|
|
|
|||||||
|
|||||||||
J Biol Chem, Vol. 275, Issue 2, 1502-1510, January 14, 2000
From the Department of Microbiology, Dartmouth Medical School,
Hanover, New Hampshire 03755
Type 4 prepilins or prepilin-like-proteins are
secreted by a wide range of bacterial species and are required for a
variety of functions including type 4 pilus formation, toxin and other enzyme secretion, gene transfer, and biofilm formation. A distinctive feature of these proteins is the presence of a specialized leader peptide that is cleaved off by a cognate membrane-bound type 4 prepilin
peptidase (TFPP) during the process of secretion. In this report we
show that the TFPPs represent a novel family of bilobed aspartate
proteases that is unlike any other protease. The active site pairs of
aspartic acids of the two TFPPs in Vibrio cholerae are
found at positions 125 and 189 of TcpJ and 147 and 212 of VcpD.
Corresponding aspartate residues are completely conserved throughout
this extensive peptidase family.
Members of the family of leader peptidases known as type 4 prepilin peptidases (TFPP)1
have been identified in a vast number of species of Gram-negative bacteria and an increasing number of Gram-positive bacteria. The TFPP
is responsible for the cleavage and N-methylation (known collectively as processing) of the highly conserved type 4 leader peptide present at the N terminus of the families of secreted proteins
known as type 4 prepilins and type 4 prepilin-like proteins (1).
Whereas the cleavage of the type 4 leader peptide is a necessary step
for secretion of the mature pilin, methylation of the N terminus of the
mature pilin is not required for secretion and has no known function
(2). Type 4 pilins are polymerized as the structural subunits of type 4 pili (Tfp), which are surface organelles required for diverse
activities that contribute to broad attributes such as genetic
transfer, virulence, and environmental persistence of a wide array of
Gram-negative bacterial pathogens. Prototypical examples include
microcolony formation mediated by toxin-coregulated pilus (TCP) of
Vibrio cholerae,2
bacterial surface dispersal mechanisms mediated by bundle forming pilus
of enteropathogenic Escherichia coli (3), colonization and
natural transformation mediated by PilE of Neisseria sp.
(4), and gliding motility mediated by the Tfp of Myxococcus
sp. (5). The related type 4 pilin-like proteins partially comprise the main terminal branch of the general secretory pathway in Gram-negative bacteria, also known as the type 2 secretion pathway (6). The general
secretory pathway is the pathway utilized by the majority of proteins
that are secreted outside of Gram-negative bacteria. Such proteins
include toxins such as cholera toxin of V. cholerae (7) and
exotoxin A of Pseudomonas aeruginosa (8), as well as other
enzymes such as pullulanase of Klebsiella pneumoniae (9) and
hemolysin of Aeromonas hydrophila (10). Type 4 pilin-like proteins are also required for natural transformation of Bacillus subtilus (11) and Streptococcus pneumoniae (12).
The type 4 leader peptide is characterized by several features that are
highly conserved, yet differ from those of standard leader peptides.
The N-terminal leader that is cleaved from the mature protein is highly
charged and immediately precedes a region of approximately 20 residues
that are predominantly hydrophobic and are retained within the mature
protein. The majority of type 4 prepilins or prepilin-like proteins are
designated type 4a, containing leader peptides that are short (~6
residues). Type 4b preproteins contain a longer leader (~25
residues). The peptide bond on the prepilin that is hydrolyzed by the
TFPP lies between the charged and hydrophobic domains, immediately
C-terminal to an invariant glycine. The new N-terminal amino acid that
arises upon processing is a N-methylated phenylalanine for type 4a
proteins and is typically a N-methylated methionine for type
4b proteins. The TFPPs themselves are integral cytoplasmic membrane
proteins with numerous transmembrane domains. The processing reaction
has been postulated to occur on the cytoplasmic side of the membrane because of the membrane orientation of the prepilin, the location of
all the major nonmembrane peptidase domains, and the likelihood that
the cytoplasmically located S-adenosyl methionine would
provide an available source of methyl groups for the methylation step of the reaction (13).
Previous studies on the proteolytic mechanism of the TFPPs have focused
on the largest cytoplasmic region of the protein designated cytoplasmic
domain 1. These studies were performed on PilD, a prototypic TFPP from
P. aeruginosa. Domain 1 of the PilD peptidase contains two
pairs of cysteine residues that are conserved among many members of the
TFPP family. Alteration of the 4 highly conserved cysteine residues by
substitution of alanine or serine residues resulted in up to an
80-100% reduction of peptidase activity in an in vitro
assay. However, the processing defect varied from approximately 0% to
80% for the various mutants in vivo, suggesting that
although pilin cleavage was less efficient, it was not abolished (14).
Chemical inhibitor studies supported the notion that the cysteine
residues contributed to protease activity and PilD was classified as a
cysteine protease, specifically as a member of the C20 family of
cysteine proteases (15). The retention of partial activity by some of
the pilD mutants as well as the subsequent discovery of
TFPP's that lack the consensus cysteine residues have brought this
mechanism of protease activity into question. For example, the XpsO
TFPP of Xanthomonas campestris was characterized and shown
to lack all the domain 1 cysteine residues, yet the xpsO
gene fully complements a pilD deletion for prepilin
processing (16). Some newer members of the rapidly growing family lack the entire domain 1 region. Analysis of a current TFPP alignment also
reveals a complete lack of any conserved histidine residue, a necessary
component of the cysteine protease catalytic mechanism (15). These
observations have led to a revised classification of PilD, and
therefore the complete family of TFPPs, to the U12 category of
proteases with unknown catalytic mechanism (17).
In the study reported here, an approach similar to the comprehensive
mutational strategy employed to identify the signal peptidase I active
site (18) was used to determine the active site residues of TcpJ, the
TFPP responsible for processing the TcpA type 4 prepilin of V. cholerae. A protein sequence alignment of the TFPP family revealed
several highly conserved potential protease active site residues in
addition to the two cysteine pairs that exist in this protease family.
These include serine, aspartic acid, lysine, and glutamic acid
residues, most of which are located in cytoplasmic domains of TFPPs.
Mutations in tcpJ corresponding to these positions, as well
as a deletion of the entire region encoding cytoplasmic domain 1, were
constructed. In vivo activity and in vitro
protease assays indicate that only Asp125 and
Asp189, which are completely conserved throughout the
entire TFPP family, are absolutely required for protease activity in
TcpJ. Chemical protease inhibition studies are consistent with
this finding. The mutational analysis was extended to a second TFPP of
V. cholerae, VcpD, which is required for toxin secretion
(19). Taken together, the results lead to the conclusion that members
of the TFPP family are bilobed aspartic acid proteases and due to their
complete insensitivity to pepstatin should be regarded as a novel
family of non-pepsin-like acid proteases. These findings allow the
rational development of inhibitors with practical therapeutic value.
Bacterial Strains, Plasmids, Media, and
Antibiotics--
E. coli strains used were K38 (20) and
JM109 (21); Amber-Lys, Amber-Leu, Amber-Gln, Amber-Ser, and Amber-Tyr
are chromosomal amber suppressor strains from Promega's
INTERCHANGETM in vivo Amber suppression
mutagenesis system. Strain JM290 is JM109 carrying pTrc99A/EpsI (6)His
(19). Strain MK90 is K38 carrying p3Z-A, which provides tcpA
under the control of a T7 promoter, and pGP1-2, which provides the
heat-inducible T7 RNA polymerase that drives transcription of the
tcpA on p3Z-A (22). Strain CL318 is JM109 carrying pCL9.
