|
J Biol Chem, Vol. 275, Issue 2, 1095-1104, January 14, 2000
Muscle Develops a Specific Form of Small Heat Shock Protein
Complex Composed of MKBP/HSPB2 and HSPB3 during Myogenic
Differentiation*
Yuki
Sugiyama ,
Atsushi
Suzuki §,
Masaru
Kishikawa ,
Rika
Akutsu ,
Tomonori
Hirose ,
Mary M. Y.
Waye¶,
Stephan
K. W.
Tsui¶,
Shosei
Yoshida , and
Shigeo
Ohno **
From the Department of Molecular Biology, Yokohama
City University School of Medicine, Kanazawa-ku, Yokohama 236-0004, Japan, the ¶ Department of Biochemistry, The Chinese University of
Hong Kong, Shatin, N.T., Hong Kong, and the Department of
Pathology and Tumor Biology, Graduate School of Medicine, Kyoto
University, Sakyo-ku, Kyoto 606-8501, Japan
 |
ABSTRACT |
Previously, we identified a new
mammalian sHSP, MKBP, as a myotonic dystrophy protein kinase-binding
protein, and suggested its important role in muscle maintenance
(Suzuki, A., Sugiyama, Y., Hayashi, Y., Nyu-i, N., Yoshida, M., Nonaka,
I., Ishiura, S., Arahata, K., and Ohno, S. (1998) J. Cell
Biol. 140, 1113-1124). In this paper, we develop the former work
by performing extensive characterization of five of the six sHSPs so
far identified, that is, HSP27, B-crystallin, p20, MKBP/HSPB2, and
HSPB3, omitting lens-specific A-crystallin. Tissue distribution
analysis revealed that although each sHSP shows differential
constitutive expression in restricted tissues, tissues that express all
five sHSPs are only muscle-related tissues. Especially, the expressions
of HSPB3, identified for the first time as a 17-kDa protein in this
paper, and MKBP/HSPB2 are distinctly specific to muscles. Moreover,
these sHSPs form an oligomeric complex with an apparent molecular mass of 150 kDa that is completely independent of the oligomers formed by
HSP27, B-crystallin, and p20. The expressions of MKBP/HSPB2 and
HSPB3 are induced during muscle differentiation under the control of
MyoD, suggesting that the sHSP oligomer comprising MKBP/HSPB2 and HSPB3
represents an additional system closely related to muscle function. The
functional divergence among sHSPs in different oligomers is also
demonstrated in several ways: 1) an interaction with myotonic dystrophy
protein kinase, which has been suggested to be important for the
maintenance of myofibril integrity, was observed only for MKBP/HSPB2;
2) a myotube-specific association with actin bundles was observed for
HSP27 and B-crystallin, but not for MKBP/HSPB2; and 3) sHSPs whose
mRNAs are induced by heat shock are B-crystallin and HSP27.
Taken together, the results suggest that muscle cells develop two kinds
of stress response systems composed of diverged sHSP members, and that
these systems work independently in muscle maintenance and differentiation.
 |
INTRODUCTION |
Heat shock and numerous other stress conditions lead to the rapid
induction of several genes whose protein products, collectively called
heat shock proteins (HSPs),1
play protective roles in cell survival (1). Considering that muscles
are frequently subjected to severe conditions caused by heat,
oxidative, and mechanical stresses, especially during exercise (2),
these HSPs may be especially important in this particular tissue. In
fact, several HSPs, including HSP60, 70, and 90, have been shown to be
induced after exhaustive exercise (3). In addition, the inducible
isoform of HSP70 has been shown to be constitutively expressed in a
certain type of skeletal muscle fiber (4), suggesting that muscle cells
are chronically ready to respond to frequent stresses. However, there
have been limited numbers of studies that focus on HSPs in muscle cells.
HSPs with low molecular masses of 15-30 kDa are called small heat
shock proteins (sHSPs); they commonly share a homologous sequence of
about 80 amino acids called the " -crystallin domain" (5). Among
mammalian sHSPs, HSP272 and
B-crystallin have been studied most intensely; they show chaperone-like activity in vitro (6-8), and their
expressions are induced in response to such diverse stimuli as heat
shock, heavy metal exposure, and hypertonicity (9, 10). They confer stress resistance when overexpressed in cultured mammalian cells (11-13). The most interesting feature of their cytoprotective roles is
that they are believed to act to stabilize cytoskeletal structures such
as actin stress fibers and intermediate filaments (12, 14).
Consistently, they are also suggested to interact with these
cytoskeletal proteins in vitro (15-17). Therefore,
considering that muscle cells develop specific cytoskeletal structures
based on actin and intermediate filaments (desmin), such as myofibrils, it is reasonable to speculate that HSP27 and B-crystallin also play
important roles in muscle maintenance. In fact, several studies have
pointed out that these two sHSPs show abundant constitutive expression
in skeletal muscle and heart (18, 19). Furthermore, their roles in
organizing and protecting the myofibril structure have been suggested
by the demonstration of their localization on specific sarcomeric
structures such as Z- or I-bands, as well as their regulated expression
during development or continuous contractile stimulation (20-22).
However, because of the relative ubiquitousness of their expression,
most studies of HSP27 and B-crystallin have been performed in
non-muscle cells, and not enough attention has been paid to
demonstrating the critical roles of sHSPs in muscle cells.
Previously, we identified a novel sHSP, MKBP, as a binding protein for
myotonic dystrophy protein kinase (DMPK), the protein product of the
gene responsible for myotonic dystrophy (23). This is the same protein
as HSPB2, which was independently identified by Iwaki et al.
(24) as the protein product of a gene located in the 5' upstream region
of the B-crystallin gene. We demonstrated that this MKBP/HSBP2 binds
specifically to the kinase domain of DMPK, thus activating the kinase
activity. MKBP/HSPB2 also shows a chaperone-like activity that protects
the kinase from heat-induced inactivation. Importantly, the expression
of MKBP/HSPB2, but not other sHSPs, is specifically up-regulated in the
skeletal muscle of myotonic dystrophy patients as if to compensate for
the reduced amount of DMPK. Together with the fact that DMPK knock-out
mice develop a late-onset, progressive myopathy (25), these findings led us to propose that this kinase is involved in a stress-response system in muscle cells by being a specific target of MKBP/HSPB2 (23).
Furthermore, because MKBP/HSPB2 itself is localized not only at the
neuromuscular junction where DMPK is concentrated, but also at the
Z-band of myofibrils, we speculated that MKBP/HSPB2 also contributes to
the maintenance of myofibril integrity by interacting directly with
myofibrils independent of DMPK. Interestingly, in muscle cytosol,
MKBP/HSPB2 forms an oligomeric complex separate from that containing
HSP27 and B-crystallin. Therefore, our previous work, which provided
the first example of a correlation between a particular muscular
dystrophy and a stress-response system in muscle cells, also suggested
the presence of muscle sHSPs systems that are more complicated than
previously expected.
Recently, the number of known mammalian sHSPs has rapidly risen to six
(23, 24, 26-28), but half of them have not been sufficiently
characterized. Especially, there has been no work comparing them on the
same basis. In this study, in an attempt to analyze the suggested sHSP
systems in muscle cells, we carried out studies to characterize the
five sHSPs expected to be expressed in muscles, that is, HSP27,
B-crystallin, p20, MKBP/HSPB2, and HSPB3. We first raised an
antibody against HSPB3, the nucleotide sequence of which has been
reported to be a possible novel mammalian sHSP (27, 28), and identified
the protein product as a 17-kDa protein. We then used antibodies and
cDNAs to examine the tissue distribution, transcriptional
regulation, mutual interactions, and cellular localization of all five
sHSPs in cultured muscle cells. Based on the results, we suggest that
the sHSP family may have diverged to form two independent chaperone
systems specific for muscle cells.
 |
EXPERIMENTAL PROCEDURES |
cDNAs--
Rat p20 and human HSPB3 cDNAs were amplified
from a rat 3Y1 cell cDNA library (29) and a human skeletal muscle
cDNA library (CLONTECH Laboratories, Inc., Palo
Alto, CA), respectively, by PCR using appropriate synthetic
oligonucleotide primers flanking the ORF of each protein. The
preparation of the cDNAs for MKBP/HSPB2, B-crystallin, and HSP27
has been described previously (23). For the expression of HSPB3 in COS1
cells, we constructed an expression vector, HSPB3/SRD, by inserting a
0.64-kb fragment of an HSPB3 cDNA clone (GenBank accession number
U15590) containing 0.17 kb of the 5'-untranslated region and the whole
ORF up to the predicted stop codon into an SRD mammalian expression
vector (30).
Antibodies--
Anti-human HSPB3 rabbit polyclonal antiserum was
generated using a glutathione S-transferase-HSPB fusion
protein as an antigen. Anti-human MKBP (c-2) and anti-rat p20
polyclonal antibodies have been reported previously (23, 26). The
antibodies were affinity purified prior to use. The
anti- B-crystallin polyclonal antibody was purchased from Chemicon
International Inc. (Temecula, CA), while the anti-HSP25 polyclonal
antibody and anti-rat HSC70 polyclonal antibody were from StressGen
Biotechnologies Corp. (British Columbia, Canada). The anti-human HSP27
monoclonal antibody and the anti-mouse desmin monoclonal antibody were
purchased from Affinity Bioreagents Inc. (Colden, CO) and
Zymed Laboratories Inc. (San Francisco, CA), respectively.
