leader sequence. All four RFC genes in
pBL472 are arranged in a counterclockwise orientation and have retained
the T7 expression cassette. pBL456 (pPY55, T7-RFC3), pBL555
(pPY55, T7-RFC4), and pBL609 (pPY55, T7-RFC5)
have been described (14, 15, 19). The RFC2 gene was
amplified with primers RFC2-1 (CCTTGACATGTTTGAAGGGTTTGGTCC) and RFC2-2
(GGGAAGCTTGTATATTAGAGTTGGGATATT), which introduce an AflIII
site at the initiating methionine and a HindIII site at the
stop codon, respectively. The PCR product was digested with AflIII and HindIII and ligated into vector pPY55,
in which the single AflIII site in a nonessential region had
previously been destroyed by filling in and digested with
NcoI and HindIII to give pBL565 (pPY55,
T7-RFC2).
A 0.38-kb fragment of the RFC1 gene was amplified with
primers RFC1-1 (GAGACCATGGTCAATATTTCTGATTTC), which introduces a
NcoI site at the initiating methionine, and RFC1-2
(GAACACCTGTGAAGACAATTGTTAG) just past an internal BamHI site
in the RFC1 gene. The PCR product was made blunt-ended with
DNA polymerase I, Klenow fragment plus dNTPs, digested with
NcoI, and ligated into vector pPY55 that had been digested
with ClaI, filled in with DNA polymerase I, Klenow fragment
plus dNTPs and then digested with NcoI. The resulting plasmid was cut with AatII, filled in with DNA polymerase I,
Klenow fragment plus dNTPs, and then digested with BamHI,
and the remaining portion of the RFC1 gene was ligated in as
a BamHI to filled-in XhoI fragment obtained from
plasmid pBL411 to give plasmid pBL614 (pPY55 colE1-ori, AmpR,
T7-RFC 1) (13). To obtain an expression plasmid with a
truncated RFC1 gene, pBL614 was digested with
NcoI and HinDIII, and the linear fragment was
isolated. A double-stranded oligonucleotide made by hybridization of
oligonucleotides CATGGTGCATCATCACCATCACCACCATA and
AGCTTATGGTGGTGATGGTGATGATGCAC was ligated into the linearized vector.
The resulting plasmid, pBL480 (pPY55 colE1-ori, AmpR, T7-RFC1- N) contains a deletion of residues 3-273 of
RFC1 and an addition of seven histidines between amino acids
2 and 274.
Plasmid pBL472 was digested with HinDIII and
PvuII and treated with DNA polymerase I, Klenow fragment
plus dNTPs, and the resulting fragment containing the four small
RFC genes was ligated into plasmid pBL480 digested with
SmaI. The resulting plasmid, pBL481, contains all five
RFC genes in a counterclockwise orientation, each under the
control of the T7 cassette (Fig. 1B).
Plasmids pBL641 (pRS316, RFC1, URA3) and pBL642
(pRS314, RFC1, TRP1) are complementing centromere
plasmids containing the entire RFC1 sequence (31). Plasmid
pBL642-2 (pRS314, RFC1, TRP1) was created using
site directed mutagenesis in order to introduce a NcoI
restriction site at the N terminus of RFC1. This mutation did not alter the amino acid sequence of the RFC1 gene.
Plasmid pBL642-3 (pRS314, RFC-1 N,
TRP1) was constructed by replacing the 1.5-kb
NcoI-BglII RFC1 fragment in pBL642-2
with the 0.8-kb NcoI-BglII truncated
RFC1 fragment from plasmid pBL480. This swap deletes
residues 3-273 and adds seven histidine residues between amino acids 2 and 274.
Strains and Genetics--
The E. coli strain used for
general cloning purposes was DH5 , whereas BL21(DE3) was used for
overproduction studies. Diploid yeast strain W303
(MATa/MAT ade2-1/ade2-1 ura3-1/ura3-1 his3-11/his3-11 trp1-1/trp1-1 leu2-3,112/leu2-3,112
can1-100/can1-100) was used for the genetic studies with
RFC1. The entire RFC1 gene was disrupted by
transformation of strain W303 with a PCR-generated fragment spanning
from ~500 nucleotides upstream to ~500 nucleotides downstream of
the RFC1 gene and in which the entire RFC1 coding sequence was replaced by the KanMX6 resistance marker (32). G418
resistant transformants were examined by PCR to verify disruption of
the RFC1 gene in one of the two RFC1 alleles. The
G418 resistant cells were transformed with plasmid pBL641 (pRS316,
RFC1, URA3) and sporulated. Haploid progeny
carrying the disruption of the RFC1 gene and complementing
plasmid pBL641 were identified by standard genetic techniques and PCR
analysis. Strain PY171 (MATa rfc1- ::KanMX6 ade2-1 ura3-1 his3-11
trp1-1 leu2-3,112 can1-100 + pBL641 (pRS316, RFC1,
URA3)) was transformed with the pBL642 series of plasmids,
and transformants that had lost pBL641 were identified by growth on
5-fluoroorotic acid medium to give strain PY173-X (MATa
rfc1- ::KanMX6 ade2-1 ura3-1 his3-11
trp1-1 leu2-3,112 can1-100 + pBL642-x (pRS314, rfc1-x,
TRP1)).
Standard media were used (33). YPDA is YPD plus 20 µg/ml of adenine.
DNA damage sensitivity measurements were carried out on YPDA solid
media to which was added, after autoclaving, 0.05% of methylmethane
sulfonate (MMS) or 110 mM hydroxyurea.
Strains PY173 and PY173-X were transformed with HpaI-cut
pRS305-URA3 (Bluescript LEU2 URA3) to target
integration in the LEU2 locus (34). To determine
URA3 pop-out frequencies, a fluctuation analysis was
carried. Two transformants of each strain were grown to saturation in
complete minimal SC medium, diluted in SC to 100 cells/ml, divided into
10 cultures for each transformant, and grown for 3 days to saturation.
4 × 106 cells were plated on SC medium plus
5-fluoroorotic acid to score for URA3 pop-outs. Median
values were obtained and averaged over the two independent
transformants of each strain. Frequencies were corrected for residual
growth on the selection plates.
Telomere Length Determination--
The telomere analysis was
performed essentially as described (35). Colonies from two successive
5-fluoroorotic acid selection plates, as described above, were diluted
in YPDA medium and grown to saturation at 30 °C. This corresponds to
approximately 30 generations of cell growth of the RFC1
mutants. Successive 1000-fold dilutions in YPDA and growth to
saturation corresponded to additional steps of 10 generations each.
Genomic DNA was isolated from cultures after 30, 70, and 120 generations of growth, digested with XhoI, and subjected to
Southern blot analysis. The probe was a XhoI-SalI fragment from plasmid pJH345 (a gift of Michael McAlear), which contains a telomere-associated Y' sequence and ~300 nucleotides of
poly(G1-3T) sequences.
Buffers--
HEG buffer contains 30 mM HEPES-NaOH
(pH 7.5), 1 mM dithiothreitol, 0.5 mM EDTA,
10% glycerol, 0.01% Nonidet P-40, 5 µM pepstatin A, 5 µM leupeptin, and 0.5 mM
p-methylphenylsulfonyl fluoride. Where indicated, the buffer
was supplemented with 7 mM magnesium acetate and 1 mM ATP. Added NaCl is indicated in mM with a
subscript, e.g. buffer HEG200 contains 200 mM NaCl. Ampholytes 3.5-9 (0.05%) are added to all steps
after the PCNA-agarose column, and p-methylphenylsulfonyl fluoride was omitted from the MonoS step.