V. cholerae strains are derivatives of classical Ogawa O395
Smr. Strain J71K-1 is O395
tcpJ::kanr (22). Strain
JM315 is O395 vcpD1 (19). Strain CL381 is O395 vcpD1,
tcpJ::kanr. Plasmid pCL9, a
derivative of pUC18 (21), was constructed by the cloning of a 980-bp
EcoRI/NsiI fragment containing tcpJ into the
EcoRI and PstI sites in the polylinker of pUC18.
Plasmid pCL10 was constructed by the additional cloning of a
2.0-kilobase pair HindIII fragment that contains
tcpA into the HindIII site of the pCL9
polylinker. Plasmid pCL11 was constructed by the PCR amplification of
tcpJ with primer pair J-ATG NcoI (5'-
AGACCATGGAATACGTTTACTTGATCCTATTTTCGATTG) and J-Histag
(5'-CCCCTGCAGCTCAATGATGATGATGATGATGCATTAAACGGATTG) and the cloning of
the resulting fragment into the NcoI and PstI sites of the pKK233-2 based expression vector, pTrc99A (Amersham Pharmacia Biotech). Primer J-Histag 3' codes for 6 His residues, which
are added to the C terminus of the TcpJ protein. Plasmid p3Z-A was
constructed by the cloning of the 1-kilobase pair DraI tcpA fragment into the SmaI site of the Promega
expression vector, pGEM3Z (22). Plasmid pJM294 is a pACYC184 derivative
containing vcpD (19). Plasmid pRTG7H3 is a
tcpA-expressing plasmid (23). Plasmid pGP1-2 carries the
thermoinducible T7 polymerase gene (24).
E. coli strains were grown in LB at 37 °C. V. Cholerae strains were grown in LB, pH 6.5, at 30 °C to induce
expression of TCP. Antibiotics were added to the media when needed at
the following concentrations: 100 µg/ml ampicillin, 45 µg/ml
kanamycin, 34 µg/ml chloramphenicol.
Preparation of Membranes Containing TcpJ Prepilin Peptidase or
TcpA Prepilin--
The method for membrane preparation was adapted
from a previously described cell fractionation protocol (25). A 100-ml
overnight culture was placed on ice for 20 min, and the cells were then collected by centrifugation at 5000 × g for 10 min.
The cell pellet was resuspended in 1 ml of 200 mM Tris, pH
8.0, to which 1 ml of 50 mM Tris, pH 8.0, 1 M
sucrose, 2 ml of H2O, 20 µl of 0.5 M EDTA,
and 20 µl of lysozyme (10 mg/ml) were added. The cell suspension was
allowed to incubate on ice for an additional 30 min. 100 µl of 1 M MgSO4 was added, and the suspension was
centrifuged at 5000 × g for 10 min. The cell pellet is
resuspended in 5 ml of 50 mM Tris, pH 8.0, sonicated 3 × 15 s at 50% duty, and centrifuged at 5000 × g
for 10 min. The supernatant was then centrifuged at 230,000 × g (60,000 rpm in a TLA 100.3 rotor) for 15 min. The resulting pellet, which contained the total membrane fraction, was
resuspended in 200 µl of 50 mM Tris, pH 8.0.
TcpA Prepilin Quantitation--
Membrane preparations were
prepared from 42 °C grown overnight cultures of E. coli
K38, which does not express TcpA, and MK90, which overexpresses TcpA
prepilin at elevated temperature. 20 µl of a membrane preparation
from K38 and from MK90 were subjected to electrophoresis on a 12.5%
SDS-PAGE gel alongside a standard of 3 µg of trypsin, followed by
staining with Coomassie Blue. The stained gel was dried using the Novex
gel drying system. The dried gel was scanned by a Molecular Dynamics
Personal Densitometer SI, and densitometry analysis was performed using
ImageQuant version 1.2 software. The intensities (measured in pixels)
of the 3-µg trypsin band, the TcpA prepilin band (MK90), the
corresponding location of the TcpA prepilin band in the TcpA-negative
control lane (K38), and an approximately 28-kDa band from both K38 and MK90 were measured while adjusting to a single background value. The
mass of the TcpA prepilin present in the MK90 lane was determined by
first subtracting the intensity of the corresponding area in the K38
TcpA prepilin-lacking lane. This corrected for the staining intensity
of minor protein bands that co-migrate with TcpA prepilin. By comparing
the intensity values of the 28-kDa bands from the TcpA-positive and
TcpA-negative lanes, a further adjustment was made to the TcpA prepilin
value to account for any loading difference between the lanes. The
trypsin band intensity was divided by 3 µg to determine an
intensity/µg value, which was applied to the final TcpA prepilin band
value to determine the mass of TcpA prepilin/µl in the membrane
preparation. The TcpA prepilin membrane preparation was diluted with 50 mM Tris, pH 8.0, buffer to a concentration of 0.2 µg/µl.
In Vitro Cleavage Assay--
The in vitro TcpJ
cleavage assay was designed, based on the assay developed for PilD of
P. aeruginosa (26), except that pre-TcpA was provided in a
membrane preparation rather than as purified protein. TcpJ derivatives
were provided in membrane preparations of the TcpJ-expressing strain
JM109 (pCL9) (wild-type and mutant alleles). The 100-µl processing
reaction was prepared by combining a 50-µl substrate fraction with a
50-µl enzyme fraction (an equivalent of 1 unit of wild-type activity)
and incubated at 37 °C for 1 h. The substrate fraction was
prepared by combining 5 µl of the TcpA prepilin-containing membrane
preparation (1 µg of TcpA prepilin), 10 µl 0.5% (w/v) cardiolipin,
20 µl of 5× assay buffer (125 mM triethanolamine HCl, pH
7.5, 2.5% v/v Triton X-100), and brought up to the total volume with
H2O. The enzyme fraction was prepared by combining a
standardized volume of TcpJ-containing membrane preparation and
H2O to bring the volume to 50 µl. The cleavage reaction
was stopped by the addition of 100 µl of 2× protein sample buffer.
The volume of TcpJ preparation for all TcpJ derivatives was
standardized to be equivalent to the volume containing an amount of
wild-type TcpJ sufficient to cleave 50% of 1 µg of TcpA prepilin in
1 h, which is defined as 1 unit of TcpJ peptidase activity. The
formation of mature TcpA from precursor was monitored by Western
immunoblot analysis.
Chemical Protease Inhibitors--
Chemical inhibitors were
tested for their ability to prevent the cleavage of TcpA from the
prepilin to mature form in the in vitro cleavage assay.
Various concentrations of inhibitors were added to both the enzyme (1 unit of TcpJ) and substrate fraction so that, when combined, the
inhibitor concentration would remain constant. The inhibitor was
incubated in the enzyme fraction at room temperature for 30 min prior
to the combination of the two fractions. The 100-µl reaction was
allowed to proceed for 1 h at 37 °C before 100 µl of 2× SDS
protein sample buffer was added to stop the reaction. The specific
concentrations of each inhibitor are listed in Table I. The
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride
(EDAC)/glycinamide inhibition protocol is a two-step chemical reaction
based on the procedure developed for the selective modification of
carboxyl side groups of aspartic and glutamic acids in proteins (27).
Takahashi et al. (28) first suggested the use of this
procedure as a method to specifically inhibit acid proteases. Membranes
containing the equivalent of 6 units of TcpJ activity are incubated in
80 µl of 25 mM potassium biphthalate, pH 4.0, and 100 mM EDAC for 30 min at room temperature. 20 µl of 1 M glycinamide was added to the mixture, and incubation at
room temperature was continued for an additional 30 min before the
reaction was stopped by the addition of 150 µl of 200 mM
Tris buffer, pH 8.0. The mixture was spot dialyzed against 50 mM Tris buffer, pH 8.0, for 1 h and then centrifuged
at 230,000 × g (60,000 rpm in TLA 100.3 rotor) for 15 min. The resulting membrane pellet, which contains the chemically
modified TcpJ was resuspended in 60 µl of 50 mM Tris, pH
8.0. 20 µl of the membrane suspension, which contains 2 units of
TcpJ, was used in the in vitro cleavage assay to determine
the peptidase activity. Activity of the modified TcpJ was compared with
an equivalent amount of TcpJ, which had been subjected to a mock
modification procedure that did not include EDAC or glycinamide.