RNA Analysis--
The tissue distribution of each sHSP mRNA
was analyzed using a set of Human Multiple-tissue Northern blot
membranes (CLONTECH). Total RNA from cultured cells
was prepared using a Quick Prep Total RNA Extraction kit (Amersham
Pharmacia Biotech). cDNA fragments corresponding to the whole ORF
of each sHSP were radiolabeled with [ -32P]dCTP (1 × 106 cpm/ml) and used to probe membranes to which the
RNAs were blotted as described previously (23). The probes for myogenin
and muscle creatine kinase were prepared as described previously (31). Hybridization was performed using ExpressHybTM Hybridization Solution (CLONTECH) according to the manufacturer's
instructions. The membranes were washed two times at 50 °C for 20 min except for MKBP/HSPB2, which was washed at 53 °C.
Autoradiography was carried out at 70 °C on Kodak x-ray film. When
reprobing the membranes, the remaining radioactivity was removed by
incubating the membranes in 5 mM Tris-HCl, pH 7.5, 2 mM EDTA, 0.1% SDS at 100 °C for 10 min; radioactivity
was confirmed to be negligible before the next hybridization.
RT-PCR was performed using Ready-To-Go RT-PCR beads (Amersham Pharmacia
Biotech) according to the manufacturer's instructions. The primer sets
for the mouse sHSPs were as follows: ATGTCGGGCCGCACAGTGCC and
CCTTCTCCGAAGCGCTGC for MKBP/HSPB2, ACTATGGCAAAAATCATTTTGAGG and
CTTCTCCGTGGAGGCTGAGT for HSPB3 (designed based on the published mouse
EST sequence), ATGGACATCGCCATCCACCAC and TCTGAGAGTCCGGTGTC for
B-crystallin, and ACTGGGCATGGCCTTCCGTGT and TTACTCCTTGGAGGCCATGT for glyceraldehyde-3-phosphate dehydrogenase.
Yeast Two-hybrid Analysis--
Bait and prey plasmids were
constructed by subcloning the whole ORF of each sHSP into pGBT9 or
pGAD10 (CLONTECH Laboratories, Inc.), respectively,
and an appropriate set of plasmids was simultaneously transformed into
the yeast indicator strain HF7C by standard methods (32). After 4 days
of growth at 30 °C on selective culture plates lacking tryptophan
and leucine, double transformants were replated onto histidine-lacking
plates containing 10 mM 3-aminotriazole to examine the
interaction of the introduced proteins. The results were also confirmed
by examining the -galactosidase activity of each clone with a
standard filter assay method.
Cell Cultures--
A subclone of C2C12 mouse myoblast (clone
C2/4) was used in this study (33). C3H10T1/2 (clone 8) was purchased
from American Type Culture Collection and 10TflagMyoD cells were
generated by transfecting the pME-flagMyoD expression vector together
with pSV2neo (34). All cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, with 400 µg/ml G418 added in the case of 10TflagMyoD. Differentiation was induced by culturing the cells on type I collagen-coated tissue culture
plates (Iwaki, Tokyo), and then switching the cells to serum-free ITS
medium consisting of Dulbecco's modified Eagle's medium supplemented
with 10 µg/ml insulin, 5 µg/ml transferrin, 10 nmol of selenite
(Life Technologies, Inc., Grand Island, NY). For heat treatment, the
cells were exposed to transitory heat shock by floating them on a water
at appropriate temperatures for 15-60 min; the cells were then
recovered by culturing at 37 °C for appropriate times before harvest.
Preparation of Tissue Extracts for SDS-PAGE--
Ten-week-old SD
rats were fasted overnight and killed under ether anesthesia or by
cardioectomy. Organs and tissues were excised and washed with ice-cold
PBS, frozen immediately in liquid nitrogen, and then crushed into a
powder with a CRYO-PRESS (Diatron, Ltd., Tokyo, Japan) precooled in
liquid nitrogen. The powders were suspended in 10 volumes (v/w) of SDS
sample buffer (2% SDS, 1 mM EDTA, 70 mM
Tris-HCl, pH 6.7, 10% glycerol, 125 mM 2-mercaptoethanol,
0.02% bromphenol blue), homogenized with a POLYTRON homogenizer
(KINEMATICA AG, Littau/Luzern, Switzerland), and sonicated. A human
skeletal muscle extract was prepared by similarly processing a small
block of frozen limb muscle (biceps bracii) obtained for diagnostic purposes with informed consent. The samples were heat-denatured at
100 °C for 5 min. Total protein concentrations in the samples were
determined by spotting aliquots of each sample onto nitrocellulose membranes (Hybond-C extra, Amersham Pharmacia Biotech) and staining with Coomassie Brilliant Blue. The stained spots were quantified densitometrically using bovine serum albumin as a standard. The amounts
of each sHSP in a certain volume of human skeletal muscle solubilized
as described above were estimated by Western blot analysis based on
standard data obtained using purified recombinant human sHSPs.
Gel Filtration Analysis of Rat Muscle Extracts--
The frozen
rat skeletal or cardiac muscle powders were suspended in 10 volumes
(v/w) of lysis buffer (20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 5 mM EDTA, 5 mM EGTA, 10 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 0.5 mM dithiothreitol) and
homogenized by 10 strokes of a Dounce homogenizer. The lysates were
centrifuged at 130,000 × g for 40 min at 4 °C, and
the supernatants were loaded onto a prepacked Superose 12 (HR10/30)
column equilibrated with buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2 mM EGTA, 10 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 0.5 mM dithiothreitol) at 4 °C. The
molecular mass standards used were thyroglobulin (669 kDa), apoferritin
(440 kDa), -amylase (200 kDa), bovine -globulin (158 kDa), bovine
serum albumin (67 kDa), chicken ovalbumin (45 kDa), and carbonic
anhydrase (29 kDa).
Immunoprecipitation--
Fifteen microliters of Protein
A-Sepharose (Amersham Pharmacia Biotech) was combined with 2 µg of
affinity-purified anti-MKBP/HSPB2 or anti-p20 IgG, and incubated for
1 h at 4 °C with total rat muscle extracts (150 µl) or
fractions obtained by gel filtration (260 µl). Bovine serum albumin,
0.1% (w/v), was added to the solutions to block nonspecific binding.
The resins were washed five times with lysis buffer containing 0.5%
Triton X-100. Immune complexes were eluted by agitating the resins
vigorously in 100 µl of 0.2 M glycine-HCl, pH 2.5, for 15 min at 4 °C. The supernatant was neutralized with a small aliquot of
Tris-HCl, pH 9.0, and mixed with 50 µl of 3 × SDS sample buffer.
Electrophoresis and Western Blot Analysis--
One-dimensional
SDS-PAGE (12 or 15% polyacrylamide) was performed according to the
method of Laemmli (35). The separated proteins were transferred onto
polyvinylidene fluoride membranes (Millipore Corp., Bedford, MA) which
were then soaked in 5% skimmed milk. Immunoblots were processed for
immunoreaction as described previously (36), and visualized by a
chemiluminescence ECL system (Amersham Pharmacia Biotech).
Immunohistochemistry--
C2C12 cells were fixed directly on
collagen-coated dishes using 3% formaldehyde in PBS for 30 min at room
temperature, and permeabilized with 0.1% Triton X-100 in PBS for 15 min. Detergent extraction was performed by treating the cells with
extraction buffer (10 mM Tris-HCl, pH 7.5, 5 mM
MgCl2, 10 mM NaCl, 0.1 mM phenylmethylsulfonyl fluoride, 0.5% Triton X-100) for 10 min on ice
prior to fixation. The dishes were soaked in PBS containing 10% calf
serum, cracked into several pieces, and treated with primary antibodies
for 45 min at 37 °C in a moist chamber. The samples were washed
three times with PBS containing 0.1% Tween 20, then similarly
incubated with BODIPY-conjugated goat anti-rabbit IgG antibody
(Molecular Probes, Inc., Eugene, OR). After washing, the cells were
mounted with VECTASHIELD (Vector Laboratories, Inc., Barlingame, CA)
and observed and photographed digitally under a fluorescence microscope
(Olympus BX-50) equipped with a cooled CCD camera (Photometrics, East
Britannia Drive, Tucson, AZ).
 |
RESULTS |
Identification of a Novel sHSP with a Molecular Mass of 17 kDa
Corresponding to HSPB3 cDNA--
Among the six members of the
mammalian sHSP family so far reported, HSPL27 is the only one that has
not been identified at the protein level (27). Several errors in the
nucleotide sequence of the HSPL27 cDNA were recently corrected in
the data base to predict an ORF with 150 amino acids corresponding to a
protein with an estimated molecular mass of 16,965 kDa (GenBank
accession number U15590). Because this is identical to the sequence of HSPB3 published by Boelens et al. (28) as a corrected
version of the HSPL27 cDNA, we also use HSPB3 as a revised name for
HSPL27, according to the suggestion of the HUGO Human Gene Nomenclature Committee. To confirm the expression of endogenous HSPB3, we raised an
anti-HSPB3 rabbit polyclonal antibody using a recombinant protein as an
antigen, and detected a band with the predicted 17 kDa mass in human
skeletal muscle (Fig. 3a). The migration of this band was
identical to that of the protein product of the HSPB3 cDNA ectopically expressed in COS1 cells (Fig. 3a, lane 6; see
"Experimental Procedures"). Therefore, we conclude that the
corrected amino acid sequence for HSPB3 represents a novel sHSP with a
molecular mass of 17 kDa expressed in vivo. Northern blot
analysis of the poly(A)+ RNA from human tissues (Fig.