Overexpression of RF-C in E. coli--
Plasmid pBL481 was
transformed into BL21(DE3) cells and selected on LB + Amp plates. If
the strain also contained pSBETa, selection was on LB+Amp+Kan plates. A
few colonies were used to inoculate a 50-ml culture of "terrific"
broth (containing, per liter, 12 g of tryptone, 24 g of yeast
extract, 0.4% glycerol, and 50 mM potassium phosphate, pH
7.2, and required antibiotics at 50 µg/ml). Standard media were used
for yeast genetics and grown for 8-10 h at 24 °C with vigorous
shaking (300 rpm). A 5-10-ml inoculum was used to inoculate 1 liter of
terrific broth (A600 = 0.01), and the flask was
incubated overnight at 24 °C with vigorous shaking (300 rpm) to
A600 = 2. The cells were then induced with 0.4 mM isopropyl -D-thiogalactopyranoside, and
shaking was continued for an additional 4-6 h. The cells were
harvested and resuspended in 10 ml of HEG200 buffer and
stored frozen at -70 °C.
Purification of RF-C and the Four-subunit Rfc2-5p
Complex--
All steps were carried out at 0-4 °C unless indicated
otherwise. The thawed cells were lysed by sonication, polymin P was added to 0.5% to precipitate nucleic acids, and after stirring for 5 min, cell debris and the precipitate were removed by centrifugation at
18,000 rpm for 30 min. Ammonium sulfate (0.28 g/ml) was added to the
supernatant, and after 30 min, the precipitated proteins were collected
at 38,000 rpm for 60 min and resuspended in 10 ml of HEG buffer. The
fraction was then dialyzed against HEG buffer to a conductance of
HEG100 and loaded onto a 10-ml S-Sepharose column
equilibrated in HEG100. The column was washed subsequently with 30 ml of HEG200, and eluted with a 75-ml linear
gradient of HEG200-HEG600, followed by a 10-ml
wash with HEG1000. The four-subunit Rfc2-5p complex elutes
at ~HEG250, and RF-C-1 N elutes at
~HEG400. Further purification was only carried out with
complexes overproduced in pSBETa-containing cells.
ATP and magnesium acetate were added to RF-C containing fractions to
final concentrations of 1 and 7 mM, respectively, and the
fraction was diluted with HEG buffer to a conductance of
HEG200 and loaded onto a 15-ml PCNA-agarose column
equilibrated in buffer HEG200. The column was washed with
30 ml of buffer HEG300 containing magnesium acetate-ATP,
and the bound proteins were eluted with HEG300 buffer
containing 3 mM EDTA. To fractions containing RF-C-1 N, ampholytes 3.5-9 were added to a final concentration of 0.05%.
The RF-C-1 N containing fractions were diluted with HEG buffer
containing 0.05% ampholytes to a conductance of HEG150 and injected onto a 1-ml Mono S column (Amersham Pharmacia Biotech) equilibrated in HEG150, washed with 5 ml of
HEG150 buffer, and eluted with a 10-ml linear gradient from
150 to 600 mM NaCl in HEG buffer containing 0.05%
ampholytes. RF-C-1 N eluted at ~350 mM NaCl. The yield
of RF-C was ~0.8 mg/liter of culture.
The Rfc2-5 complex from the S-Sepharose column was dialyzed against
HEG buffer to a conductivity of HEG100 and loaded onto a
1-ml MonoQ column. The column was washed with 3 ml of
HEG100 and eluted by a 10-ml gradient of
HEG200-HEG500. Rfc2-5p eluted at ~150
mM NaCl. The RF-C subcomplex containing fractions were diluted 2-fold with HEG buffer and loaded onto a 1-ml MonoS column. The
column was washed with 3 ml of HEG100 and eluted by a 10-ml gradient of HEG100-HEG500. The Rfc2-5 complex
eluted at ~250 mM NaCl. The yield of Rfc2-5 was ~5
mg/liter of culture.
SDS-Polyacrylamide Electrophoresis--
A 16 cm × 20 cm × 0.75 mm, 7.5% acrylamide, 0.25% bisacrylamide, 0.1% SDS
gel was cast containing 0.16%
N,N,N',N'-tetramethylethylenediamine (TEMED). The
gel was run in the cold room with prechilled buffer at 25 mA constant
current until the dye front had progressed of the way
through the stacking gel. The current was then increased to 50 mA until
the dye front had entered the resolving gel by 1-2 cm. At this time,
the gel was run at a constant voltage of 260-300 V.
Replication Assays--
Standard 30-µl replication assays
contained 40 mM Tris-HCl, pH 7.8; 8 mM
magnesium acetate; 50 mM NaCl; 0.2 mg/ml bovine serum albumin; 1 mM dithiothreitol; 100 µM each of
dATP, dCTP, and dGTP; 25 µM [3H]dTTP (100 cpm/pmol dNTP); 1 mM ATP; 100 ng of singly primed single-stranded mp18 DNA (0.04 pmol of circles); 0.85 µg of E. coli SSB or 0.6 µg of yeast replication protein A; 100 ng of
PCNA (1.1 pmol of trimers); 25 ng of Pol (0.05 pmol); and RF-C as indicated. Incubations were at 37 °C for 4 min, and
acid-precipitable radioactivity was determined. In some assays
dNTP-PNPs replaced dNTPs, meaning that 100 µM dAMP-PNP
replaced dATP in an otherwise identical assay.
[ -32P]dTTP (1000 cpm/pmol nucleotide) replaced
[3H]dTTP when products were analyzed by alkaline agarose
gel electrophoresis. After electrophoresis, the gel was neutralized,
dried, and exposed to film for autoradiography or exposed to a phosphor
screen for phosphor imaging and quantitation.
Replication of poly(dA) with an average chain length of 300 nucleotides
was carried out in a 30-µl assay in the same buffer system containing
200 ng of poly(dA)-(dT)22 (40:1 nucleotide ratio; 1.7 pmol
of template molecules and 0.7 pmol of primers) with 40 µM
[3H]dTTP, 1 mM ATP, 50 mM NaCl,
1.3 µg of SSB, 2.2 pmol of PCNA, 0.1 pmol of Pol , and RF-C as
indicated. Incubations were at 30 °C for 8 min, and the reactions
were processed as described above.
Biogel A-5m Filtration of Complexes--
Complexes were formed
in a 60-µl reaction containing 30 mM Tris-HCl, pH 7.8, 8 mM MgAc2, 50 mM NaCl, 100 µg/ml
bovine serum albumin, 1 mM dithiothreitol, 1.65 µg of
singly primed SS mp18 DNA (0.7 pmol of circles), 14 µg of E. coli SSB, 0.5 mM ATP, 100 µM each dCTP
and dGTP, 10 pmol of PCNA, 2 pmol of RF-C or RF-C-1 N, and 1 pmol of
Pol . The SSB-coated DNA was incubated with PCNA and RF-C or
RF-C-1 N in the assay mix for 30 s at 30 °C, Pol was
added, and the reaction was incubated further for 30 s. The reaction was then cooled on ice and filtered through a 2-ml Biogel A-5m
(Bio-Rad) column, equilibrated in 30 mM Tris-HCl, pH 7.5, 5% glycerol, 0.1 mm EDTA, 8 mM MgCl2, 2 mM dithiothreitol, 100 µg/ml bovine serum albumin, 50 mM NaCl, and 25 µM dCTP and dGTP. Three drop
fractions were collected. DNA predominantly eluted in fractions 8-10,
free protein in fractions 15-22, and free nucleotides in fractions
25-30.
Replication Activity of Isolated Complexes--
The void volume
fractions (fractions 8-10) from the Biogel column were pooled, and 40 µl of complex, corresponding to approximately 0.1 pmol of DNA
complexes, were assayed in a 65-µl reaction containing 30 mM Tris-HCl, pH 7.8; 8 mM magnesium acetate;
100 µg/ml bovine serum albumin; 100 µM each of dCTP,
dGTP, and dATP; and 12.5 µM [ -32P]dTTP.