Mutagenesis of tcpJ--
The TcpJ S46A, C76A, D189A, and K191A
alterations were constructed in pCL10 by the QuikchangeTM
(Stratagene) method of mutagenesis, which utilizes inverse PCR primed
by divergent overlapping primers containing the desired complementary
nucleotide changes. The S18A, C48A, C51A, S65A, C73A, S81A, E88A,
D125A, D125E, D125N, D125Amb, S172A, D183N, D189E, D189N, D189Amb,
S212A/S213A, and Immunoblot Analyses--
In vivo TcpA processing was
monitored in E. coli and V. cholerae strains
grown to mid-log phase except where indicated. 0.5 ml of cell culture
was centrifuged and resuspended in 100 µl of LB. 100 µl of 2×
SDS-PAGE sample buffer was added to the sample. The total sample was
boiled for 5 min, and 50 µl was subjected to electrophoresis on a
12.5% SDS-PAGE gel. For both in vivo and in
vitro processing, the proteins were electroblotted to
nitrocellulose and probed with anti-TcpA peptide 6 antiserum. The
secondary Ab, an anti-rabbit IgG conjugated to horseradish peroxidase,
was used to detect TcpA by chemiluminescence using ECL reagents
(Amersham Pharmacia Biotech), followed by autoradiography.
For detection of TcpJ, 20 µl of a membrane preparation from a
TcpJ-expressing strain was combined with 20 µl of 2× SDS-PAGE sample
buffer and incubated at 37 °C for 15 min. 20 µl of the sample was
then subjected to electrophoresis on a 12.5% SDS-PAGE gel. Proteins
were transferred to nitrocellulose and probed with anti-TcpJ peptide
J3-1 antiserum or, in the case of TcpJ (6)His and TcpJ
(6)His A Limited Set of Potential Peptidase Active Site Residues Are
Conserved among TFPPs--
In order to characterize the biochemical
mechanism of the cleavage reaction catalyzed by TcpJ and other TFPPs,
we sought to identify the critical active site amino acids. First, a
limited set of candidate active site residues were identified for
targeted changes. Since only the amino acids cysteine, serine, aspartic acid, histidine, lysine, or glutamic acid have been identified as
critical active site residues in proteases, an alignment of 27 TFPPs
was used to quantitate the conservation of these residues (Fig.
1). Since the active site is thought to
be located on the cytoplasmic face of the cellular membrane, the
analysis was further refined to focus on those residues located within
the three major theoretical cytoplasmic domains of TcpJ. Twelve
conserved positions were identified, including eight in cytoplasmic
domain 1, one in domain 2, and three in domain 3 as indicated by
asterisks (Fig. 2A). Of these
residues, only Asp125 and Asp189 are present in
every single TFPP examined. The positions of all potentially catalytic
residues with respect to the membrane topology model of TcpJ are
indicated in Fig. 2B. 16 residues including the 7 serines, 4 cysteines, 3 aspartic acids, 1 lysine, and 1 glutamic acid indicated as
shaded residues in Fig. 1 and 2B were selected
for mutagenesis. 13 of the 16 potential active site residues targeted
for mutagenesis are all of the residues conserved at greater than the
arbitrary level of 50% in TcpJ. The three selected residues that did
not meet this criterion are Ser172, Asp183, and
Ser212. Ser172 of TcpJ may be functionally
equivalent to residues Ser168 and Ser171
indicated as (S168) and (S171) in Fig. 1, which,
in combination, are approximately 65% conserved. Asp183
and Glu183 (Fig. 1, (E183)) in combination are
conserved in nearly 80% of the 27 TFPPs. Aspartic acid and glutamic
acid can function equivalently as the active site of an acid protease
(29). Mutagenesis of Ser212 was required due to the
construction of the S212A/S213A double mutant, which was necessary so
the analysis of the phenotype of the S213A would not be ambiguous due
to the remaining serine in the adjacent position.
Asp125 and Asp189 Are the Sole Residues
Required for Peptidase Activity--
Alteration of the targeted
residues was performed by site-directed mutagenesis of the 16 selected
positions in tcpJ present on plasmid pCL10, which also
carries tcpA encoding the TcpA type 4 prepilin that is the
cognate substrate of TcpJ. Mutant and wild-type constructs were
introduced into E. coli JM109, and total cell protein
extracts from midlog cultures were analyzed for TcpJ protease activity
by Western immunoblot detection of precursor and mature forms of TcpA
(Fig. 3A). TcpJ proteins with
alterations S18A, S46A, C51A, S65A, C73A, C76A, S81L, E88A, S172A,
D183N, and K191A exhibited peptidase activity identical to wild-type
TcpJ, whereas C48A displayed an intermediate level of peptidase
activity. The four mutants D125A, D125N, D189A, and D189N completely
lacked all peptidase activity, as would be expected when an active site residue of a protease is converted to a nonfunctional substitute. The
D125E and D189E mutants retain the carboxylic acid moiety at the
R-group terminus and both retain partial peptidase activity. Processing
by S212A/S213A double mutant is not shown because it was later
determined that the mutant TcpJ is unstable.
In order to test the peptidase activity expressed by the
tcpJ mutant constructs in V. cholerae, they were
introduced into V. cholerae strain CL381, an O395 derivative
with an insertional disruption in tcpJ and an in-frame
deletion of vcpD, which render it completely devoid of TcpA
processing activity. The resultant strains were grown under
TCP-inducing conditions (LB, pH 6.5, 30 °C) and total cell protein
extracts were examined by Western immunoblot analysis of TcpA (Fig.
3B). The CL381 double mutant was utilized for this analysis,
because disruption of tcpJ alone does not lead to a complete
loss of TcpA processing, as evidenced by the detection of some
processed TcpA in the J71K-1 extract. The CL381 extract shows that the
residual processing is due to VcpD, a second TFPP present in V. cholerae. Similar to the results seen in JM109, tcpJ
mutants S18A, S46A, C51A, S65A, C73A, C76A, S81L, E88A, S172A, D183N,
and K191A exhibited peptidase activity identical to wild-type TcpJ
while C48A possessed an intermediate peptidase activity. D125A, D125N,
D189A, and D189N all completely lacked peptidase activity, whereas the
D125E and D189E mutants restored peptidase activity, providing further
support for the assignment of Asp125 and Asp189
as the active site residues.
To further extend the number of different amino acid substitutions
analyzed at the 125 and 189 positions of TcpJ, amber (TAG) codons were
individually engineered at each corresponding position on the pCL10
plasmid and the resultant constructs were introduced into Amber-Lys,
Amber-Leu, Amber-Gln, Amber-Ser, and Amber-Tyr suppressor strains of
E. coli. The strains were grown to mid-log phase, and whole
cell protein extracts were examined for cleavage of TcpA by Western
immunoblot analysis (Fig. 3C). No amino acid substitution at
either position 125 or 189 exhibited any peptidase activity. The
protein levels and membrane localization of the altered TcpJ proteins
were all comparable to wild-type TcpJ.