2a) revealed a consistent 0.84-kb transcript for HSPB3
specifically in skeletal muscle and heart (see below), although longer
exposure produced an extremely faint band of 3.7-kb in the same tissues.
The alignment of the amino acid sequence of human HSPB3 with those of
the other human sHSPs so far identified revealed it to be the most
diverged member of the family (28), showing ~40% amino acid identity
in the -crystallin domain (Fig.
1a), which is the most highly
conserved region among family members (5). In addition, it shows no
similarity in the N-terminal region (hatched bar in Fig.
1b) where another short conserved stretch is detected in
other family members.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
Comparison of the six mammalian sHSPs so far
identified. a, the percent amino acid identity among
sHSPs in the alignment of the -crystallin domain. Calculations were
carried out based on an alignment of the amino acid sequences of human
sHSPs by the CLUSTAL W program (50). b, schematic diagram
comparing the overall structures of mammalian sHSPs. Notice that HSPB3
not only shows a completely diverged N-terminal sequence, but also has
the shortest C-terminal tail following the -crystallin domain.
|
|
Muscle Is the Only Tissue That Simultaneously Expresses all Five
sHSPs--
As a first step in investigating the physiological
functions of mammalian sHSPs, we performed comparative studies of their tissue distributions by Northern blot as well as Western blot analyses.
Although there have been several studies in which the tissue
distributions of three sHSPs, HSP27, B-crystallin, and p20, were
examined individually (18, 19, 26, 37-39), this is the first study
that examines on the same basis all known members other than
lens-specific A-crystallin. Fig.
2b shows a blot of 2-µg
samples of poly(A)+ RNA isolated from various human tissues
probed successively with the cDNAs for each sHSP. To compare the
relative tissue distribution of each sHSP, the exposure time for each
autograph was normalized so that the signal for each sHSP in heart was
almost equal. Overall, the mRNAs of all sHSPs examined show clear
constitutive expression in heart and skeletal muscle. As for tissue
distribution, the mRNA for HSP27 is observed most broadly with the
richest expression in skeletal muscle and heart. The mRNAs of three
sHSPs, B-crystallin, MKBP/HSPB2, and p20, show similar distribution
patterns, with significant accumulations in skeletal muscle and heart.
Other than muscle, they are also seen in prostate, ovary, intestine, and colon. As shown previously, B-crystallin mRNA is also
expressed in kidney and brain (37). Compared with these sHSPs, the
expression of HSPB3 mRNA is unusual in its exclusive expression in
striated muscles; it is also unique in its preferential expression in
heart.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
Northern blot analysis of the expression of
each sHSP mRNA in various adult human tissues. A set of Human
Multiple Northern blots (CLONTECH) was used, in
which each lane was loaded with 2 µg of poly(A)+ RNA
isolated from the indicated tissues. a, HSPB3 cDNA
hybridizes to a 0.84-kb mRNA specifically expressed in skeletal
muscle and heart. The probe cDNA corresponds to the region encoding
the N-terminal region preceding the -crystallin domain. Note that it
also detects a faint band of 3.7 kb in the same tissues. The same
results were obtained using a cDNA fragment encoding the whole ORF
of the protein (part of the result is shown in b).
b, comparison of the tissue specificity of the expression of
each sHSP. The same blots were repeatedly probed with a succession of
different cDNA fragments corresponding to the whole ORF of each
sHSP (see "Experimental Procedures"). To demonstrate the relative
ubiquitousness of B-crystallin expression, another result obtained
at longer exposure is also shown for this sHSP alone at the
bottom of the panel. See the text for
details.
|
|
Fig. 3 shows the results of Western
blotting using polyclonal antibodies specific to each sHSP. As
described above, the newly generated antiserum against HSPB3 detected a
band of the predicted 17 kDa mass in human skeletal muscle (Fig.
3a, lane 5). The size of the band is clearly distinct from
those of other sHSPs, suggesting that the antiserum is specific for
HSPB3 and does not cross-react with other sHSPs. Fig. 3b
shows the tissue distribution of each sHSP protein in rat tissue
extracts examined using these antibodies. Here, we confirm the
ubiquitous expression of HSC70, the constitutive form of the HSP70
family, on our parallel blot (39). The exposure times were again
normalized to the signal intensity in heart. The results are consistent
with those of Northern blot analysis, although the unique tissue
distribution pattern of each sHSP was demonstrated more clearly here
than by Northern blot. This is due to the relatively increased signal
intensities for HSP27, B-crystallin, and p20 in non-muscle tissues,
especially lung, but not for MKBP/HSPB2 and HSPB3. Another discrepancy
with the Northern blot data is the appearance of the prominent band in prostate (asterisk at the top of Fig. 3b)
detected by the anti-HSPB3 antiserum. Although the antiserum shows a
lower titer and specificity for rat HSPB3, and the band indicates a
smaller molecular mass (15 kDa) than for HSPB3 in muscles, we cannot
exclude the possibility this band might represent an HSPB3-related
protein expressed in rat prostate.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 3.
Western blot analysis showing the tissue
specificity of the expression of each sHSP. a, the
newly raised anti-HSPB3 antibody specifically detects a 17-kDa protein
in human skeletal muscle extracts (lane 5). Twenty-five
micrograms of protein from human skeletal muscle was separated by 15%
SDS-PAGE and analyzed using the various antibodies indicated at the
top (lanes 1-5). The 30-kDa band observed in
lane 3 is a nonspecific band that reacted with the
anti- B-crystallin polyclonal antibody. Note that the 17-kDa protein
that reacts with the anti-HSPB3 antibody is clearly distinct from bands
with any other sHSP. This protein shows the same migration as
exogenously expressed HSPB3 in COS1 cells (lane 6). In
lane 7, COS1 cell extracts without the expression vector
were loaded as a negative control. b, tissue-specific
expression of each sHSP protein. Equal amounts of proteins extracted
from adult rat tissues (10 µg for HSP27, B-crystallin, and HSC70,
and 20 µg for MKBP/HSPB2 and HSPB3) were separated by 15% SDS-PAGE
and, after membrane transfer, subjected to immunoreaction with the
indicated antibodies. The asterisk indicates a prominent
cross-reactive band for the anti-HSPB3 antiserum observed in rat
prostate with a smaller molecular mass (15 kDa). Coomassie Brilliant
Blue staining confirmed that weak bands at the edge of the top
panel for HSPB3 observed in spleen, thymus, and prostate arise
from nonspecific staining of condensed proteins (data not shown).
|
|
It should be noted that, although detected broadly, HSP27 expression
shows a clearly restricted tissue distribution pattern as shown
previously (38, 39). On the other hand, B-crystallin and p20 show
more limited distributions, occasionally discordant in, for example,
kidney, prostate, and colon (18, 26, 38). However, there is an apparent
trend for HSP27 to be expressed abundantly in tissues where
B-crystallin or p20 accumulate, implying some correlation between
their expressions. The other two sHSPs, MKBP/HSPB2 and HSPB3, show more
specific expressions qualitatively distinct from those of HSP27,
B-crystallin, and p20. Their expressions are rather specific to
heart and skeletal muscles, and consistent with the results of Northern
blot, the expression of HSPB3 is more skewed to heart.
In summary, the results indicate that all five sHSPs are constitutively
expressed in restricted tissues, and there is a unique hierarchy in
their tissue distribution patterns. The most significant result of this
hierarchy is that, as far as we have examined, heart and skeletal
muscle are the only tissues in which the five sHSPs commonly show
constitutive, abundant expression. Using purified recombinant proteins
for each sHSP as standards, we estimated the protein concentrations of
HSP27, MKBP/HSPB2, B-crystallin, and HSPB3 in human skeletal muscle
(biceps bracii, which contains an almost even population of three cell
types, typeI, IIA, and IIB
(40))3 as 3.4, 0.30, 0.57, and 0.09 µg/mg of protein, respectively.
The Expressions of B-crystallin, MKBP/HSPB2, and HSPB3, but Not
HSP27 and p20, Are Induced during the Initial Phase of Skeletal Muscle
Differentiation--
The abundant and specific expressions of the five
sHSPs in skeletal muscle suggest that their expressions may be
controlled by myogenic factors such as MyoD. Therefore, we next
examined the change in the amount of each sHSP mRNA during the
differentiation of mouse C2C12 myoblast cells induced by serum
starvation (Fig. 4a). HSP27
and B-crystallin mRNAs were easily detected in myoblasts (time = 0), whereas only very weak signals could be detected for MKBP/HSPB2 and p20 after very long exposures. HSPB3 mRNA was not detected at all. Under our conditions, the induction of myogenin mRNA, which is the earliest known event accompanying myogenic differentiation (41), is observed within 7 h after serum
deprivation. After that, the mRNA for muscle creatine kinase, a
muscle-specific protein, begins to up-regulate within 15 h.