The reaction was incubated at 14 °C for 1 min, at which time 1.5 pmol of RF-C or RF-C-1 N was added to the reaction or RF-C storage
buffer was added in a control assay. At various time intervals, 20-µl
aliquots were removed into 5 µl of 50 mM EDTA, 50%
glycerol, and 2% SDS. The products were separated on an 1% alkaline
agarose gel as described above.
PCNA Loading and Unloading Assays--
PCNA containing the
N-terminal phosphorylatable tag (phPCNA, MRRASVGS-PCNA) was
32P-labeled using cAMP-dependent protein kinase
and purified as described (34). Complexes were assembled with RF-C or
RF-C-1 N and isolated by Biogel A-5m filtration as described above,
except that 300 fmol of 32P-phPCNA replaced PCNA. The void
volume fractions (fractions 8-10) from the Biogel column were pooled,
and 55 µl of complex, corresponding to approximately 0.1 pmol of DNA,
were assayed in a 65-µl reaction containing 30 mM
Tris-HCl, pH 7.8; 8 mM magnesium acetate; 100 µg/ml
bovine serum albumin; 100 µM each of dCTP, dGTP,
dAMP-PNP, and dTTP; and 0.5 mM ATP as indicated. The
reaction was incubated at 14 °C for 1 min, at which time 1.5 pmol of
RF-C or RF-C-1 N was added to the reaction or RF-C storage buffer was
added in a control assay. After 20 min at 14 °C the reaction was
cooled on ice and filtered through a second 2-ml Biogel A-5m (Bio-Rad). Three-drop fractions were collected and counted in a scintillation counter.
Light Scattering Experiments--
Measurements were performed
using a DynaPro-801 molecular sizing instrument. Approximately 1 mg/ml
of RF-C or RF-C-1 N in HEG300 buffer was filtered through
a Whatman Anatop 10 filter (0.1 µm) and measured at 20 °C in the
absence or presence of various osmolytes. Twenty independent
measurements were determined from each sample. The data were analyzed
with the software provided by the manufacturer to obtain values for the
hydrodynamic radius and polydispersity.
Surface Plasmon Resonance--
The BIAcore apparatus was used
for this analysis. About 500 response units of a 71-mer 5'-biotinylated
oligonucleotide (mp18 nucleotides 6230-6300) was immobilized on the
surface of a streptavidin SA chip in 10 mM sodium acetate
buffer at pH 5.5. The protein-DNA interactions were measured by
injecting a 10 nM solution of either wild-type RF-C or
RF-C-1 N over the immobilized DNA substrate at a flow rate of 30 µl/min. The running buffer used in the analysis contained 30 mM Hepes-NaOH (7.5), 1 mM EDTA, 10% glycerol,
0.01% Nonidet P-40, 0.1% ampholytes 3.5-9, 8 mM
MgCl2, 125 mM NaCl, and 0.2 mg/ml bovine serum albumin.
 |
RESULTS |
Experimental Rationale for Overexpression of RF-C with Truncated
Rfc1p in E. coli--
Previously, we have reported an overproduction
strategy for RF-C in yeast, in which all genes were placed in a
multicopy plasmid under control of the galactose-inducible
GAL1-10 promoter (13). Although this strategy yielded
sufficient protein for many biochemical studies, about 2 mg per
100 g of cells, it was subject to several disadvantages and
restrictions. First, overproduction of RF-C was still too limited for
extended structural studies of RF-C that we intend to carry out.
Second, the overproduction of partial complexes, e.g.
Rfc2-5p, in yeast was very cumbersome. Because subcomplexes, unlike
the complete RF-C, do not form an ATP-dependent complex
with PCNA, a PCNA-affinity column as a one-step purification tool could
not be employed, and extensive chromatography with associated loss of
material was necessary. Most importantly, however, the homologous
overexpression system limited mutational studies to those mutants that
were viable in yeast. Therefore, E. coli was attempted as an
overproduction host.
Overexpression of the small RFC genes in E. coli
had previously been carried out in our laboratory and by others (14,
15, 16, 19). When overexpressed individually, all the small subunits were produced in insoluble form. However, when the genes were co-expressed, the solubility of the subunits increased as complexes were formed. For instance, overexpression of RFC2 together
with RFC3 yielded a soluble complex, and so did to some
degree co-expression of the RFC3 and RFC4 genes.
Co-expression of the RFC2, RFC3, and RFC4 genes also yielded a soluble complex, although it was
not stable and dissociated upon chromatography. In contrast, the
analogous three-subunit complex from human RF-C is extremely stable
(36). However, when all four small RFC genes in plasmid
pBL472 were co-expressed, a stable soluble complex was produced in high
yield in E. coli (data not shown).
Initial attempts to obtain expression of the full-length
RFC1 gene from the T7 promoter in E. coli
carrying pBL614 were completely unsuccessful. No polypeptide
corresponding to Rfc1p could be detected by Western analysis. As the
N-terminal domain of human Rfc1 is not essential for function in
vitro, we truncated the RFC1 gene and added a
His7 tag to the N terminus. The start point of the RFC1- N gene at amino acid 274 corresponds approximately
to the start point of the truncated human Rfc1 subunit at amino acid 555, but as the two proteins lack significant sequence similarity in
this region, no precise comparison can be made. Expression of the
truncated gene from plasmid pBL480 yielded marginal amounts of
insoluble Rfc1- Np, detectable only by Western analysis (data not
shown). As it was possible that the synthesized Rfc1- Np polypeptide could be subject to rapid degradation in E. coli, and
stabilization might occur in the presence of the other RF-C subunits,
we cloned all RFC genes into a single plasmid, pBL481. To
avoid possible expression problems dealing with colliding transcription
complexes originating from strong promoters arranged in an opposing
direction, all genes were arranged into a counterclockwise orientation
(Fig. 1B). Although Rfc1- Np
could still not be identified as an unique Coomassie-stained band in
extracts from induced cells carrying pBL481, a Western analysis
indicated a greatly increased yield of this polypeptide, with a major
fraction detectable in the soluble extract (data not shown).
Fractionation of the soluble extract by S-Sepharose chromatography
allowed us to unambiguously identify the desired Rfc1- Np containing
RF-C complex, designated RF-C-1 N, in the 0.4 M NaCl
eluate from the S-Sepharose column (Fig. 1C). Additionally,
a large excess of the four-subunit Rfc2-5p complex eluted in the 0.25 M NaCl fraction.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 1.
Overproduction of RF-C in E. coli.
A, schematic representation of the RFC1 gene with
the consensus homology boxes from Ref. 18. Box I, the ligase homology
domain, is deleted from RFC1- N, and a His7
tag has been added. B, schematic of plasmid pBL481 for
overexpression of the entire RF-C complex. Each RFC gene is
placed under control of the bacteriophage T7 promoter and the gene 10 leader sequence (T7). C, overproduction of RF-C from
E. coli with or without plasmid pSBETa overproducing the
argU tRNA. The load and the 0.25 and 0.4 M NaCl fractions
of a S-Sepharose column were separated on a SDS-10% polyacrylamide
gel. Proteins were visualized by Coomassie staining. D,
comparison of RF-C purified from yeast with RF-C-1 N purified from
E. coli. Proteins were separated as described under
"Experimental Procedures" and stained with colloidal
Coomassie.
|
|
The coding sequences of the RFC genes contain an unusually
large number of the rare arginine codons AGA and AGG, which pose translational problems in E. coli, particularly if they
occur in tandem, because of the low abundance of the argU tRNA for
those codons (37, 38). In the RFC1 gene, such a tandem
repeat occurs at codons 476 and 477, and tandem rare arginine codons
also occur in RFC2, RFC3, and RFC4.