TcpJ peptidase activity was also be measured by an in vitro
assay modeled after the in vitro peptidase assay devised for
PilD of P. aeruginosa (26). TcpA-containing membranes from
MK90 and TcpJ-containing membranes from CL318 were combined in the
in vitro assay. A series of assays with an increasing volume
of TcpJ-containing membranes was used to determine the volume of
membrane preparation corresponding to 1 unit of TcpJ activity, which is
the amount required to cleave 50% of 1 µg of TcpA prepilin into the
mature form in 1 h (Fig.
4A).
The peptidase activity of proteins encoded by a subset of the
tcpJ mutants was determined in the in vitro
cleavage assay. TcpJ proteins with alterations S46A, C51A, S65A, C73A,
and C76A were all capable of cleaving TcpA prepilin in the in
vitro assay. C48A, the double mutant S212A/S213A, and the Ala,
Glu, and Asn changes at positions 125 and 189 abolished all peptidase
activity (Fig. 4B). These results are consistent with the
in vivo analysis except for the C48A, D125E, and D189E
proteins, which exhibited intermediate peptidase activity in
vivo had no peptidase activity in vitro. This is not
surprising since studies on PilD of P. aeruginosa have shown
that the in vitro assay is a more stringent test of peptidase activity than the in vivo conditions (14). The
double mutant S212A/S213A has no peptidase activity due to the fact
that the enzyme is unstable as shown by the lack of any TcpJ present in
TcpJ immunoblot. All other TcpJ derivatives were detected at levels
approximately equal to wild-type except for C48A and C51A, which gave
faint or undetectable TcpJ signals. This is likely due to the anti-TcpJ
antiserum, which is directed against a peptide that encompasses
Cys48 and Cys51. It is likely that C48A and
C51A mutants alter the epitope in TcpJ sufficiently so that the protein
is not detected by the antiserum.
Cytoplasmic Domain 1 Is Not Required for TcpJ Peptidase
Activity--
In order to definitively determine whether the cysteine
residues or any portion of cytoplasmic domain 1 is required for TFPP cleavage activity, an internal in-frame deletion corresponding to
positions 35-81 of TcpJ was constructed. Since our TcpJ antibody is
directed against a peptide within the region removed by the deletion,
the construction was made in the 6-His epitope-tagged version of
tcpJ contained on plasmid pCL11, yielding plasmid
pCL11 VcpD Requires a Pair of Aspartic Acid Residues Corresponding to
Those Necessary for TcpJ Activity--
In order to determine the
extent to which the TcpJ requirement for the aspartic acid residue pair
can be generalized to other members of the TFPP family, the
corresponding changes of D147A and D212A were made in VcpD. The VcpD
TFPP is responsible for processing type 4 prepilins such as those
involved in mannose-sensitive pilus formation and processes the
extracellular protein secretion type 4 prepilin-like proteins required
for the secretion of toxin and other enzymes by V. cholerae. VcpD can
also cleave TcpA prepilin, although the cognate TFPP for TcpA is TcpJ
(19). Wild-type, D147A, and D212A forms of VcpD expressed from plasmid
pJM294 derivatives were introduced into E. coli JM109
carrying the tcpA-expressing plasmid pRTH3G7. Strains were
grown to midlog phase, whole cell protein extracts were made prepared,
and the extracts were examined by SDS-PAGE and Western immunoblot
analysis with anti-TcpA antiserum (Fig.
6A). Wild-type VcpD cleaved
TcpA prepilin completely under these conditions, whereas the D147A and
D212A mutant derivatives were totally defective. Protein levels of VcpD
in the four strains were determined by Western immunoblot analysis
using the anti-TcpJ antiserum, which cross-reacts with VcpD. The D147A
and D212A forms of VcpD are present at levels similar to those in
wild-type VcpD. An analogous result was seen with the cleavage of the
type 4 prepilin-like protein substrate of VcpD, EpsI (Fig.
6B). These experiments demonstrate that alanine
substitutions at Asp147 and Asp212, the
aspartic acid residues in VcpD that correspond to protease active site
Asp125 and Asp189 of TcpJ, completely eliminate
peptidase activity for multiple substrates.
Protease Inhibitor Studies of TcpJ Activity Support the Essential
Role of the Aspartic Acid Residues for Protease
Activity--
Utilizing the TcpJ in vitro cleavage assay, a
number of chemical protease inhibitors were examined for their ability
to block the peptidase activity of TcpJ (Table
I). Two or more inhibitors specific to
each class of protease family were tested for their ability to prevent
TcpJ peptidase activity. The majority of the inhibitors had little or
no effect on the peptidase activity, as measured by the comparison of
cleaved TcpA produced in the in vitro assay in the presence
or absence of inhibitor. All inhibitors were tested at the maximum
suggested concentration except for the EDAC/glycinamide inhibition
protocol, for which it was not required. Of all the common protease
inhibitors used, only NEM inhibited cleavage greater than 50%. This
agrees with the strong inhibitory effect of NEM on PilD of P. aeruginosa (14). In contrast, a combination of EDAC and
glycinamide, which is known to modify aspartic acid residues and is the
only method known to inhibit the non-pepsin-type acid proteinases such
as proteinase A from Aspergillus (28), completely inhibited
TcpJ peptidase activity. A 20-100-fold excess of the maximum suggested
concentration of pepstatin only exhibited a minor inhibitory effect on
peptidase activity, thus ruling out a pepsin-like active site in
TcpJ.
The action of a family of leader peptidases known as the TFPPs is
required for extracellular protein secretion, genetic exchange, and
organelle formation in a wide array of bacterial systems. Their
involvement in the processing of prepilins to mature forms is a
prerequisite to type 4 pilin secretion and assembly of the pilus
structure. Other secreted proteins that have type 4 leader peptides,
but are not pilin subunits, are referred to as type 4 prepilin-like
proteins. Such proteins are components of general secretory pathways
involved in protein secretion and pilus biogenesis, the natural
transformation pathways, and conjugal plasmid DNA transfer pathways.
Despite the probable ubiquitous presence of TFPPs among bacterial
species, identification of the protease active site has been elusive.
This may have been due in part to the insensitivity of TFPPs to
commercially available protease inhibitors. In addition, none of the
consensus protease active site motifs present in the vast majority of
other protease families are obvious in this peptidase family. For
example, the typical catalytic residues of serine proteases are the
three amino acids serine, aspartic acid, and histidine, but several
families of serine proteases such as the signal peptidase I family
utilize only serine and lysine as the catalytic residues (30). The most
conserved histidine residue in the TFPP family, His30, is
only present in 30% of the members (Fig. 1, (H30)), thus ruling out involvement of the S/D/H motif in the catalytic mechanism. The numerous highly conserved serines as well as Lys191,
conserved in nearly 80% of the TFPP family members, raised the possibility that the proteolytic activity might involve a Ser/Lys catalytic mechanism. A further possibility was that the TFPP could be a
cysteine protease. This potential mechanism was suggested by the
pilD mutational analysis of the 4 highly conserved cysteines in the peptidase family. Mutations at the 4 cysteines failed to completely eliminate peptidase activity in vivo, but in an
in vitro assay these altered proteins were nearly completely
deficient of peptidase activity (14). However, since all cysteine
proteases require both a cysteine and a histidine as the catalytic dyad (15), the lack of a highly conserved histidine in the TFPP family excludes any known cysteine catalytic mechanism. The possibility of an
aspartic acid protease mechanism is strongly suggested for the TFPP
family due to the presence of two completely conserved aspartic acid
residues corresponding to TcpJ positions 125 and 189 in domains 2 and
3, respectively (Fig. 2B). However, Asp125 and
Asp189 do not exist in the motif D(T/S)G, which is common
to the majority of aspartic acid proteases (31). In addition, the pH
optimum, which has been determined to be near neutral for TcpJ (data
not shown) and PilD of P. aeruginosa (26), is in contrast to
the highly acidic pH optimum of the majority of aspartic acid proteases (32). The final protease family comprises the metalloproteases, for
which over half contain the active site motif, HEXXH (32). The TFPP family lacks any homology to the HEXXH
metalloprotease motif. In light of this sequence alignment analysis, an
aspartic acid protease mechanism was deemed to be the most probable
correct assignment for TFPPs. However, all potential protease active
site residues conserved at greater than 50% were targeted for
mutagenesis in order to determine the active site with certainty.