Morphologically, 36 h after serum starvation, the cells begin to
fuse to form multinucleated myotubes. Northern blot and RT-PCR analysis
of the total RNA from differentiating C2C12 cells at the indicated
times reveal the following features of sHSP expression (Fig. 4,
a and c): 1) the amount of HSP27 mRNA remains
unchanged during differentiation; 2) the mRNA for B-crystallin
is up-regulated in conjunction with the induction of myogenin mRNA;
3) the mRNAs for MKBP/HSPB2 and HSPB3 are induced at a later stage
of differentiation; and 4) the amount of p20 mRNA decreases
somewhat during differentiation.

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 4.
MKBP/HSPB2, HSPB3, and
B-crystallin mRNA expressions are regulated
under the control of a myogenic factor, MyoD, and induced along with
the myogenic differentiation of C2C12 myoblasts. a,
changes in the expression of each sHSP mRNA during the course of
mouse C2C12 myoblast differentiation. Differentiation was induced by
serum withdrawal from the culture medium at time 0. Ten micrograms of
total RNA isolated from C2C12 cells at the indicated times was
subjected to Northern blot analysis using the cDNA fragments
indicated on the left. b, MKBP/HSPB2 and
B-crystallin mRNA levels are regulated by the myogenic factor,
MyoD. C3H10T1/2 mouse fibroblast cells were stably transformed to
myoblasts by the exogenous introduction of MyoD. The transformant
(10TMyoD) and host (10T1/2) cells were cultured either in growth
(G) or differentiation medium for 24 or 48 h. Ten
micrograms of total RNA from each cell was subjected to Northern blot
analysis. In lane C, RNA from differentiated C2C12 cells was
loaded as a positive control. Note that the mRNAs for MKBP/HSPB2
and B-crystallin are specifically induced in 10TMyoD cells by serum
starvation, while a reduction in p20 mRNA is observed in both
cells. The signal for HSPB3 mRNA was too weak to analyze, whereas
HSP27 mRNA was not detected in these cells. c, the
results of RT-PCR analysis showing the induction of MKBP/HSPB2 and
HSPB3 mRNAs during myogenic differentiation. One hundred nanograms
of total RNA extracted from the indicated mouse cells on the indicated
day was processed by reverse transcription (42 °C, 30 min) followed
by PCR using specific sets of primers for each sHSP. PCR cycle numbers
were 30 for MKBP/HSPB2 and HSPB3 and 24 for B-crystallin and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The
products were visualized by ethidium bromide staining. d,
the induction of sHSP proteins during the course of C2C12
differentiation. Ten micrograms (for HSP27, p20, and desmin) or 20 µg
(for MKBP/HSPB2, B-crystallin, HSPB3, and HSC70) of protein from
cell cultures prepared on the indicated day was separated by SDS-PAGE
and immunoblotted with the antibodies indicated on the
left.
|
|
Fig. 4, b and c, establish that the increase in
B-crystallin, MKBP/HSPB2, and HSPB3 mRNA is the result of
myogenic differentiation controlled by the myogenic regulatory factor
MyoD, and not due to stress stimulation caused by serum starvation.
10TflagMyoD cells (10TMyoD), which are stably transformed to myoblastic
cells by the ectopic expression of MyoD, also show the induction of B-crystallin and MKBP/HSPB2 mRNA upon serum depletion, while the
parental Swiss C3H10T1/2 fibroblast cells (10T1/2) do not. Because of
the low amount of the HSPB3 mRNA, its induction is difficult to
detect by Northern blot analysis (Fig. 4b); however, RT-PCR
analysis clearly demonstrates the induction of HSPB3 in parallel with
MKBP/HSPB2 mRNA in 10TMyoD cells (Fig. 4c). It should also be noted that B-crystallin is up-regulated earlier than the
induction of MKBP/HSPB2 and HSPB3 in these cells, too. A reduction in
p20 mRNA was observed even in the parental cells, suggesting that
this reduction may be due to serum depletion (Fig. 4b).
Consistent results were obtained by Western blot analyses of C2C12 cell
extracts during the course of differentiation (Fig. 4d).
Again, HSP27 is the predominant sHSP expressed in myoblasts, although
B-crystallin and p20 are also present in lesser amounts. During the
course of differentiation, B-crystallin starts to up-regulate, while
the amount of p20 gradually decreases. Subsequently, MKBP/HSPB2 and
HSPB3 are induced during the late phases of differentiation.
Selective Mutual Interactions between sHSP: Diverged
Hetero-oligomeric States of sHSPs in Muscle Cells--
A
characteristic feature of sHSPs that has been conserved throughout
evolution is their tendency to form large aggregates in the cytosol
through their homo- and hetero-oligomeric activities (19, 26, 42). Fig.
5 summarizes the results of two-hybrid assays monitoring all combinations of interactions between pairs of the
five sHSPs. First, the panel shows that all sHSPs except HSPB3 show
homophilic interaction, although the activity in the case of p20 is
relatively low. Second, each sHSP shows selective heterogeneous
interactions with other sHSP members: as shown previously, HSP27 and
B-crystallin interact with each other, while MKBP/HSPB2 interacts
with neither HSP27 nor B-crystallin (23). On the other hand, p20
unexpectedly interacts with MKBP/HSPB2 as well as with HSP27 and
B-crystallin, raising the possibility that p20 is involved not only
in the complex formed by HSP27 and B-crystallin, but also that
formed by MKBP/HSPB2. Another intriguing result is that HSPB3, unlike
other sHSPs, does not show a homophilic interaction, but interacts
exclusively with MKBP/HSPB2. Therefore, it is speculated that HSPB3
represents a very intimate partner of MKBP/HSPB2 in
vivo.

View larger version (87K):
[in this window]
[in a new window]
|
Fig. 5.
The five members of the mammalian sHSP family
show highly selective interactions with each other. All possible
interactions between two of the five sHSPs, as well as the interaction
of each sHSP with DMPK, were examined using yeast two-hybrid assays.
Growth on a -ULWH plate (right) lacking uracil, leucine,
tryptophan, and histidine indicates interaction. 3-AT is
3-aminotriazole, which was added to suppress the background growth of
yeast.
|
|
The selective mutual interactions of mammalian sHSPs expressed
simultaneously in muscle cells were further confirmed by gel filtration
analysis of muscle cytosol combined with immunoprecipitation. Fig.
6a shows the elution pattern
of the five sHSPs by gel filtration of the rat heart soluble fraction.
Similar results were also obtained in analyses of rat skeletal muscle
extracts (data not shown). As demonstrated previously, HSP27 together
with p20 forms two broad peaks with apparent molecular masses around
>500 and 50 kDa, while B-crystallin co-elutes only with the former
peak (26). On the other hand, MKBP/HSPB2 elutes independently of these
two oligomeric complexes, forming one broad peak with an apparent molecular mass of 150 kDa (23). We examined the elution profile of
HSPB3 and detected it in the same fractions as MKBP/HSPB2. This is
consistent with the results in Fig. 5, and suggests that MKBP/HSPB2
forms a 150-kDa complex with HSPB3. Subsequent immunoprecipitation analysis against the above fractions using the anti-MKBP/HSPB2 as well
as anti-p20 antibodies finally established the complex formation of
sHSPs in muscle cells (Fig. 6, b and c): as shown in Fig. 6b, HSPB3, but no other sHSP, including p20,
co-precipitates with the anti-MKBP/HSPB2 antibody from fractions
corresponding to the MKBP/HSPB2 peak, confirming the oligomerization of
MKBP/HSPB2 and HSPB3 in the 150-kDa complex. On the other hand, as
shown in Fig. 6c, immunoprecipitation by the anti-p20
antibody further supports the absence of p20 from this complex. These
results indicate that, based on their oligomerization properties, the
five mammalian sHSPs can be categorized into two groups, one comprising
HSP27, B-crystallin, and p20, and the other MKBP/HSPB2 and HSPB3,
and that the two groups form mutually exclusive oligomers in the
soluble fraction of muscle cells.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6.
Gel filtration and immunoprecipitation
analysis of rat muscle extracts. a, the soluble
fraction from rat heart was subjected to gel filtration through
Superose 12 and analyzed by immunoblotting using the indicated
antibodies. The arrows labeled 669, 440, 200, 158, 67, 44, and 29 at the top indicate the apparent molecular masses
(kDa) of gel filtration markers. The bidirectional arrow at
the bottom indicates the fractions subjected to the
following immunoprecipitation analysis shown in b and
c. In lane C, the starting muscle extract was
loaded to indicate the position of each sHSP. Note that HSPB3 coelutes
with MKBP/HSPB2 at a position corresponding to an apparent molecular
mass of 150 kDa. b and c, the fractions from gel
filtration obtained in a were subjected to
immunoprecipitation analysis using anti-MKBP/HSPB2 (b) or
anti-p20 (c) antibodies. The immunocomplexes were analyzed
using the indicated antibodies. d, total extracts from rat
heart were similarly subjected to immunoprecipitation. The starting
extract (lane 1) and the immunocomplex precipitated by 3 µg of anti-MKBP/HSPB2 (lane 2), anti-p20 IgG (lane
3), or control rabbit IgG (lane 4), were analyzed by
immunoblotting using the indicated antibodies.
|
|
Besides the dominant forms of sHSP oligomers described above, Fig. 6
also suggests the presence of heterogeneity among sHSP oligomers.