Therefore, we carried out overexpression in the presence of a plasmid,
pSBETa, which overproduces the argU tRNA (30). This strategy was very
successful, as overproduction of both the Rfc2-5p complex and of
RF-C-1 N increased 2-3-fold (Fig. 1C). Consequently, this
system was applied to our studies of RF-C.
In order to obtain maximum expression levels of soluble RF-C-1 N,
various conditions were altered, including temperature, media, and
aeration. Lowering the temperature to 24 °C dramatically increased
the levels of all the subunits of RF-C, including Rfc-1 Np. The best
results were obtained when cells were cultured in rich media, such as
terrific broth with vigorous shaking (see under "Experimental
Procedures").
Purification and Electrophoretic Analysis of
RF-C-1 N--
Cleared lysates were subjected to ammonium sulfate
fractionation and S-Sepharose chromatography. After this step, the
four- and five-subunit complexes were generally >80% pure (Fig.
1C). However, an imbalance in the stoichiometry of the
subunits of RF-C-1 N often occurred. As it was important to obtain
only active heteropentameric complexes we applied a PCNA-affinity
chromatography step as described previously (13). Briefly, binding of
RF-C to PCNA-agarose under high salt conditions occurs only in the presence of magnesium and ATP. As this represents a step in the catalytic pathway of PCNA loading, only active RF-C binds to the matrix
under these conditions. Subsequent elution of the complex is achieved
with EDTA. A MonoS step is then carried out in order to remove traces
of ATP. As expected, the four-subunit Rfc2-5p complex did not
specifically bind to PCNA-beads and was instead purified by successive
MonoQ and MonoS columns.
Three of the four RF-C subunits, Rfc2p, Rfc3p, and Rfc5p, comigrate
during standard SDS-polyacrylamide electrophoresis. In order to obtain
separation, we surveyed different denaturing electrophoresis systems,
including high resolution electrophoresis in the presence of Tricine
buffers, but without success (39). However, separation of the subunits
could be achieved by increasing the concentration of the cross-linking
catalyst TEMED in the gel from the usual 0.06% to 0.16% and running
the gel in the cold room (Fig. 1D). Presumably, the
increased TEMED concentration shortens the chain length of the
acrylamide polymer, thereby altering its sieving properties. A further
increase of TEMED to 0.4% did not further increase the resolution. A
comparison of RF-C purified from yeast with RF-C-1 N from E. coli showed an exact comigration and proper stoichiometry of the
small subunits (Fig. 1D). The relative migration positions
of Rfc2p, Rfc3p, and Rfc5p were obtained by comparison with the
individually overproduced subunits (data not shown).
Stability of RF-C and RF-C-1 N--
Problems with RF-C stability
had been noted previously (10). In part, inactivation of RF-C was
caused by aggregation, as could be demonstrated by loss of RF-C protein
after filtration through an 0.1 µM filter (data not
shown). Similar problems were encountered with RF-C-1 N in this study
and were even exacerbated when we tried to obtain the complex at high
protein concentrations. Aggregation problems were also noticed during
dialysis to decrease the salt concentration of samples, even though
care was taken to maintain a salt concentration higher than 150 mM NaCl. In order to increase the stability of the protein,
we tested different osmolytes to minimize aggregation of RF-C-1 N.
Light scattering was used to detect aggregation in the sample (see
under "Experimental Procedures"). Light scattering allows a rapid
and accurate measurement of the hydrodynamic radius of the complex. The
standard deviation of the calculated mean radius is represented by the
polydispersity coefficient (Cp). A Cp value of <15% suggests a
monodisperse solution with undetectable aggregation, whereas a Cp of
>15% is indicative of aggregation. Thus, by comparing the
polydispersity values, the optimal osmolyte can be evaluated.
The fraction of RF-C-1 N obtained after the PCNA-agarose column was
either further passed over the MonoS column in the standard HEG buffer
system, or various osmolytes were added and MonoS chromatography was
carried out in their presence. The five osmolytes tested were 100 mM urea, 100 mM arginine (pH 7), 100 mM glycine (pH 7), 1 mM ATP (pH 7.5), and
0.05% ampholytes (pH 3.5-9.5). The purified proteins were filtered
through an 0.1 µm filter and injected into the apparatus. The results
of the analysis are shown in Fig. 2 and
Table I. In the absence of any osmolytes,
the Cp of RF-C-1 N solution was >30%, suggesting substantial
aggregation. Addition of glycine had no effect, and only a minor
improvement was observed with 1 mM ATP present (Fig.
2B). Polydispersity was reduced to 20% when the buffer
contained 100 mM of arginine or urea (Table I). The most
dramatic stabilization was observed with broad-range ampholytes (pH
3.5-9) at 0.05 or 0.2%, which maintained RF-C-1 N essentially as a
monodisperse solution with a Cp value of about 10% (Fig. 2C
and Table I). The measured Stokes radius of 62 Å is consistent with
that of a globular complex with a molecular mass of 240 kDa, close to
the predicted value of 221 kDa.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Light scattering measurements of RF-C.
The Stokes radius is determined in 19 consecutive determinations. The
error bars indicate the degree of polydispersity in each
determination. Additions to the basic RF-C buffer were none
(A), 1 mM ATP (B), or 0.2%
ampholytes, pH 3.5-9 (C).
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Effect of osmolytes and ligands on the aggregation state of RF-C-1 N
Light scattering was carried out as described under "Experimental
Procedures." The mean solution radius and degree of polydispersity
(Cp) are given.
|
|
DNA Binding Activity of RF-C-1 N--
Surface plasmon resonance
was used to assess the binding of the full-length and truncated RF-C
complex to SS DNA. The chip contained a primed 71-mer SS
oligonucleotide that was attached via a biotin-steptavidin linkage
(Fig. 3). The response signal when RF-C
was flowed across the surface was 4-fold higher than the response
signal obtained with RF-C-1 N, indicating a major contribution of the
ligase homology domain of Rfc1p to binding. These data were corrected
for the difference in molecular weight between RF-C and RF-C-1 N. The
binding of RF-C to DNA is increased by ATP, and even more so by the
nonhydrolyzable analog ATP S (11, 12). In agreement with those
results, strong binding to the chip was observed with either RF-C or
RF-C-1 N when ATP S was included in the buffer. The small
difference in binding between the two complexes may reflect the
residual contribution of the ligase homology domain (Fig. 3).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
The ligase homology domain of RF-C enhances
nonspecific DNA binding. Surface plasmon resonance measurements
were carried out as described under "Experimental Procedures." A
schematic of the sensor chip is shown (B, biotin;
Av, streptavidin). Protein flow was started at
t = 0 and stopped at t = 175 s.
ATP S (10 µM) was added where indicated. Measured
response units were divided by the molecular weight of RF-C or
RF-C-1 N as appropriate to obtain molar responses (in arbitrary
units). The maximal signal for RF-C + ATP S at 175 s was 1500 response units.
|
|
DNA Replication Activity of RF-C-1 N--
We compared the
replication activity of wild-type RF-C with that of RF-C-1 N using
singly primed mp18 DNA. In this assay PCNA is loaded onto the primed
circular template by RF-C, and processive replication is carried out by
the PCNA-Pol complex. Increasing amounts of RF-C or RF-C-1 N were
preincubated with PCNA and DNA, and replication was started by the
addition of Pol . In this assay, no significant differences were
observed between the molar activities of RF-C and RF-C-1 N (Fig.
4A). This was the case
regardless whether E. coli SSB or the yeast single-stranded
binding protein replication protein A was used to coat the SS DNA
(results not shown). Turnover of RF-C to load PCNA at additional primer
termini is negligible in the mp18 replication assay. Therefore, we
assessed loading on the homopolymeric template-primer system
poly(dA)-oligo(dT) template, in which the DNA ends may promote complex
dissociation (40). Indeed, on this DNA substrate, RF-C-1 N shows
about 5-fold more replication activity than RF-C (Fig. 4B),
indicative of nonspecific binding of RF-C or a failure to dissociate
after complete replication of the template.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 4.