The results from the mutational analysis of TcpJ at the 16 selected
positions clearly demonstrate that only the two aspartic acids
corresponding to positions 125 and 189 of TcpJ are essential for
protease activity. Substitution of the amino acids alanine, asparagine,
leucine, serine, tyrosine, glutamine, and lysine into positions 125 and
189 of TcpJ produced a stable and properly localized enzyme that lacked
any protease activity. The cause for this loss of protease activity of
the mutants at positions 125 and 189 was determined to be the loss of
the carboxylic acid group of the aspartic acid. The carboxylic acid
functional groups of the active site aspartic acids directly
participate in the general acid-base catalysis that causes the
hydrolysis (cleavage) of the peptide bond (32). When the carboxylic
acid functional group was restored at positions 125 or 189 by the
substitution of glutamic acid, the protease activity was also restored.
The additional one carbon in length of the glutamic acid R-group was
less tolerated at position 189 than 125, suggesting that the location
in space of the R-group carboxylic acid at position 189 is critical to
protease activity. It can be inferred from the constraint at position
189 that the carboxylic acid group of Asp189 directly
participates in the initial chemical reduction of the prepilin peptide
bond while Asp125 contributes to the hydrolysis through
interaction with a water molecule. Demonstration that the complete loss
of protease activity for all amino acid substitutions at positions 125 and 189 was not simply due to a conformational change was also
addressed by the asparagine and serine substitutions at these
positions. Asparagine and serine have small polar R-groups similar to
the R-group of aspartic acid and thus would likely maintain the
wild-type conformation of the enzyme.
Only one of the altered forms of TcpJ, the double mutant S212A/S213A
form, was unstable and could not be assessed for protease activity. The
replacement of both hydrophilic serine residues with hydrophobic
alanine residues occurs at a loop region between transmembrane domains
and likely prevented the proper integration of the mutant peptidase
into the membrane, resulting in its degradation. In lieu of a cleavage
activity result of the S212A/S213A mutant, other evidence indicates a
protease active site serine does not exist at position 212 or 213. Ser212 and Ser213 are both located on the
periplasmic side on the inner membrane and could not participate in a
protease reaction occurring on the cytoplasmic side on the membrane.
Additionally, the only possible catalytic partners are
Lys191, which is not required for protease activity or
Lys180, which if considered functionally equivalent to
Lys182 (Fig. 1, (K182)) would only be found in
approximately 60% of peptidases.
Conclusive evidence that no amino acid residue between position 35 and
81 is required individually, or in combination, for peptidase activity
or for TCP biogenesis was provided by the internal deletion in TcpJ
that removed the majority of cytoplasmic domain 1. This eliminates the
possibility that two or more of the four conserved cysteines act
collectively in some manner as a protease active site cysteine. The
deletion also demonstrates that domain 1 is not in any way required for
substrate recognition, binding, orientation, or any function that leads
to the assembly of the pilin into a pilus structure.
Evidence for conservation of the protease active site among multiple
members of the TFPP family was provided by mutations that altered
either of the two aspartic acids of VcpD corresponding to the active
site residues in TcpJ. These alterations abolished VcpD activity, thus
strongly suggesting that all TFPPs share the aspartic acid active site.
The result with VcpD was of further importance because its cognate
targets are within the type 4a subgroup of type 4 prepilins or
prepilin-like proteins, which have a short signal peptide of typically
5-8 amino acids. In contrast, the cognate substrate of TcpJ is TcpA,
which is a type 4b prepilin with a 25-amino acid leader peptide.
The chemical protease inhibitor studies served to confirm the
mutational analysis that determined that TcpJ is not a cysteine protease, serine protease, metalloprotease, or a typical aspartic acid
protease. The protocol using EDAC and glycinamide strongly implicates
the dependence on aspartic acids for activity of the enzyme. Inhibition
by the EDAC/glycinamide protocol also suggests that the active site
aspartic acids are accessible to chemical inhibitors and not shielded
by the protein conformation of the cytoplasmic domains. The only
protease inhibitor other than EDAC/glycinamide that inhibited at
greater than 50% was NEM, which acts by modifying thiol groups of the
cysteine R-groups of cysteine proteases. The partial inhibition of TcpJ
could occur due to the modification of Cys48, which when
altered by mutation to an alanine, caused a comparable loss of protease
activity. This would suggest that, when Cys48 is not in its
natural form, it can lead to a conformational change in the enzyme that
partially prevents the functioning of the protease active site.
The TFPPs differ from the majority of aspartic acid proteases in that
the active site aspartic acids are not found in the D(T/S)G motif, the
optimum pH for in vitro activity is near neutral as opposed
to pH 2-4, and peptidase activity is not inhibited by pepstatin. Other
aspartic acid proteases exist that possess these unusual traits
individually. Signal peptidase II, an aspartic acid protease that
cleaves prolipoproteins, does not possess the D(T/S)G motif at the
active site (33). The human aspartic acid protease renin has a pH
optimum range of 5.5-7.5 (34). Pseudomonas sp. 101 carboxyl
proteinase is a bacterial aspartic acid protease that is insensitive to
pepstatin (35). Aspartic acid proteases, which are insensitive to
pepstatin, are often referred to as non-pepsin-like acid proteases
(28). The majority of aspartic acid proteases like pepsin and human
immunodeficiency virus type 1 protease are bilobed molecules in which
the active site cleft is located between the lobes with an active site
aspartic acid contributed from each lobe. In this respect, the TFPPs
display a remarkable similarity. The active site can be envisioned as a
cleft between two lobes corresponding to domains 2 and 3 with one
active site aspartic acid residue in each lobe.
The comprehensive mutational analysis and chemical inhibitor studies
that led to the discovery of the active site of TcpJ are ultimately
most significant in that they allow for the prediction of the protease
active site of the entire TFPP family. The identity of the active site,
as well as the ability to specifically target the active site aspartic
acids by a chemical protocol, provide the foundation for the
development of specific protease inhibitors of all members of the TFPP
family. Such inhibitors would have substantial antimicrobial effects on
a wide range of pathogenic bacteria.
We thank J. Marsh for strains and plasmids,
Ripple Electron Microscope Facility at Dartmouth College for electron
microscopy, Dartmouth College Molecular Biology Core Facility for
oligonucleotide synthesis and DNA sequencing, and D. Pippen for helpful discussions.
*
This work was supported in part by Grant ROI AI 23096 from
the National Institutes of Health.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Microbiology,
Dartmouth Medical School, Hanover, NH 03755. Tel.: 603-650-1632; Fax:
603-650-1318; E-mail: ronald.k.taylor@dartmouth.edu.
2
Kirn, T. J., Lafferty, M. L., Sandoe, C. M. P.,
and Taylor, R. K. (2000), Mol. Microbiol., in press.
The abbreviations used are:
TFPP, type 4 prepilin peptidase;
Tfp, type 4 pili;
TCP, toxin-coregulated pilus;
NEM, N-ethylmaleimide;
PCR, polymerase chain reaction;
Ab, antibody;
PAGE, polyacrylamide gel electrophoresis;
EDAC, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride.