Especially, because MKBP/HSPB2 was detected faintly in the anti-p20
antibody immunoprecipitate from the 50-kDa fraction (Fig.
6c), a very minor fraction of p20 may associate with
MKBP/HSPB2 rather than HSP27. Although this association could not be
confirmed by reciprocal immunoprecipitation with anti-MKBP/HSPB2
antibody, probably because of the difference in the antibody titers
(Fig. 6b), the results may reflect the interaction between
MKBP/HSPB2 and p20 suggested by the two-hybrid assay (Fig. 5). In fact,
co-precipitation of very minor fractions of p20 and MKBP/HSPB2 was
detected in the anti-MKBP/HSPB2 or anti-p20 antibody precipitates,
respectively, when the total extract was used as a starting material
(Fig. 6d). As shown in Fig. 6d, B-crystallin,
but not HSP27, was detected in the anti-MKBP/HSPB2 antibody
precipitate. Because the two-hybrid assay did not detect an interaction
between B-crystallin and MKBP/HSPB2, this finding suggests the
possible presence of a tertiary complex of B-crystallin, p20, and
MKBP/HSPB2, in which B-crystallin interacts with MKBP/HSPB2
via p20.
HSP27 and B-crystallin, but Not MKBP/HSPB2, Are Localized on
Well Developed Actin Bundles Specific to Myotubes--
The exclusive
properties of the two groups of sHSPs observed in muscle cytosol
suggests the presence of two independent sHSP systems with divergent
functions. Considering that sHSPs are assumed to work as molecular
chaperones (6-8), sHSPs in different systems may have distinct
molecular targets. We previously demonstrated that MKBP/HSPB2 interacts
with DMPK and thus activates and/or stabilizes its activity by way of
its chaperone-like activity (23). Fig. 5 indicates that, among the five
sHSPs, MKBP/HSPB2 is the only one that interacts with DMPK, suggesting
that the effect on DMPK is specific for the system containing
MKBP/HSPB2. On the other hand, recent studies have demonstrated that
one of the specific targets of HSP27 and B-crystallin may be the
actin-based cytoskeleton (12, 14, 16). Therefore, we next examined the cellular localization of three sHSPs, HSP27, B-crystallin, and MKBP/HSPB2, in differentiated C2C12 myotubes in view of their relationship with the actin cytoskeleton (Fig.
7). Even under differentiation
conditions, not all myoblast cells differentiate into myotubes; some
remain mononuclear and can be discriminated morphologically as well as
by their expression of marker proteins such as troponin T (33).
Consistent with the results of Northern and Western blot analyses,
anti-HSP27 antibody stains myoblasts in growth medium (Fig.
7A) as well as multi- and mononuclear cells under
differentiation conditions (Fig. 7B), while
anti- B-crystallin and anti-MKBP/HSPB2 antibody stain only
differentiated multinuclear cells (C and D; data
not shown). Without any pretreatment before fixation, these sHSPs all
appear dispersed in the cytoplasm showing no localization to specific
structures, although the staining of MKBP/HSPB2 appears more
particulate (B, C, and D). However, pretreatment
of cells with 0.5% Triton X-100 before fixation removes most of the
cytoplasmic staining and allows the localization of HSP27 and
B-crystallin to be clearly visualized on filaments running along the
long axis of myotubes (F and G).
Rhodamine-phalloidin staining revealed these to be actin bundles
(J and K). Importantly, the localization of HSP27
on actin filaments is scarcely observed in undifferentiated myoblasts,
although they express HSP27 abundantly and develop many stress fibers
(E and I). This suggests that the actin
localization of HSP27 and B-crystallin is specific to myotubes, which contain well developed actin bundles as a prototype of myofibril structures. On the other hand, no filamentous localization of MKBP/HSPB2 could be detected even in Triton X-100 pretreated C2C12 myotubes (H and L). This provides another example
of the functional divergence of sHSPs involved in different
complexes.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 7.
HSP27 and
B-crystallin, but not MKBP/HSPB2, are localized on
myotube-specific actin bundles. C2C12 myoblasts were cultured in
growth medium (A, E, and I) or differentiated
into myotubes by culturing in differentiation medium for 4 days. The
cells were fixed in 3% formaldehyde with (E-L) or without
(A-D) pre-extraction with 0.5% Triton X-100. The cells were
immunostained for HSP27 (A, B, E, and F),
B-crystallin (C and G), or MKBP/HSPB2
(D and H). For E-H, actin filaments
were also doubly stained with rhodamine-phalloidin (I-L,
respectively). Note that the Triton X-100 extraction of cells cultured
at physiological temperature removes most cytoplasmic signals and
clearly reveals the localization of HSP27 and B-crystallin on actin
bundles in myotubes (compare with F and J, and
G and K).
|
|
In Contrast to HSP27 and B-crystallin, the mRNAs for p20,
MKBP/HSPB2, and HSPB3 Are Not Induced by Heat Shock--
Finally, we
examined the heat-shock response of the expression of each sHSP.
Previously, we demonstrated that the amounts of HSP27 and
B-crystallin mRNAs dramatically increase in differentiated C2C12
myotubes after heat shock, whereas the amount of MKBP/HSPB2 mRNA
does not (23). Fig. 8 expands this
observation to the other sHSPs, p20 and HSPB3, as well as to
undifferentiated myoblasts. At first, it was shown that even in C2C12
myoblasts (Fig. 8a), the heat-induced accumulation of HSP27
and B-crystallin mRNAs occurs to an extent similar to that
observed in myotubes (Fig. 8, b-d). In contrast, the
mRNAs for MKBP/HSPB2, p20, and HSPB3 were show no significant heat
inducibility in either cell type even under more severe conditions
(Fig. 8, a-d).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 8.
Heat shock does not induce the accumulation
of MKBP/HSPB2, p20, and HSPB3 mRNAs. The C2C12 myoblast
(a) or myotube (b-d) cells were heat treated
under various conditions (a and b, 44 °C 15 min; c, 44 °C 1 h; and d, 46 °C 15 min), then recovered at 37 °C for the indicated times. Ten
micrograms of total RNA extracted from each cell was subjected to
Northern blot analysis using the indicated probes. In lanes
1 and 6 of each panel, the total RNAs from untreated
cells harvested in parallel at 1 and 8 h after the heat shock,
respectively, were loaded. Asterisks indicate the signal on
18 S ribosomal RNA detected nonspecifically with a MKBP/HSPB2
probe.
|
|
 |
DISCUSSION |
The recent expansion of the mammalian sHSP family provides a new
avenue to understanding the physiological significance of this poorly
understood HSP family. In the present study, we for the first time
examined several essential features of five mammalian sHSPs so far
identified, all except the lens-specific A-crystallin, on the same
basis using collected cDNAs and specific antibodies for each sHSP.
In the course of this study, we confirmed the expression of the protein
product of the HSPB3 gene previously reported in human heart
as a 17-kDa protein (27, 28). The accumulated data reveal the unique
features of this HSP family.
The Mammalian sHSP Family May Have Diverged to Form Specific
Chaperone Systems for Skeletal Muscle and Heart--
Originally, HSPs
were defined as proteins whose synthesis is induced by heat or other
physiological stresses (43). However, subsequent work has revealed that
most HSPs are also constitutively expressed in various tissues (1).
Tanguay et al. (39) have suggested that HSP90 and HSC70,
which are thought to play housekeeping roles for proper cell growth and
differentiation, are expressed rather ubiquitously, whereas the levels
of HSP70 and HSP27 are specifically high in organs that are subjected
to more immediate environmental aggression. Here, we show that the
tissue distribution of HSP27 is broadest among family members, and that
the other four sHSPs display more limited tissue distributions showing
a unique hierarchy. Considering the suggested cytoprotective roles of
HSP27 and B-crystallin against physiological stress (11-13), the
constitutive expressions of these sHSPs in restricted tissues suggest
that, in addition to other HSPs with higher molecular mass, the cells
in these tissues need to be protected by sHSPs continuously or without
time consuming protein synthesis (38). The observed hierarchy of sHSP
expression further suggests that HSP27 is the most essential, while the
other members provide additional responses to different kinds of stress
or protect different molecular targets specific to certain tissues.
The most important implication of the present study is that all five
sHSPs are abundantly and rather specifically expressed in skeletal
muscle and heart. In other words, the tissues where the five sHSPs are
commonly expressed are confined to these muscles. This is a very
significant feature peculiar to this HSP family. Furthermore, among the
five sHSPs, the muscle specificity of MKBP/HSPB2 and HSPB3 expression
is significantly and qualitatively different from that of the others.