Replication properties of RF-C and
RF-C-1 N on singly primed SS mp18 DNA
(A) or poly(dA)-(dT)22
(B). For details, see under "Experimental
Procedures."
|
|
Nonspecific binding of RF-C to SS DNA might also be inhibitory to
replication if the bound RF-C could not be displaced by the polymerase.
This inhibition by excess RF-C was actually observed, in particular
when DNA replication was carried out at 14 °C. In the experiment
shown in Fig. 5A, PCNA and Pol
were loaded onto primed mp18 DNA by RF-C-1 N, and the DNA-protein
complex was separated from unbound proteins by filtration through a
Biogel A-5m column. Replication was then started at 14 °C by
addition of dNTPs, and after 1 min, a 15-fold molar excess of RF-C or
RF-C-1 N was added to the reaction, and time aliquots were analyzed
by alkaline agarose gel electrophoresis (Fig. 5A). The data
clearly show a much stronger inhibition of replication by RF-C (80%)
than by RF-C-1 N (20% inhibition).

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 5.
Excess RF-C inhibits DNA replication without
unloading PCNA. A, replication at 14 °C of isolated
complexes without additional RF-C or with a 15-fold molar excess of
RF-C or RF-C-1 N as indicated. A schematic of the assay is indicated
at the top. B, Biogel A-5m elution profiles of
isolated replication complexes challenged with RF-C or RF-C-1 N with
or without added ATP. A diagram of the assay is given at the
top. For details, see under "Experimental
Procedures."
|
|
One possible explanation of the observed results could be that excess
RF-C unloads PCNA, thereby terminating replication, and that RF-C is
more efficient at unloading than RF-C-1 N. To investigate that
possibility, the above assay was expanded with two modifications.
First, a 32P-labeled form of PCNA replaced wild-type PCNA,
which allowed us to monitor the fate of PCNA by scintillation counting.
Previously, we have shown that this PCNA variant is catalytically
indistinguishable from wild-type (41). Secondly, in order to
investigate whether ATP or dATP, both of which are proficient in the
loading reaction, affected inhibition of replication or the
DNA-association status of PCNA, dAMP-PNP replaced dATP during DNA
synthesis. This analog is active for incorporation by the polymerase
but inactive for loading (7). With these modifications, a strong
inhibition of replication by excess RF-C compared with excess
RF-C-1 N was observed, similar to that shown in Fig. 5A
(results not shown). Isolated replication complexes were incubated at
14 °C with dNTP-PNPs, and after 1 min, a 15-fold molar excess of
RF-C or RF-C-1 N with or without 0.5 mM ATP was added to
the reaction and incubation continued for an additional 19 min at
14 °C. The reaction was then chilled on ice and subjected to a
second gel filtration column. Radioactivity, indicative of
32P-PCNA, was then determined. The elution profiles in Fig.
5B clearly show that PCNA remains associated with the DNA
under all conditions. Therefore, inhibition by excess RF-C is not due
to unloading of PCNA.
Analysis of a Yeast Mutant Lacking the Ligase Homology
Domain--
The mutant rfc1- N gene was introduced into
haploid yeast cells as the sole source of RFC1 as described
under "Experimental Procedures." Not only was the mutant viable, it
also showed no growth defect at the three temperatures tested,
i.e. 13, 30, and 37 °C (Fig.
6, data not shown). In particular, growth
at 13 °C was tested because all conditional RFC1 mutants
isolated to date have been cold-sensitive alleles (42, 43). Microscopic
examination of cells grown at 13 °C showed no increase in the
percentage of large budded cells, which would have been indicative of a
defect at G2/M at the low temperature (data not shown).
This indicates that the N terminus of RFC1 is also
dispensable for RF-C activity in vivo.

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 6.
Sensitivity of a rfc1- N
strain to DNA damaging agents. Serial 10-fold dilutions of
the mutant and the isogenic wild-type strains were plated as drops
(containing 102, 103, 104, or
105 cells) on YPDA medium and grown at 13 °C for 7 days,
irradiated with 100 J/m2 UV light, and either grown at
30 °C for 3 days, grown on YPDA in the presence of 0.005% MMS for 2 days, or grown on YPDA in the presence of 100 mM
hydroxyurea (HU) for 4 days. The experiment was carried out
twice without significant variation, except for the MMS data. The
rfc1- N mutant was consistently between 2- and 10-fold
more sensitive to MMS than the isogenic wild-type strain (the
experiment showing the most dramatic difference is shown in the
figure). There was no clear correlation in sensitivity to MMS with the
concentration of MMS used (0.005-0.015%), the number of generations
that the mutant had been propagated (30 or 70 generations), or the
growth temperature (13, 30, or 37 °C). However, in each MMS
experiment, several independent isolates of the mutant strain showed
identical sensitivity.
|
|
To assess whether the ligase homology domain functions in DNA repair,
the mutant was tested for sensitivity to different DNA damaging agents.
Strains were grown in the presence of 110 mM hydroxyurea or
0.005-0.015% MMS or exposed to ultraviolet light. Again, these
experiments were performed at 13, 30, and 37 °C. The mutant strain
did not show any increased sensitivity to hydroxyurea or ultraviolet
light at the three temperatures tested. However, a slight sensitivity
to MMS was observed in the rfc1- N mutant compared with
wild-type (Fig. 6). The sensitivity varied between experiments, the
mutant strain being between 2- and 10-fold more sensitive to MMS (see
legend to Fig. 6).
The effect of deletion of the ligase homology on recombination was
tested in a strain containing a direct repeat of the 2.2-kb LEU2 gene, separated by 4.4 kb of DNA containing the
URA3 gene (plus 3 kb of vector sequences). Intragenic
recombination between the repeats proceeds with deletion of the
URA3 gene and can be scored by plating on 5-fluoroorotic
acid-containing plates (see under "Experimental Procedures" for
details). Recombination frequencies were 1.4 ± 0.4 × 10 5 for the wild-type strain and 1.6 ± 0.4 × 10 5 for the rfc1- N mutant. The virtual
identity of the two frequencies indicates that there is no defect in
homologous recombination in the rfc1- N mutant.
RF-C is required for proper telomere maintenance (35). A
RFC1 deletion strain containing two plasmids, one with the
wild-type RFC1 on an URA3 plasmid and one with
the truncation gene rfc1- N on a TRP1 plasmid,
was grown on 5-fluoroorotic acid medium to allow only growth of cells
with rfc1- N as the sole source for Rfc1p (see under
"Experimental Procedures"). The cells were propagated in rich
medium for up to 120 generations, and DNA prepared from cells after 30, 70, and 120 generations. The chromosomal DNA was digested with
XhoI. XhoI cuts in the subtelomeric Y'-sequence and in wild-type strains produces a fragment of 1.1-1.4 kb that includes 0.2-0.4 kb of telomeric repeat DNA (G1-3T) (35). A Southern blot analysis with a telomeric probe showed that the length
of telomeric XhoI fragments was identical between the
rfc1- N strain and the wild-type control and that this
length was maintained over 120 generations of growth. Therefore,
strains deficient for the ligase homology domain of Rfc1p show no
defect in telomere maintenance and telomere length regulation (Fig.
7).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 7.
The rfc1- N strain is not
defective for telomere length maintenance. The strains were grown
at 30 °C in YPDA medium for the indicated number of generations.