The Type 4 Prepilin Peptidases Comprise a Novel Family of
Aspartic Acid Proteases*
and
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
35-81 were constructed in pCL10, and D147A and
D212A were constructed in pJM294 using other methods of inverse PCR
primed by nonoverlapping divergent primers. Both primers contained an
engineered common restriction site that allowed for the restriction of
the PCR product by the appropriate enzyme followed by the ligation at
the complementary DNA overhangs. In these cases, only one primer
carried the desired mutation that was incorporated into the amplified
DNA. In some cases the engineering of restriction sites into the
primers was accompanied by the incorporation of silent mutations. In
other primers, seamless cloning and mutagenesis was performed by
incorporating the restriction enzyme site EarI or
SapI at the 5' end of each primer in the pair. These enzymes
cleave just outside their recognition site, which makes possible a
primer design that ensures that the recognition site is cleaved off the
end of the PCR product, while complementary gene sequence overhangs
remain to promote annealing prior to ligation.
35-81, with TetraHis Ab (Qiagen). Detection with secondary
antibody was carried out as described for TcpA.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (48K):
[in a new window]
Fig. 1.
Percentage of conserved homology of potential
protease active site residues from 27 TFPP homologs. All potential
protease active site residues (Cys, Ser, Asp, Lys, His, Glu) in TcpJ
were analyzed for their percentage of homology in a protein sequence
alignment of the TFPP family. Potential protease active site residues
that are the major conserved amino acids at a position in the peptidase
family alignment but are not conserved in TcpJ are enclosed in
parentheses and are designated with respect to the relative
position in the TcpJ protein sequence. When a residue in TcpJ and a
conserved residue not found in TcpJ exist at the same relative
position, then both are indicated by a sectored
bar with the TcpJ portion represented by the
lower portion of the bar. The
remaining portion of the bar
represents the conserved residue not in TcpJ. Predicted membrane
topology is indicated by C (cytoplasmic), P
(periplasmic), or M (transmembrane) below each residue.
Gray bars indicate the conserved residues that
have been altered during this study. Alignment was done in DNASTAR
MegAlign, using the Clustal method of alignment.
View larger version (78K):
[in a new window]
Fig. 2.
Primary sequence alignment of the three major
cytoplasmic domains of the TFPP family and topology relative to
TcpJ. A, partial protein sequence alignment of 27 TFPP
homologs. The first region shown corresponds approximately to the large
cytoplasmic domain 1. The following two regions correspond precisely to
the predicted residues, which constitute cytoplasmic domains 2 and 3. Asterisks designate positions in these regions for which
mutations were constructed for this study. The alignment was done in
DNASTAR MegAlign, using the Clustal method for alignment. B,
membrane topology model of TcpJ. The predicted topology of TcpJ was
deduced by comparing the hydrophobicity profile of TcpJ with the
-lactamase fusion data of Erwinia carotovora OutO (36)
and the alkaline phosphatase fusion data of P. aeruginosa
PilD (37). Cytoplasmic domains 1, 2, and 3 are indicated. All potential
protease active site residues (Cys, Ser, Asp, Lys, His, Glu) have been
designated. Gray shaded residues indicate each
position that has been altered during this study. Active site residues
are additionally indicated with a star.
View larger version (43K):
[in a new window]
Fig. 3.
Peptidase activity exhibited by
tcpJ wild-type and mutant strains. A,
Western immunoblot analysis to detect cleavage levels of TcpA in
E. coli JM109 strains containing pCL10- and pCL11-based
mutations in tcpJ. The TcpJ-negative control lane is an
extract from JM109 carrying only the tcpA-encoding plasmid
pRTG7H3. All mutations are present on pCL10 except WT6His and
35-81, which are on pCL11. PP denotes prepilin TcpA
(uncleaved), and MP denotes mature pilin (cleaved).
B, Western immunoblot analysis to detect cleavage levels of
TcpA in V. cholerae O395. J71K-1 is an O395
tcpJ::kanr mutant, which
retains some residual TcpA cleavage activity due to a second TFPP,
VcpD. CL381 is a
tcpJ::kanr,
vcpD double mutant that lacks both TFPP activities
present in V. cholerae. All remaining strains are CL381
containing pCL10- and pCL11-based mutations as in A. C,
Western immunoblot analysis to detect TcpJ D125am and D189am cleavage
activity in E. coli amber-suppressor strains and a
non-suppressor control strain, JM109. The level of TcpJ detected by
Western immunoblot analysis of TcpJ in membrane fractions is shown
below the cleavage reaction for each strain. The TcpJ-negative control
is an extract from JM109 (pRTG7H3). The wild-type extract is from JM109
(pCL10). The tcpJ amber (TAG) mutations are present on
pCL10.
View larger version (31K):
[in a new window]
Fig. 4.
In vitro assay for peptidase
activity of wild-type and altered TcpJ proteins. A, the
in vitro cleavage assay with increasing amounts of TcpJ
containing membrane fraction. 1 unit cleaves 50% of 1 µg of TcpA
prepilin (PP) to the mature pilin form (MP) in
1 h at 37 °C. B, the activity of 15 mutants of TcpJ
in the in vitro peptidase assay. The TcpJ(6)His and
TcpJ 35-81 derivatives are in pCL11 constructions. All other
mutations are in pCL9. A Western immunoblot analysis showing levels of
TcpJ in the membrane fractions is shown below each reaction lane.
TcpJ(6)His and TcpJ35-81 TcpJ levels were detected by Tetra-His
Ab.
35-81. TcpJ (6)His and the deletion derivative expressed from
pCL11 and pCL1135-81 were both able to cleave TcpA to equivalent
extents in E. coli (Fig. 3A), V. cholerae (Fig. 3B), or in vitro (Fig. 4B). Interestingly, TcpJ (6)His35-81 was found to
process TcpA efficiently enough to restore piliation to the
tcpJ mutant strain, J71K-1 (Fig.
5).
View larger version (67K):
[in a new window]
Fig. 5.
The complementation of V. cholerae
O395 tcpJ mutant by TcpJ(6)His 35-81 for TcpA
cleavage and TCP biogenesis. A, Transmission electron
microscopy of V. cholerae strains to detect for their
ability to secrete and assemble TCP. Strains: 1, O395; 2, J71K-1; 3, J71K-1 pCL1135-81; 4, J71K-1 pCL11. Arrows indicate lateral bundles
of TCP. Magnification is 50,000-fold. B, Western immunoblot
analysis to detect levels of precursor (PP) and mature (MP) forms of
TcpA produced by the same V. cholerae strains as in
A.
View larger version (34K):
[in a new window]
Fig. 6.
Mutations that alter the predicted protease
active site aspartic acid residues in VcpD eliminate peptidase
activity. A, Western immunoblot analysis using
anti-TcpA antisera to detect cleavage levels of TcpA in JM109 by VcpD
mutants. All strains are JM109 and carry the tcpA-expressing
plasmid, pRTG7H3. The VcpD negative strain contains no other plasmid.
The wild-type and mutant alleles of vcpD are expressed from
pJM294 derivatives. A Western immunoblot analysis showing levels of
VcpD for each strain is also shown. B, Western immunoblot
analysis using Tetra-His Ab to detect cleavage levels of EpsI(6)His in
JM109 by VcpD derivatives. All strains are JM109 and carry the
EpsI(6)His-expressing plasmid, pJM290 and vcpD derivatives
as in A.
The effect of chemical inhibitors on the in vitro TcpJ cleavage assay
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
ACKNOWLEDGEMENTS
FOOTNOTES
Recipient of Predoctoral Fellowship AI F31-09635 from the National
Institutes of Health.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Strom, M. S.,
Nunn, D. N.,
and Lory, S.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
2404-2408 2.
Pepe, J. C.,
and Lory, S.