In addition, they are sharply induced along with the myogenic
differentiation controlled by MyoD, suggesting that they represent the
first examples of muscle-specific HSPs. Interestingly, consistent with
these expression properties, the five mammalian sHSPs can be
categorized into two basic groups, one comprising HSP27,
B-crystallin, and p20, and the other MKBP/HSPB2 and HSPB3, based on
their oligomerization properties. Each group forms mutually exclusive
oligomers, suggesting the presence of two independent sHSP systems in
muscle cells. Taken together, the present results indicate that muscle
cells develop highly sophisticated, unique sHSPs in two ways. First,
they express the three ubiquitous forms of sHSP, HSP27,
B-crystallin, and p20, simultaneously in large amounts and let them
form co-oligomers ( B-crystallin/HSP27/p20 and HSP27/p20) unique to
muscle cells. Second, they also express another independent sHSP system
comprising MKBP/HSPB2 and HSPB3, and this system is scarcely observed
in other types of cells (Fig. 9).
Because MKBP/HSPB2 expression is detected in intestine, colon, and
uterus (Fig. 3)4 and Boelens
et al. (28) showed Northern blot data suggesting the
expression of HSPB3 in smooth muscle, this latter system may also
participate in stress response in smooth muscle cells.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 9.
Schematic model for chaperone systems
comprising diverse members of the mammalian sHSP family. In
addition to the system consisting of HSP27, B-crystallin, and p20,
which works rather ubiquitously, muscle cells develop an additional
system consisting of MKBP/HSPB2 and HSPB3 to maintain the sophisticated
cytoskeletal structure, myofibrils (see the text for details). Notice
that the stoichiometry of each sHSP oligomer is illustrated
arbitrarily.
|
|
The close relationship of sHSPs with cytoskeletal components has been
well demonstrated: HSP27 and B-crystallin have been suggested to
interact with actin and intermediate filaments in vitro
(15-17). In addition, it has been suggested that their cytoprotective role in non-muscle cells can be attributed, at least in part, to their
ability to stabilize cytoskeletal structures such as stress fibers (12,
14). On the other hand, HSP27, B-crystallin, and MKBP/HSPB2 have
been shown to be localized on specific sarcomeric structures of the
skeletal or cardiac muscle myofibril, such as Z-bands or I-bands (16,
20-23, 44). Together with these results, the present data strongly
suggest that one of the essential functions of the mammalian sHSP
family is to maintain and/or protect cytoskeletal structures. In
striated muscle cells, which are frequently subjected to severe
conditions of heat and oxidative and mechanical stresses especially
during exercise (2), the sHSP family may develop to maintain
constitutively the extremely developed cytoskeletal structure,
myofibrils, in which many proteins, including filamentous oligomers,
are precisely assembled. In this respect, it is very interesting that,
in contrast with other HSPs such as HSP70 or HSP90, the amino acid
sequences of the mammalian sHSPs are highly diverged from those of
sHSPs found in prokaryotes and yeast (5, 45). No orthologs of the
individual mammalian sHSPs are found even in Caenorhabditis
elegans. Therefore, the gene duplications that resulted in the
sophisticated sHSP systems observed in mammalian muscle cells might not
have progressed rapidly until the early stages of vertebrate evolution
when muscle cells developed to produce stronger and more sustained
contractile forces. Although more sequence information about sHSPs from
other species is needed, it is very interesting to clarify which of the
two independent mammalian sHSP systems developed first.
Recent work showing correlations with specific muscular dystrophies
supports the critical importance of these myoprotective systems
composed by diverged sHSP family members. We identified MKBP/HSPB2 as a
binding protein for DMPK, activating and/or stabilizing the kinase
activity through its specific chaperone-like activity (23). Since this
kinase is considered to be important in the maintenance of myofibril
integrity (25), we proposed that one of the causes of the disease is a
defect in the muscle-specific, stress-responsive system composed of
DMPK and MKBP/HSPB2. More directly, a missense mutation in the
B-crystallin gene was recently identified as the cause of
desmin-related myopathy (46). Since this disease is characterized by a
delayed accumulation of desmin aggregates, an essential component of
Z-bands, this result strongly supports the idea that the chaperone
activity of sHSPs is crucially important for maintaining myofibril
structures. Although the molecular pathogenesis of these diseases
should be clarified further, the results suggest that a defect in sHSP
systems leads to a gradual accumulation of damage, which finally
results in the late onset muscle degeneration observed in myotonic
dystrophy and desmin-related myopathy.
Functional Divergence of the Two sHSP Systems in Muscle
Cells--
Several studies have demonstrated that the expression of
B-crystallin is regulated during skeletal and cardiac muscle
development, and that its chaperone-like functions are also coupled to
the activation of genetic programs responsible for myogenic
differentiation and cardiac morphogenesis (47, 48). Here, using a mouse
myoblast cell line, C2C12, as well as 10TflagMyoD cells, which stably
transform to myoblasts, we demonstrated the up-regulation of
B-crystallin expression during the very early stages of myogenic
differentiation. Furthermore, we found the localization of
B-crystallin as well as HSP27 on well developed actin bundles in
myotubes (Fig. 7). Importantly, this HSP27 localization is not observed
in myoblasts, suggesting the possible involvement of these sHSPs in the
initial organization of myofibril assembly in myotubes. They may
interact with some proteins on actin bundles whose expressions
themselves are induced along with myogenic differentiation.
Interestingly, MKBP/HSPB2, which belongs to the other sHSP system in
muscle cells, does not show a similar localization on actin bundles,
although it localizes on Z-bands similarly to B-crystallin in mature
muscle cells. This suggests that the roles of MKBP/HSPB2 during the
early stages of muscle differentiation may differ from those of HSP27 and B-crystallin. In fact, the expressions of MKBP/HSPB2 and HSPB3
are more tightly regulated by the myogenic program and induced later
than the up-regulation of B-crystallin. The functional divergence
between the two independent sHSP systems may be based on their specific
interactions with distinct molecular targets, one of which is
illustrated in the interaction between DMPK and MKBP/HSPB2.
Finally, we also demonstrate that B-crystallin and HSP27 are the
only sHSPs whose mRNAs are induced by heat shock. This further indicates that the sHSP system comprising MKBP/HSPB2 and HSPB3 may work
dominantly under normal conditions. Although categorized into the group
with B-crystallin and HSP27, p20 mRNA shows no heat
inducibility. Together with its unique response to serum starvation
(Fig. 4), this sHSP may represent a variation of this group.
Complexity of sHSPs Oligomerization--
The present results
obtained by two-hybrid analysis monitoring the interaction between
pairs of sHSPs are essentially consistent with the biochemical data
from gel filtration analysis. This means that the distinct
oligomerization of the five sHSPs observed in vivo arises
from their highly selective interactions with each other (Fig. 6). To
determine which regions are responsible for these selective
interactions will be the focus of future investigations. The present
results suggest that the unique nature of HSPB3 can be attributed to
its sequence, which lacks the N-terminal conserved region and the
C-terminal tail.
It should also be noted that the present analyses do not allow a
precise discussion of the stoichiometry of each oligomer, and that
there may be several variations in the composition of sHSP oligomers.
In addition, our oligomerization data were all obtained with the
soluble fraction of muscle cells. As has been suggested for
B-crystallin, HSP27, and p20 (26), sHSPs show an immediate
redistribution from the cytosol to the insoluble fraction in response
to several kinds of stress. We have observed that MKBP/HSPB2 and HSPB3
show similar responses to heat shock (23).4 Because this
redistribution of sHSPs may be an emergent response of the cells to
protect themselves, identifying the oligomerization state and partners
of each sHSP in the insoluble fraction is extremely important for
understanding sHSP function. Interestingly, this early response is
accompanied by the phosphorylation on the certain residues on HSP27
(for example, Ser-15 and Ser-90 in Chinese hamster HSP27 (49)) and
dissociation of the large complex made by B-crystallin, HSP27, and
p20, suggesting that stressful conditions induce modification of the
interactions between sHSPs. This suggests the intriguing possibility
that the interaction between p20 and MKBP/HSPB2 detected in
vitro (in two-hybrid assay), but not very strongly in the soluble fraction of skeletal muscle and heart, might operate during this dynamic process under stress providing cross-talk between novel sHSP
members. Thus this interaction may exist and contribute to the
regulation of the system in muscle cells. Our results provide a
foundation for further studies to understand the complexity and
dynamics of the sHSP stress-response system.
 |
ACKNOWLEDGEMENT |
We thank K. Kato for providing the anti-p20 antibody.
 |
FOOTNOTES |
*
This work was supported by Grant 8A-1 from the National
Center of Neurology and Psychiatry of the Ministry of Health and
Welfare and Grant 09770103 from the Ministry of Education, Science,
Culture, and Sports, Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence may be addressed. E-mail:
abell@med.yokohama-cu.ac.jp.
**
To whom correspondences may be addressed: Dept. of Molecular
Biology, Yokohama City University School of Medicine, Kanazawa-ku, Yokohama 236, Japan. Tel.: 81-045-787-2596; Fax: 81-045-785-4140; E-mail: ohnos@med.yokohama-cu.ac.jp.
2
Although the mouse and rat homologues of human
HSP27 have been called HSP25, in this paper we standardize the protein
name to HSP27 irrespective of species to avoid confusion.