Southern analysis of telomere ends, migrating at ~1.2 kb, was
performed. See under "Experimental Procedures" for details.
|
|
 |
DISCUSSION |
The studies reported here show that heteropentameric RF-C can be
overproduced in E. coli in sufficient quantities for
biophysical studies. The success of the project hinged on the
dispensability of the N-terminal domain of Rfc1p for function and on
the concomitant overproduction of the argU tRNA for the rare arginine
codons AGA and AGG. This strategy still produced the small Rfc proteins
in an approximately 5-fold excess over Rfc1- N, so that after
purification about 1 mg of RF-C and 5 mg of Rfc2-5 were obtained per
liter of cells. The Rfc2-5 complex will be of value in biophysical
studies and in reconstitution studies with Rfc-like proteins that may take the place of Rfc1p to form alternative complexes. One of these
potential RFC1 homologues is CTF18
(CHL12), which may function to link the replication
apparatus to the chromosome segregation apparatus, and another is
RAD24, which is involved in checkpoint function and
interacts with the small RF-C subunits (44, 45).
A comparison of the replication properties of RF-C-1 N with wild-type
RF-C isolated from a yeast overproduction strain showed no difference
when primed circular mp18 DNA was the substrate (Fig. 4A).
As no appreciable turnover of RF-C occurs in this assay system, it
allows us to quantitate the molar activity of the RF-C preparations:
both are about 70-80% active. For both RF-C preparations, obtaining
such an active enzyme preparation is critically dependent on
stabilization of the enzyme and prevention of aggregation by including
broad range ampholytes during purification and storage (Fig. 2). The
results with the truncation enzyme differ substantially from analogous
experiments with human RF-C, in which the presence of the N-terminal
domain of Rfc1 was found to be very inhibitory for replication of
circular DNA substrates (23, 25). In the yeast system, a lower
replication activity of RF-C compared with RF-C-1 N was only observed
on poly(dA)-oligo(dT) (Fig. 4B). In contrast to the circular
mp18 system, replication of a linear template-primer may require
multiple PCNA loading events by the clamp loader in order to achieve
the formation of a productive complex between PCNA and Pol because
the loaded PCNA can rapidly slide off the end of the linear DNA.
Consequently, replication of linear DNA is less efficient than
replication of circular DNA (40, 46). In addition, as complete
replication of the linear template is expected to promote complex
dissociation, recycling of the complex to a new template-primer is
promoted. Therefore, it is likely that the decreased activity of RF-C
in the linear DNA replication assay indicates slower dissociation of
the wild-type enzyme in comparison to RF-C-1 N.
In a study to determine whether inhibition of replication could also
occur through nonspecific binding of RF-C to SS DNA or at sites of
secondary structure, we measured DNA replication by Pol holoenzyme
in the presence of a large excess of RF-C or RF-C-1 N. At 30 °C, a
moderate inhibition was observed by RF-C (data not shown), but this
inhibition was accentuated at 14 °C (Fig. 5A). Through
isolation of complex intermediates, we showed that this inhibition was
not a result of unloading of PCNA at high concentrations of RF-C (Fig.
5B). Most likely, the inhibition occurs through the strong
nonspecific binding of RF-C to SS DNA, as shown in Fig. 3. Inhibition
may be accentuated at sites of secondary structures that would be
stabilized at 14 °C. In agreement with this conclusion is the
observation that in the presence of excess RF-C, replication
intermediates accumulate at pause sites (Fig. 5A).
Biochemical studies with the isolated human ligase homology domain show
that DNA binding is strongly stimulated by the presence of a recessed
or blunt end 5'-phosphate in partial duplex structures (26). In
addition, the domain shows a binding preference for telomeric repeat
sequences (27). The substrate binding specificity of this domain
suggests a possible function in Okazaki fragment maturation or telomere
maintenance. However, the preference for recessed 5'-phosphates would
also be consistent with a function for the ligase homology domain in
repair pathways such as base excision repair or nucleotide excision
repair, which proceed via filling in of repair gaps.
Previously, Holm and co-workers (17) had shown that N-terminal
truncations of the yeast RFC1 gene up to amino acid ~150 could complement a cold-sensitive rfc1-1 mutation (17).
Similarly, these N-terminal truncations complemented an allele of
RFC1 inactivated by insertional mutagenesis in the middle of
the gene. However, one N-terminal truncation that deleted into the
ligase homology domain showed only partial complementation. In
addition, a cold-sensitive allele of RFC1,
cdc44-10, with two mutations in the ligase homology domain,
G185E and P234L, showed cold sensitivity for growth and sensitivity to
MMS (42). Most recently, Alani and co-workers (43) isolated another
RFC1 allele by insertional mutagenesis of transposon Tn3.
Most likely expressed from a promoter inside the transposon, this
mutant allele may make a truncated protein starting at amino acid 318, the first methionine after the insertion point, at a position very
close to domain II. As with the double point mutant isolated by Holm
and co-workers (17), the insertional mutant also shows cold sensitivity
for growth, sensitivity to DNA damaging agents, and an increased rate
of spontaneous mutations, suggesting that the N-terminal domain of
Rfc1p may be important for DNA replication and DNA repair (42, 43).
In order to study the in vivo effect of the RFC1
truncation that we used in our expression studies, we created a mutant
strain with a complete deletion of the RFC1 gene to avoid
possible complications due to interallelic complementation. The
complementing wild-type RFC1 gene or the truncation
rfc1- N ( 3-273) allele was carried on a centromere
based plasmid under control of the native promoter. The mutant showed
no defect in growth at any temperature in the presence or absence of
the replication inhibitor hydroxyurea or in telomere maintenance (Figs.
5 and 6), nor could we detect a defect in homologous recombination in a
intrachromosomal recombination assay. However, a slight sensitivity to
MMS, but not to UV-irradiation, was observed in the
rfc1- N mutant, indicative of a minor repair defect.
Perhaps the mutant is partially defective for base excision repair,
which in yeast also uses the PCNA-Pol / replication system (47,
48).
The difference in observed phenotype between mutant strains with the
cdc44-10 or rfc1::Tn3 alleles on one
hand and the rfc1- N allele on the other hand cannot be
easily rationalized. Perhaps the mutations in cdc44-10,
which allele was identified in a cold sensitivity screen, cause
misfolding or destabilization of the entire Rfc1p subunit at the
restrictive temperature. For the rfc1::Tn3 allele,
the observed defects may also be caused by the close proximity of the
internal methionine start site to domain II or inappropriate expression
of the truncated protein from the cryptic promoter inside the Tn3 cassette.
In conclusion, the successful overexpression of RF-C in bacteria and
stabilization of the complex opens the way for more thorough biophysical and biochemical studies of the eukaryotic clamp loader. It
also makes it possible to study mutants of RF-C that, because of their
lethality, cannot be overproduced in yeast. We have already used this
overproduction system to isolate mutant RF-C complexes with mutations
in the ATP-binding domains of several subunits.
 |
ACKNOWLEDGEMENTS |
We thank John Majors for critical discussions
during the progress of this work, Gabriel Waksman for help with the
light scattering measurements, and Ying Li for information regarding
the purification of the Rfc2-5 complex.
 |
FOOTNOTES |
*
This work was supported in part by Grant GM32431 from the
National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported in part by a fellowship from the W. M. Keck Foundation.
§
To whom correspondence should be addressed: Dept. of Biochemistry
and Molecular Biophysics, Washington University School of Medicine, 660 S. Euclid, St. Louis, MO 63110. Tel.: 314-362-3872; Fax:
314-362-7183; E-mail: burgers@biochem.wustl.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
SS, single-stranded;
SSB, single-stranded binding protein;
Pol , DNA polymerase ;
PCNA, proliferating cell nuclear antigen;
RF-C, replication factor C;
RF-C-1 N, RF-C with the rfc1- Np subunit;
dAMP-PNP, 2'-deoxyadenyl-5'-yl imidodiphosphate;
MMS, methylmethane sulfonate;
kb, kilobase pair;
PCR, polymerase chain reaction;
TEMED, N,N,N',N'-tetramethylethylenediamine;
dAMP-PNP, 2'-deoxyadeny-5'-yl-imidodiphosphate;
ATP S, adenosine
5'-O-(thiotriphosphate).
 |
REFERENCES |
| 1.
|
Prelich, G.,
Tan, C. K.,
Kostura, M.,
Mathews, M. B.,
So, A. G.,
Downey, K. M.,
and Stillman, B.