(1998)
J. Biol. Chem.
273,
19120-19129 3.
Bieber, D.,
Ramer, S. W.,
Wu, C. Y.,
Murray, W. J.,
Tobe, T.,
Fernandez, R.,
and Schoolnik, G. K.
(1998)
Science
280,
2114-2118 4.
Tonjum, T.,
and Koomey, M.
(1997)
Gene (Amst.)
192,
155-163[CrossRef][Medline]
[Order article via Infotrieve]
5.
Wu, S. S.,
and Kaiser, D.
(1995)
Mol. Microbiol.
18,
547-558[CrossRef][Medline]
[Order article via Infotrieve]
6.
Pugsley, A. P.
(1993)
Microbiol. Rev.
57,
50-108 7.
Sandkvist, M.,
Michel, L. O.,
Hough, L. P.,
Morales, V. M.,
Bagdasarian, M.,
Koomey, M.,
DiRita, V. J.,
and Bagdasarian, M.
(1997)
J. Bacteriol.
179,
6994-7003 8.
Strom, M. S.,
Nunn, D.,
and Lory, S.
(1991)
J. Bacteriol.
173,
1175-1180 9.
Pugsley, A. P.,
and Reyss, I.
(1990)
Mol. Microbiol.
4,
365-379[CrossRef][Medline]
[Order article via Infotrieve]
10.
Pepe, C. M.,
Eklund, M. W.,
and Strom, M. S.
(1996)
Mol. Microbiol.
19,
857-869[CrossRef][Medline]
[Order article via Infotrieve]
11.
Dubnau, D.
(1997)
Gene (Amst.)
192,
191-198[CrossRef][Medline]
[Order article via Infotrieve]
12.
Pestova, E. V.,
and Morrison, D. A.
(1998)
J. Bacteriol.
180,
2701-2710 13.
Strom, M. S.,
and Lory, S.
(1987)
J. Bacteriol.
169,
3181-3188 14.
Strom, M. S.,
Bergman, P.,
and Lory, S.
(1993)
J. Biol. Chem.
268,
15788-15794 15.
Rawlings, N. D.,
and Barrett, A. J.
(1994)
Methods Enzymol.
244,
461-486[Medline]
[Order article via Infotrieve]
16.
Hu, N. T.,
Lee, P. F.,
and Chen, C.
(1995)
Mol. Microbiol.
18,
769-777[CrossRef][Medline]
[Order article via Infotrieve]
17.
Rawlings, N. D.,
and Barrett, A. J.
(1999)
Nucleic Acids Res.
27,
325-331 18.
Tschantz, W. R.,
Sung, M.,
Delgado-Partin, V. M.,
and Dalbey, R. E.
(1993)
J. Biol. Chem.
268,
27349-27354 19.
Marsh, J. W.,
and Taylor, R. K.
(1998)
Mol. Microbiol.
29,
1481-1492[CrossRef][Medline]
[Order article via Infotrieve]
20.
Russel, M.,
and Model, P.
(1984)
J. Bacteriol.
159,
1034-1039 21.
Yanisch-Perron, C.,
Vieira, J.,
and Messing, J.
(1985)
Gene (Amst.)
33,
103-119[CrossRef][Medline]
[Order article via Infotrieve]
22.
Kaufman, M. R.,
Seyer, J. M.,
and Taylor, R. K.
(1991)
Genes Dev.
5,
1834-1846 23.
Shaw, C. E.,
and Taylor, R. K.
(1990)
Infect. Immun.
58,
3042-3049 24.
Tabor, S.,
and Richardson, C. C.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
1074-1078 25.
Pfau, J. D.,
and Taylor, R. K.
(1998)
J. Bacteriol.
180,
4724-4733 26.
Nunn, D. N.,
and Lory, S.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3281-3285 27.
Hoare, D. G.,
and Koshland, D. E., Jr.
(1966)
J. Am. Chem. Soc.
88,
2057-2058[CrossRef]
28.
Takahashi, K.,
Tanokura, M.,
Inoue, H.,
Kojima, M.,
Muto, Y.,
Yamasaki, M.,
Makabe, O.,
Kimura, T.,
Takizawa, T.,
Hamaya, T.,
Suzuki, E.,
and Miyano, H.
(1991)
Structure and Function of the Aspartic Proteinases
, pp. 203-211, Plenum, New York
29.
Takahashi, K.,
Kagami, N.,
Huang, X. P.,
Kojima, M.,
and Inoue, H.
(1998)
Adv. in Exp. Med. Biol.
436,
275-282
30.
Rawlings, N. D.,
and Barrett, A. J.
(1994)
Methods Enzymol.
244,
19-61[Medline]
[Order article via Infotrieve]
31.
Rawlings, N. D.,
and Barrett, A. J.
(1995)
Methods Enzymol.
248,
105-120[Medline]
[Order article via Infotrieve]
32.
Rao, M. B.,
Tanksale, A. M.,
Ghatge, M. S.,
and Deshpande, V. V.
(1998)
Microbiol. Mol. Biol. Rev.
62,
597-635 33.
Sankaran, K.,
and Wu, H. C.
(1995)
Methods Enzymol.
248,
169-180[Medline]
[Order article via Infotrieve]
34.
Inagami, T.
(1981)
Biochemical Regulation of Blood Pressure
, pp. 39-73, John Wiley & Sons, Inc., New York
35.
Oda, K.,
Takahashi, S.,
Ito, M.,
and Dunn, B. M.
(1998)
Adv. Exp. Med. Biol.
436,
349-353[Medline]
[Order article via Infotrieve]
36.
Reeves, P. J.,
Douglas, P.,
and Salmond, G. P.
(1994)
Mol. Microbiol.
12,
445-457[CrossRef][Medline]
[Order article via Infotrieve]
37.
Lory, S.,
and Strom, M. S.
(1997)
Gene (Amst.)