3
R. Akutsu, Y. Sugiyama and A. Suzuki,
unpublished results.
4
Y. Sugiyama and A. Suzuki, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
HSP, heat shock
protein;
sHSP, small heat shock protein;
RT-PCR, reverse
transcriptase-polymerase chain reaction;
ORF, open reading frame;
kb, kilobase(s);
PBS, phosphate-buffered saline;
DMPK, myotonic dystrophy
protein kinase.
 |
REFERENCES |
| 1.
|
Lindquist, S.,
and Craig, E. A.
(1988)
Annu. Rev. Genet.
22,
631-677[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Brooks, G. A.,
Hittelman, K. J.,
Faulkner, J. A.,
and Beyer, R. E.
(1971)
Am. J. Physiol.
221,
427-431
|
| 3.
|
Locke, M.,
Noble, E. G.,
and Atkinson, B. G.
(1990)
Am. J. Physiol.
258,
C723-729[Abstract/Free Full Text]
|
| 4.
|
Locke, M.,
Noble, E. G.,
and Atkinson, B. G.
(1991)
Am. J. Physiol.
261,
C774-779[Abstract/Free Full Text]
|
| 5.
|
Caspers, G. J.,
Leunissen, J. A.,
and de Jong, W. W.
(1995)
J. Mol. Evol.
40,
238-248[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Horwitz, J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10449-10453[Abstract/Free Full Text]
|
| 7.
|
Rajaraman, K.,
Raman, B.,
and Rao, Ch. M.
(1996)
J. Biol. Chem.
271,
27595-27600[Abstract/Free Full Text]
|
| 8.
|
Ehrnsperger, M.,
Graber, S.,
Gaestel, M.,
and Buchner, J.
(1997)
EMBO J.
16,
221-229[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Klemenz, R.,
Frohli, E.,
Steiger, R. H.,
Schafer, R.,
and Aoyama, A.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3652-3656[Abstract/Free Full Text]
|
| 10.
|
Head, M. W.,
Corbin, E.,
and Goldman, J. E.
(1994)
J. Cell. Physiol.
159,
41-50[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Lavoie, J. N.,
Gingras-Breton, G.,
Tanguay, R. M.,
and Landry, J.
(1993)
J. Biol. Chem.
268,
3420-3429[Abstract/Free Full Text]
|
| 12.
|
Iwaki, T.,
Iwaki, A.,
Tateishi, J.,
and Goldman, J. E.
(1994)
J. Cell Biol.
125,
1385-1393[Abstract/Free Full Text]
|
| 13.
|
Mehlen, P.,
Preville, X.,
Chareyron, P.,
Briolay, J.,
Klemenz, R.,
and Arrigo, A. P.
(1995)
J. Immunol.
154,
363-374[Abstract]
|
| 14.
|
Lavoie, J. N.,
Lambert, H.,
Hickey, E.,
Weber, L. A.,
and Landry, J.
(1995)
Mol. Cell. Biol.
15,
505-516[Abstract]
|
| 15.
|
Miron, T.,
Vancompernolle, K.,
Vandekerckhove, J.,
Wilchek, M.,
and Geiger, B.
(1991)
J. Cell Biol.
114,
255-261[Abstract/Free Full Text]
|
| 16.
|
Bennardini, F.,
Wrzosek, A.,
and Chiesi, M.
(1992)
Circ. Res.
71,
288-294[Abstract/Free Full Text]
|
| 17.
|
Nicholl, I. D.,
and Quinlan, R. A.
(1994)
EMBO J.
13,
945-953[Medline]
[Order article via Infotrieve]
|
| 18.
|
Kato, K.,
Shinohara, H.,
Kurobe, N.,
Inaguma, Y.,
Shimizu, K.,
and Ohshima, K.
(1991)
Biochim. Biophys. Acta
1074,
201-208[Medline]
[Order article via Infotrieve]
|
| 19.
|
Kato, K.,
Shinohara, H.,
Goto, S.,
Inaguma, Y.,
Morishita, R.,
and Asano, T.
(1992)
J. Biol. Chem.
267,
7718-7725[Abstract/Free Full Text]
|
| 20.
|
Longoni, S.,
Lattonen, S.,
Bullock, G.,
and Chiesi, M.
(1990)
Mol. Cell. Biochem.
97,
121-128[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Lutsch, G.,
Vetter, R.,
Offhauss, U.,
Wieske, M.,
Grone, H. J.,
Klemenz, R.,
Schimke, I.,
Stahl, J.,
and Benndorf, R.
(1997)
Circulation
96,
3466-3476[Abstract/Free Full Text]
|
| 22.
|
van de Klundert, F. A.,
Gijsen, M. L.,
van den IJssel, P. R.,
Snoeckx, L. H.,
and de Jong, W. W.
(1998)
Eur. J. Cell Biol.
75,
38-45[Medline]
[Order article via Infotrieve]
|
| 23.
|
Suzuki, A.,
Sugiyama, Y.,
Hayashi, Y.,
Nyu-i, N.,
Yoshida, M.,
Nonaka, I.,
Ishiura, S.,
Arahata, K.,
and Ohno, S.
(1998)
J. Cell Biol.
140,
1113-1124[Abstract/Free Full Text]
|
| 24.
|
Iwaki, A.,
Nagano, T.,
Nakagawa, M.,
Iwaki, T.,
and Fukumaki, Y.
(1997)
Genomics
45,
386-394[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Reddy, S.,
Smith, D. B.,
Rich, M. M.,
Leferovich, J. M.,
Reilly, P.,
Davis, B. M.,
Tran, K.,
Rayburn, H.,
Bronson, R.,
Cros, D.,
Balice-Gordon, R. J.,
and Housman, D.
(1996)
Nat. Genet.
13,
325-335[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Kato, K.,
Goto, S.,
Inaguma, Y.,
Hasegawa, K.,
Morishita, R.,
and Asano, T.
(1994)
J. Biol. Chem.
269,
15302-15309[Abstract/Free Full Text]
|
| 27.
|
Lam, W. Y.,
Wing Tsui, S. K.,
Law, P. T.,
Luk, S. C.,
Fung, K. P.,
Lee, C. Y.,
and Waye, M. M.
(1996)
Biochim. Biophys. Acta
1314,
120-124[Medline]
[Order article via Infotrieve]
|
| 28.
|
Boelens, W. C.,
Van Boekel, M. A. M.,
and De Jong, W. W.
(1998)
Biochim. Biophys. Acta
1388,
513-516[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Izumi, Y.,
Hirai, S.,
Tamai, Y.,
Fujise-Matsuoka, A.,
Nishimura, Y.,
and Ohno, S.
(1997)
J. Biol. Chem.
272,
7381-7389[Abstract/Free Full Text]
|
| 30.
|
Ohno, S.,
Akita, Y.,
Konno, Y.,
Imajoh, S.,
and Suzuki, K.
(1988)
Cell
53,
731-741[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Yoshida, S.,
Fujisawa-Sehara, A.,
Taki, T.,
Arai, K.,
and Nabeshima, Y.
(1996)
J. Cell Biol.
132,
181-193[Abstract/Free Full Text]
|
| 32.
|
Gietz, D.,
St. Jean, A.,
Woods, R. A.,
and Schiestl, R. H.
(1992)
Nucleic Acids Res.
20,
1425[Free Full Text]
|
| 33.
|
Yoshida, N.,
Yoshida, S.,
Koishi, K.,
Masuda, K.,
and Nabeshima, Y.
(1998)
J. Cell Sci.
111,
769-779[Abstract]
|
| 34.
|
Takebe, Y.,
Seiki, M.,
Fujisawa, J.,
Hoy, P.,
Yokota, K.,
Arai, K.,
Yoshida, M.,
and Arai, N.
(1988)
Mol. Cell. Biol.
8,
466-472[Abstract/Free Full Text]
|
| 35.
|
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Suzuki, A.,
Yoshida, M.,
and Ozawa, E.
(1995)
J. Cell Biol.
128,
373-381[Abstract/Free Full Text]
|
| 37.
|
Iwaki, T.,
Kume-Iwaki, A.,
and Goldman, J. E.
(1990)
J. Histochem. Cytochem.
38,
31-39[Abstract]
|
| 38.
|
Klemenz, R.,
Andres, A. C.,
Frohli, E.,
Schafer, R.,
and Aoyama, A.
(1993)
J. Cell Biol.
120,
639-645[Abstract/Free Full Text]
|
| 39.
|
Tanguay, R. M.,
Wu, Y.,
and Khandjian, E. W.
(1993)
Dev. Genet.
14,
112-118[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Brooke, M. H.,
and Engel, W. K.
(1969)
Neurology
19,
221-233[Free Full Text]
|
| 41.
|
Edmondson, D. G.,
and Olson, E. N.
(1989)
Genes Dev.
3,
628-640[Abstract/Free Full Text]
|
| 42.
|
Arrigo, A. P.,
Suhan, J. P.,
and Welch, W. J.
(1988)
Mol. Cell. Biol.
8,
5059-5071[Abstract/Free Full Text]
|
| 43.
|
Ashburner, M.,
and Bonner, J. J.
(1979)
Cell
17,
241-254[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Atomi, Y.,
Yamada, S.,
Strohman, R.,
and Nonomura, Y.