(1987)
Nature
326,
517-520[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Tsurimoto, T.,
and Stillman, B.
(1989)
Mol. Cell. Biol.
9,
609-619[Abstract/Free Full Text]
|
| 3.
|
Bauer, G. A.,
and Burgers, P. M. J.
(1990)
Nucleic Acids Res.
18,
261-265[Abstract/Free Full Text]
|
| 4.
|
Krishna, T. S.,
Kong, X.-P.,
Gary, S.,
Burgers, P. M.,
and Kuriyan, J.
(1994)
Cell
79,
1233-1243[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Tan, C. K.,
Castillo, C.,
So, A. G.,
and Downey, K. M.
(1986)
J. Biol. Chem.
261,
12310-12316[Abstract/Free Full Text]
|
| 6.
|
Bauer, G. A.,
and Burgers, P. M. J.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
7506-7510[Abstract/Free Full Text]
|
| 7.
|
Burgers, P. M. J.
(1991)
J. Biol. Chem.
266,
22698-22706[Abstract/Free Full Text]
|
| 8.
|
Kelman, Z.
(1997)
Oncogene
14,
629-640[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Tsurimoto, T.,
and Stillman, B.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
1023-1027[Abstract/Free Full Text]
|
| 10.
|
Yoder, B. L.,
and Burgers, P. M. J.
(1991)
J. Biol. Chem.
266,
22689-22697[Abstract/Free Full Text]
|
| 11.
|
Fien, K.,
and Stillman, B.
(1992)
Mol. Cell. Biol.
12,
155-163[Abstract/Free Full Text]
|
| 12.
|
Tsurimoto, T.,
and Stillman, B.
(1991)
J. Biol. Chem.
266,
1950-1960[Abstract/Free Full Text]
|
| 13.
|
Gerik, K. J.,
Gary, S. L.,
and Burgers, P. M. J.
(1997)
J. Biol. Chem.
272,
1256-1262[Abstract/Free Full Text]
|
| 14.
|
Li, X.,
and Burgers, P. M. J.
(1994)
J. Biol. Chem.
269,
21880-21884[Abstract/Free Full Text]
|
| 15.
|
Li, X.,
and Burgers, P. M.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
868-872[Abstract/Free Full Text]
|
| 16.
|
Noskov, V.,
Maki, S.,
Kawasaki, Y.,
Leem, S. H.,
Ono, B.,
Araki, H.,
Pavlov, Y.,
and Sugino, A.
(1994)
Nucleic Acids Res.
22,
1527-1535[Abstract/Free Full Text]
|
| 17.
|
Howell, E. A.,
McAlear, M. A.,
Rose, D.,
and Holm, C.
(1994)
Mol. Cell. Biol.
14,
255-267[Abstract/Free Full Text]
|
| 18.
|
Cullmann, G.,
Fien, K.,
Kobayashi, R.,
and Stillman, B.
(1995)
Mol. Cell. Biol.
15,
4661-4671[Abstract]
|
| 19.
|
Gary, S. L.,
and Burgers, P. M.
(1995)
Nucleic Acids Res.
23,
4986-4991[Abstract/Free Full Text]
|
| 20.
|
Walker, J. E.,
Saraste, M.,
Runswick, M. J.,
and Gay, N. J.
(1982)
EMBO J.
1,
945-951[Medline]
[Order article via Infotrieve]
|
| 21.
|
Bunz, F.,
Kobayashi, R.,
and Stillman, B.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
11014-11018[Abstract/Free Full Text]
|
| 22.
|
Uhlmann, F.,
Gibbs, E.,
Cai, J.,
O'Donnell, M.,
and Hurwitz, J.
(1997)
J. Biol. Chem.
272,
10065-10071[Abstract/Free Full Text]
|
| 23.
|
Uhlmann, F.,
Cai, J.,
Gibbs, E.,
O'Donnell, M.,
and Hurwitz, J.
(1997)
J. Biol. Chem.
272,
10058-10064[Abstract/Free Full Text]
|
| 24.
|
Fotedar, R.,
Mossi, R.,
Fitzgerald, P.,
Rousselle, T.,
Maga, G.,
Brickner, H.,
Messier, H.,
Kasibhatla, S.,
Hubscher, U.,
and Fotedar, A.
(1996)
EMBO J.
15,
4423-4433[Medline]
[Order article via Infotrieve]
|
| 25.
|
Podust, V. N.,
Tiwari, N.,
Stephan, S.,
and Fanning, E.
(1998)
J. Biol. Chem.
273,
31992-31999[Abstract/Free Full Text]
|
| 26.
|
Allen, B. L.,
Uhlmann, F.,
Gaur, L. K.,
Mulder, B. A.,
Posey, K. L.,
Jones, L. B.,
and Hardin, S. H.
(1998)
Nucleic Acids Res.
26,
3877-3882[Abstract/Free Full Text]
|
| 27.
|
Uchiumi, F.,
Watanabe, M.,
and Tanuma, S.
(1999)
Biochem. Biophys. Res. Commun.
258,
482-489[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Burgers, P. M. J.,
and Gerik, K. J.
(1998)
J. Biol. Chem.
273,
19756-19762[Abstract/Free Full Text]
|
| 29.
|
Ayyagari, R.,
Impellizzeri, K. J.,
Yoder, B. L.,
Gary, S. L.,
and Burgers, P. M.
(1995)
Mol. Cell. Biol.
15,
4420-4429[Abstract]
|
| 30.
|
Schenk, P. M.,
Baumann, S.,
Mattes, R.,
and Steinbiss, H. H.
(1995)
BioTechniques
19,
196-198[Medline]
[Order article via Infotrieve]
|
| 31.
|
Sikorski, R. S.,
and Hieter, P.
(1989)
Genetics
122,
19-27[Abstract/Free Full Text]
|
| 32.
|
Wach, A.
(1996)
Yeast
12,
259-265[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Kaiser, C.,
Michaelis, S.,
and Mitchell, A.
(1994)
Methods in Yeast Genetics
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 34.
|
Eissenberg, J. C.,
Ayyagari, R.,
Gomes, X. V.,
and Burgers, P.
(1997)
Mol. Cell. Biol.
17,
6367-6378[Abstract]
|
| 35.
|
Adams, A. K.,
and Holm, C.
(1996)
Mol. Cell. Biol.
16,
4614-4620[Abstract]
|
| 36.
|
Cai, J.,
Gibbs, E.,
Uhlmann, F.,
Phillips, B.,
Yao, N.,
O'Donnell, M.,
and Hurwitz, J.
(1997)
J. Biol. Chem.
272,
18974-18981[Abstract/Free Full Text]
|
| 37.
|
Garcia, G. M.,
Mar, P. K.,
Mullin, D. A.,
Walker, J. R.,
and Prather, N. E.
(1986)
Cell
45,
453-459[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Spanjaard, R. A.,
Chen, K.,
Walker, J. R.,
and van Duin, J.
(1990)
Nucleic Acids Res.
18,
5031-5036[Abstract/Free Full Text]
|
| 39.
|
Schagger, H.,
and von, J., G.
(1987)
Anal. Biochem.
166,
368-379[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Burgers, P. M. J.,
and Yoder, B. L.