(1991)
J. Biochem. (Tokyo)
110,
812-822[Abstract/Free Full Text]
|
| 45.
|
de Jong, W. W.,
Caspers, G. J.,
and Leunissen, J. A.
(1998)
Int. J. Biol. Macromol.
22,
151-162[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Vicart, P.,
Caron, A.,
Guicheney, P.,
Li, Z.,
Prevost, M. C.,
Faure, A.,
Chateau, D.,
Chapon, F.,
Tome, F.,
Dupret, J. M.,
Paulin, D.,
and Fardeau, M.
(1998)
Nat. Genet.
20,
92-95[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Dubin, R. A.,
Gopal-Srivastava, R.,
Wawrousek, E. F.,
and Piatigorsky, J.
(1991)
Mol. Cell. Biol.
11,
4340-4349[Abstract/Free Full Text]
|
| 48.
|
Gopal-Srivastava, R.,
Haynes, J. N.,
and Piatigorsky, J.
(1995)
Mol. Cell. Biol.
15,
7081-7090[Abstract]
|
| 49.
|
Lambert, H.,
Charette, S. J.,
Bernier, A. F.,
Guimond, A.,
and Landry, J.
(1999)
J. Biol. Chem.
274,
9378-9385[Abstract/Free Full Text]
|
| 50.
|
Thompson, J. D.,
Higgins, D. G.,
and Gibson, T. J.
(1994)
Nucleic Acids Res.
22,
4673-4680[Abstract/Free Full Text]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Shibata, K. Matsumoto, M. Oe, M. Ohnishi-Kameyama, K. Ojima, I. Nakajima, S. Muroya, and K. Chikuni
Differential expression of the skeletal muscle proteome in grazed cattle
J Anim Sci,
August 1, 2009;
87(8):
2700 - 2708.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. J. Xu, M. L. Jin, L. J. Wang, A. D. Zhang, B. Zuo, D. Q. Xu, Z. Q. Ren, M. G. Lei, X. Y. Mo, F. E Li, et al.
Differential proteome analysis of porcine skeletal muscles between Meishan and Large White
J Anim Sci,
August 1, 2009;
87(8):
2519 - 2527.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. A. Whiston, N. Sugi, M. C. Kamradt, C. Sack, S. R. Heimer, M. Engelbert, E. F. Wawrousek, M. S. Gilmore, B. R. Ksander, and M. S. Gregory
{alpha}B-Crystallin Protects Retinal Tissue during Staphylococcus aureus- Induced Endophthalmitis
Infect. Immun.,
April 1, 2008;
76(4):
1781 - 1790.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Pinz, J. Robbins, N. S. Rajasekaran, I. J. Benjamin, and J. S. Ingwall
Unmasking different mechanical and energetic roles for the small heat shock proteins CryAB and HSPB2 using genetically modified mouse hearts
FASEB J,
January 1, 2008;
22(1):
84 - 92.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. MacIntyre, E. K. Tyson, M. Read, R. Smith, G. Yeo, K. Kwek, and E.-C. Chan
Contraction in Human Myometrium Is Associated with Changes in Small Heat Shock Proteins
Endocrinology,
January 1, 2008;
149(1):
245 - 252.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Simon, J.-M. Fontaine, J. L. Martin, X. Sun, A. D. Hoppe, M. J. Welsh, R. Benndorf, and P. Vicart
Myopathy-associated {alpha}B-crystallin Mutants: ABNORMAL PHOSPHORYLATION, INTRACELLULAR LOCATION, AND INTERACTIONS WITH OTHER SMALL HEAT SHOCK PROTEINS
J. Biol. Chem.,
November 23, 2007;
282(47):
34276 - 34287.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-M. Fontaine, X. Sun, A. D. Hoppe, S. Simon, P. Vicart, M. J. Welsh, and R. Benndorf
Abnormal small heat shock protein interactions involving neuropathy-associated HSP22 (HSPB8) mutants
FASEB J,
October 1, 2006;
20(12):
2168 - 2170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Lametsch, L. Kristensen, M. R. Larsen, M. Therkildsen, N. Oksbjerg, and P. Ertbjerg
Changes in the muscle proteome after compensatory growth in pigs
J Anim Sci,
April 1, 2006;
84(4):
918 - 924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Seo, K. Lee, K. Park, K. Bae, and I. Choi
A Proteomic Assessment of Muscle Contractile Alterations during Unloading and Reloading
J. Biochem.,
January 1, 2006;
139(1):
71 - 80.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Kamradt, M. Lu, M. E. Werner, T. Kwan, F. Chen, A. Strohecker, S. Oshita, J. C. Wilkinson, C. Yu, P. G. Oliver, et al.
The Small Heat Shock Protein {alpha}B-crystallin Is a Novel Inhibitor of TRAIL-induced Apoptosis That Suppresses the Activation of Caspase-3
J. Biol. Chem.,
March 25, 2005;
280(12):
11059 - 11066.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. E. Morrison, R. J. Whittaker, R. E. Klepper, E. F. Wawrousek, and C. C. Glembotski
Roles for {alpha}B-crystallin and HSPB2 in protecting the myocardium from ischemia-reperfusion-induced damage in a KO mouse model
Am J Physiol Heart Circ Physiol,
March 1, 2004;
286(3):
H847 - H855.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.E. Van Eyk
Lessons From Old and New Kinases
Circ. Res.,
February 6, 2004;
94(2):
135 - 137.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Sun, J.-M. Fontaine, J. S. Rest, E. A. Shelden, M. J. Welsh, and R. Benndorf
Interaction of Human HSP22 (HSPB8) with Other Small Heat Shock Proteins
J. Biol. Chem.,
January 23, 2004;
279(4):
2394 - 2402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Gober, C. C. Smith, K. Ueda, J. A. Toretsky, and L. Aurelian
Forced Expression of the H11 Heat Shock Protein Can Be Regulated by DNA Methylation and Trigger Apoptosis in Human Cells
J. Biol. Chem.,
September 26, 2003;
278(39):
37600 - 37609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Depre, L. Wang, J. E. Tomlinson, V. Gaussin, M. Abdellatif, J. N. Topper, and S. F. Vatner
Characterization of pDJA1, a cardiac-specific chaperone found by genomic profiling of the post-ischemic swine heart
Cardiovasc Res,
April 1, 2003;
58(1):
126 - 135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. den Engelsman, V. Keijsers, W. W. de Jong, and W. C. Boelens
The Small Heat-shock Protein alpha B-Crystallin Promotes FBX4-dependent Ubiquitination
J. Biol. Chem.,
February 7, 2003;
278(7):
4699 - 4704.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Webster
Serine Phosphorylation and Suppression of Apoptosis by the Small Heat Shock Protein {alpha}B-Crystallin
Circ. Res.,
February 7, 2003;
92(2):
130 - 132.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. C. Kamradt, F. Chen, S. Sam, and V. L. Cryns
The Small Heat Shock Protein alpha B-crystallin Negatively Regulates Apoptosis during Myogenic Differentiation by Inhibiting Caspase-3 Activation
J. Biol. Chem.,
October 4, 2002;
277(41):
38731 - 38736.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Sobott, J. L. P. Benesch, E. Vierling, and C. V. Robinson
Subunit Exchange of Multimeric Protein Complexes. REAL-TIME MONITORING OF SUBUNIT EXCHANGE BETWEEN SMALL HEAT SHOCK PROTEINS BY USING ELECTROSPRAY MASS SPECTROMETRY
J. Biol. Chem.,
October 4, 2002;
277(41):
38921 - 38929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L Feasson, D Stockholm, D Freyssenet, I Richard, S Duguez, J S Beckmann, and C Denis
Molecular adaptations of neuromuscular disease-associated proteins in response to eccentric exercise in human skeletal muscle
J. Physiol.,
August 15, 2002;
543(1):
297 - 306.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. P. Brady, D. L. Garland, D. E. Green, E. R. Tamm, F. J. Giblin, and E. F. Wawrousek
{alpha}B-Crystallin in Lens Development and Muscle Integrity: A Gene Knockout Approach
Invest. Ophthalmol. Vis. Sci.,
November 1, 2001;
42(12):
2924 - 2934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Dupont, J. Khan, B.-H. Qu, P. Metzler, L. Helman, and D. LeRoith
Insulin and IGF-1 Induce Different Patterns of Gene Expression in Mouse Fibroblast NIH-3T3 Cells: Identification by cDNA Microarray Analysis
Endocrinology,
November 1, 2001;
142(11):
4969 - 4975.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Londono-Vallejo, H. DerSarkissian, L. Cazes, and G. Thomas
Differences in telomere length between homologous chromosomes in humans
Nucleic Acids Res.,
August 1, 2001;
29(15):
3164 - 3171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Benndorf, X. Sun, R. R. Gilmont, K. J. Biederman, M. P. Molloy, C. W. Goodmurphy, H. Cheng, P. C. Andrews, and M. J. Welsh
HSP22, a New Member of the Small Heat Shock Protein Superfamily, Interacts with Mimic of Phosphorylated HSP27 (3DHSP27)
J. Biol. Chem.,
July 13, 2001;
276(29):
26753 - 26761.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|