(1993)
J. Biol. Chem.
268,
19923-19936[Abstract/Free Full Text]
|
| 41.
|
Beckwith, W. H.,
Sun, Q.,
Bosso, R.,
Gerik, K. J.,
Burgers, P. M.,
and McAlear, M. A.
(1998)
Biochemistry
37,
3711-3722[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
McAlear, M. A.,
Tuffo, K. M.,
and Holm, C.
(1996)
Genetics
142,
65-78[Abstract]
|
| 43.
|
Xie, Y.,
Counter, C.,
and Alani, E.
(1999)
Genetics
151,
499-509[Abstract/Free Full Text]
|
| 44.
|
Skibbens, R. V.,
Corson, L. B.,
Koshland, D.,
and Hieter, P.
(1999)
Genes Dev.
13,
307-319[Abstract/Free Full Text]
|
| 45.
|
Shimomura, T.,
Ando, S.,
Matsumoto, K.,
and Sugimoto, K.
(1998)
Mol. Cell. Biol.
18,
5485-5491[Abstract/Free Full Text]
|
| 46.
|
Podust, L. M.,
Podust, V. N.,
Floth, C.,
and Hubscher, U.
(1994)
Nucleic Acids Res.
22,
2970-2975[Abstract/Free Full Text]
|
| 47.
|
Wang, Z.,
Wu, X.,
and Friedberg, E. C.
(1993)
Mol. Cell. Biol.
13,
1051-1058[Abstract/Free Full Text]
|
| 48.
|
Blank, A.,
Kim, B.,
and Loeb, L. A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
9047-9051[Abstract/Free Full Text]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. M. Stith, J. Sterling, M. A. Resnick, D. A. Gordenin, and P. M. Burgers
Flexibility of Eukaryotic Okazaki Fragment Maturation through Regulated Strand Displacement Synthesis
J. Biol. Chem.,
December 5, 2008;
283(49):
34129 - 34140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Chilkova, P. Stenlund, I. Isoz, C. M. Stith, P. Grabowski, E.-B. Lundstrom, P. M. Burgers, and E. Johansson
The eukaryotic leading and lagging strand DNA polymerases are loaded onto primer-ends via separate mechanisms but have comparable processivity in the presence of PCNA
Nucleic Acids Res.,
October 8, 2007;
35(19):
6588 - 6597.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Wood, P. Garg, and P. M. J. Burgers
A Ubiquitin-binding Motif in the Translesion DNA Polymerase Rev1 Mediates Its Essential Functional Interaction with Ubiquitinated Proliferating Cell Nuclear Antigen in Response to DNA Damage
J. Biol. Chem.,
July 13, 2007;
282(28):
20256 - 20263.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Hashiguchi, Y. Matsumoto, and A. Yasui
Recruitment of DNA repair synthesis machinery to sites of DNA damage/repair in living human cells
Nucleic Acids Res.,
May 14, 2007;
35(9):
2913 - 2923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Johnson, N. Y. Yao, G. D. Bowman, J. Kuriyan, and M. O'Donnell
The Replication Factor C Clamp Loader Requires Arginine Finger Sensors to Drive DNA Binding and Proliferating Cell Nuclear Antigen Loading
J. Biol. Chem.,
November 17, 2006;
281(46):
35531 - 35543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Majka, S. K. Binz, M. S. Wold, and P. M. J. Burgers
Replication Protein A Directs Loading of the DNA Damage Checkpoint Clamp to 5'-DNA Junctions
J. Biol. Chem.,
September 22, 2006;
281(38):
27855 - 27861.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Masuda and K. Kamiya
Role of Single-stranded DNA in Targeting REV1 to Primer Termini
J. Biol. Chem.,
August 25, 2006;
281(34):
24314 - 24321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Seki, M. Akita, Y. Kamimura, S. Muramatsu, H. Araki, and A. Sugino
GINS Is a DNA Polymerase {epsilon} Accessory Factor during Chromosomal DNA Replication in Budding Yeast
J. Biol. Chem.,
July 28, 2006;
281(30):
21422 - 21432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kobayashi, F. Figaroa, N. Meeuwenoord, L. E. T. Jansen, and G. Siegal
Characterization of the DNA Binding and Structural Properties of the BRCT Region of Human Replication Factor C p140 Subunit
J. Biol. Chem.,
February 17, 2006;
281(7):
4308 - 4317.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kim, K. Robertson, K. J. L. Mylonas, F. C. Gray, I. Charapitsa, and S. A. MacNeill
Contrasting effects of Elg1-RFC and Ctf18-RFC inactivation in the absence of fully functional RFC in fission yeast
Nucleic Acids Res.,
July 21, 2005;
33(13):
4078 - 4089.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. O. Bylund and P. M. J. Burgers
Replication Protein A-Directed Unloading of PCNA by the Ctf18 Cohesion Establishment Complex
Mol. Cell. Biol.,
July 1, 2005;
25(13):
5445 - 5455.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Franco, W. M. Lam, P. M. Burgers, and P. D. Kaufman
Histone deposition protein Asf1 maintains DNA replisome integrity and interacts with replication factor C
Genes & Dev.,
June 1, 2005;
19(11):
1365 - 1375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. H. Jin, P. Garg, C. M. W. Stith, H. Al-Refai, J. F. Sterling, L. J. W. Murray, T. A. Kunkel, M. A. Resnick, P. M. Burgers, and D. A. Gordenin
The Multiple Biological Roles of the 3'->5' Exonuclease of Saccharomyces cerevisiae DNA Polymerase {delta} Require Switching between the Polymerase and Exonuclease Domains
Mol. Cell. Biol.,
January 1, 2005;
25(1):
461 - 471.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Yao, L. Coryell, D. Zhang, R. E. Georgescu, J. Finkelstein, M. M. Coman, M. M. Hingorani, and M. O'Donnell
Replication Factor C Clamp Loader Subunit Arrangement within the Circular Pentamer and Its Attachment Points to Proliferating Cell Nuclear Antigen
J. Biol. Chem.,
December 12, 2003;
278(50):
50744 - 50753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Ayyagari, X. V. Gomes, D. A. Gordenin, and P. M. J. Burgers
Okazaki Fragment Maturation in Yeast. I. DISTRIBUTION OF FUNCTIONS BETWEEN FEN1 AND DNA2
J. Biol. Chem.,
January 10, 2003;
278(3):
1618 - 1625.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M. Hingorani and M. M. Coman
On the Specificity of Interaction between the Saccharomyces cerevisiae Clamp Loader Replication Factor C and Primed DNA Templates during DNA Replication
J. Biol. Chem.,
November 27, 2002;
277(49):
47213 - 47224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. V. Gomes and P. M. J. Burgers
ATP Utilization by Yeast Replication Factor C. I. ATP-MEDIATED INTERACTION WITH DNA AND WITH PROLIFERATING CELL NUCLEAR ANTIGEN
J. Biol. Chem.,
September 7, 2001;
276(37):
34768 - 34775.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. G. Schmidt, X. V. Gomes, and P. M. J. Burgers
ATP Utilization by Yeast Replication Factor C. III. THE ATP-BINDING DOMAINS OF Rfc2, Rfc3, AND Rfc4 ARE ESSENTIAL FOR DNA RECOGNITION AND CLAMP LOADING
J. Biol. Chem.,
September 7, 2001;
276(37):
34784 - 34791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. V. Gomes, S. L. G. Schmidt, and P. M. J. Burgers
ATP Utilization by Yeast Replication Factor C. II. MULTIPLE STEPWISE ATP BINDING EVENTS ARE REQUIRED TO LOAD PROLIFERATING CELL NUCLEAR ANTIGEN ONTO PRIMED DNA
J. Biol. Chem.,
September 7, 2001;
276(37):
34776 - 34783.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|