192,
117-121[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  R. Fluhrer, H. Steiner, and C. Haass Intramembrane Proteolysis by Signal Peptide Peptidases: A Comparative Discussion of GXGD-type Aspartyl Proteases J. Biol. Chem., May 22, 2009; 284(21): 13975 - 13979. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Fluhrer, A. Fukumori, L. Martin, G. Grammer, M. Haug-Kroper, B. Klier, E. Winkler, E. Kremmer, M. M. Condron, D. B. Teplow, et al. Intramembrane Proteolysis of GXGD-type Aspartyl Proteases Is Slowed by a Familial Alzheimer Disease-like Mutation J. Biol. Chem., October 31, 2008; 283(44): 30121 - 30128. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Spasic and W. Annaert Building {gamma}-secretase - the bits and pieces J. Cell Sci., February 15, 2008; 121(4): 413 - 420. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Martin, R. Fluhrer, K. Reiss, E. Kremmer, P. Saftig, and C. Haass Regulated Intramembrane Proteolysis of Bri2 (Itm2b) by ADAM10 and SPPL2a/SPPL2b J. Biol. Chem., January 18, 2008; 283(3): 1644 - 1652. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Arts, R. van Boxtel, A. Filloux, J. Tommassen, and M. Koster Export of the Pseudopilin XcpT of the Pseudomonas aeruginosa Type II Secretion System via the Signal Recognition Particle-Sec Pathway J. Bacteriol., March 1, 2007; 189(5): 2069 - 2076. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Y. M. Ng, B. Chaban, D. J. VanDyke, and K. F. Jarrell Archaeal signal peptidases Microbiology, February 1, 2007; 153(2): 305 - 314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Tomich, D. H. Fine, and D. H. Figurski The TadV Protein of Actinobacillus actinomycetemcomitans Is a Novel Aspartic Acid Prepilin Peptidase Required for Maturation of the Flp1 Pilin and TadE and TadF Pseudopilins. J. Bacteriol., October 1, 2006; 188(19): 6899 - 6914. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. de Bentzmann, M. Aurouze, G. Ball, and A. Filloux FppA, a Novel Pseudomonas aeruginosa Prepilin Peptidase Involved in Assembly of Type IVb Pili J. Bacteriol., July 1, 2006; 188(13): 4851 - 4860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Yamasaki, S. Eimer, M. Okochi, A. Smialowska, C. Kaether, R. Baumeister, C. Haass, and H. Steiner The GxGD motif of presenilin contributes to catalytic function and substrate identification of gamma-secretase. J. Neurosci., April 5, 2006; 26(14): 3821 - 3828. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Szabo, S.-V. Albers, and A. J. M. Driessen Active-Site Residues in the Type IV Prepilin Peptidase Homologue PibD from the Archaeon Sulfolobus solfataricus J. Bacteriol., February 15, 2006; 188(4): 1437 - 1443. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Krawitz, C. Haffner, R. Fluhrer, H. Steiner, B. Schmid, and C. Haass Differential Localization and Identification of a Critical Aspartate Suggest Non-redundant Proteolytic Functions of the Presenilin Homologues SPPL2b and SPPL3 J. Biol. Chem., November 25, 2005; 280(47): 39515 - 39523. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. J. Kirn and R. K. Taylor TcpF Is a Soluble Colonization Factor and Protective Antigen Secreted by El Tor and Classical O1 and O139 Vibrio cholerae Serogroups Infect. Immun., August 1, 2005; 73(8): 4461 - 4470. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Bose and R. K. Taylor Identification of a TcpC-TcpQ Outer Membrane Complex Involved in the Biogenesis of the Toxin-Coregulated Pilus of Vibrio cholerae J. Bacteriol., April 1, 2005; 187(7): 2225 - 2232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Capell, D. Beher, S. Prokop, H. Steiner, C. Kaether, M. S. Shearman, and C. Haass {gamma}-Secretase Complex Assembly within the Early Secretory Pathway J. Biol. Chem., February 25, 2005; 280(8): 6471 - 6478. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lewenza, J. L. Gardy, F. S.L. Brinkman, and R. E.W. Hancock Genome-wide identification of Pseudomonas aeruginosa exported proteins using a consensus computational strategy combined with a laboratory-based PhoA fusion screen Genome Res., February 1, 2005; 15(2): 321 - 329. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Shirotani, D. Edbauer, S. Prokop, C. Haass, and H. Steiner Identification of Distinct {gamma}-Secretase Complexes with Different APH-1 Variants J. Biol. Chem., October 1, 2004; 279(40): 41340 - 41345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Wickstrum and S. M. Egan Amino Acid Contacts between Sigma 70 Domain 4 and the Transcription Activators RhaS and RhaR J. Bacteriol., September 15, 2004; 186(18): 6277 - 6285. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Arrieta, M. Sotolongo, C. Menendez, D. Alfonso, L. E. Trujillo, M. Soto, R. Ramirez, and L. Hernandez A Type II Protein Secretory Pathway Required for Levansucrase Secretion by Gluconacetobacter diazotrophicus J. Bacteriol., August 1, 2004; 186(15): 5031 - 5039. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Prokop, K. Shirotani, D. Edbauer, C. Haass, and H. Steiner Requirement of PEN-2 for Stabilization of the Presenilin N-/C-terminal Fragment Heterodimer within the {gamma}-Secretase Complex J. Biol. Chem., May 28, 2004; 279(22): 23255 - 23261. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. K. H. L. Boekema, J. P. M. Van Putten, N. Stockhofe-Zurwieden, and H. E. Smith Host Cell Contact-Induced Transcription of the Type IV Fimbria Gene Cluster of Actinobacillus pleuropneumoniae Infect. Immun., February 1, 2004; 72(2): 691 - 700. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Aguzzi and C. Haass Games Played by Rogue Proteins in Prion Disorders and Alzheimer's Disease Science, October 31, 2003; 302(5646): 814 - 818. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Wiesner, D. R. Hendrixson, and V. J. DiRita Natural Transformation of Campylobacter jejuni Requires Components of a Type II Secretion System J. Bacteriol., September 15, 2003; 185(18): 5408 - 5418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Xia and M. S. Wolfe Intramembrane proteolysis by presenilin and presenilin-like proteases J. Cell Sci., July 15, 2003; 116(14): 2839 - 2844. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-V. Albers, Z. Szabo, and A. J. M. Driessen Archaeal Homolog of Bacterial Type IV Prepilin Signal Peptidases with Broad Substrate Specificity J. Bacteriol., July 1, 2003; 185(13): 3918 - 3925. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. E. Golde and C. B. Eckman Physiologic and Pathologic Events Mediated by Intramembranous and Juxtamembranous Proteolysis Sci. Signal., March 4, 2003; 2003(172): re4 - re4. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Lammich, M. Okochi, M. Takeda, C. Kaether, A. Capell, A.-K. Zimmer, D. Edbauer, J. Walter, H. Steiner, and C. Haass Presenilin-dependent Intramembrane Proteolysis of CD44 Leads to the Liberation of Its Intracellular Domain and the Secretion of an Abeta -like Peptide J. Biol. Chem., November 15, 2002; 277(47): 44754 - 44759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Collyn, M.-A. Lety, S. Nair, V. Escuyer, A. Ben Younes, M. Simonet, and M. Marceau Yersinia pseudotuberculosis Harbors a Type IV Pilus Gene Cluster That Contributes to Pathogenicity Infect. Immun., November 1, 2002; 70(11): 6196 - 6205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Steiner, E. Winkler, D. Edbauer, S. Prokop, G. Basset, A. Yamasaki, M. Kostka, and C. Haass PEN-2 Is an Integral Component of the gamma -Secretase Complex Required for Coordinated Expression of Presenilin and Nicastrin J. Biol. Chem., October 11, 2002; 277(42): 39062 - 39065. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Gallio, G. Sturgill, P. Rather, and P. Kylsten A conserved mechanism for extracellular signaling in eukaryotes and prokaryotes PNAS, September 17, 2002; 99(19): 12208 - 12213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Schreiber, K. D. Stone, M. A. Strong, L. J. DeTolla Jr, M. Hoppert, and M. S. Donnenberg BfpU, a soluble protein essential for type IV pilus biogenesis in enteropathogenic Escherichia coli Microbiology, August 1, 2002; 148(8): 2507 - 2518. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. P. Ponting, M. Hutton, A. Nyborg, M. Baker, K. Jansen, and T. E. Golde Identification of a novel family of presenilin homologues Hum. Mol. Genet., May 1, 2002; 11(9): 1037 - 1044. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-H. Kim, J. Y. Leem, J. J. Lah, H. H. Slunt, A. I. Levey, G. Thinakaran, and S. S. Sisodia Multiple Effects of Aspartate Mutant Presenilin 1 on the Processing and Trafficking of Amyloid Precursor Protein J. Biol. Chem., November 9, 2001; 276(46): 43343 - 43350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. P. Esler and M. S. Wolfe A Portrait of Alzheimer Secretases--New Features and Familiar Faces Science, August 24, 2001; 293(5534): 1449 - 1454. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Kopan and A. Goate A common enzyme connects Notch signaling and Alzheimer's disease Genes & Dev., November 15, 2000; 14(22): 2799 - 2806. [Full Text]
|
|
|
|
 |
|
 H. Tjalsma, A. Bolhuis, J. D. H. Jongbloed, S. Bron, and J. M. van Dijl Signal Peptide-Dependent Protein Transport in Bacillus subtilis: a Genome-Based Survey of the Secretome Microbiol. Mol. Biol. Rev., September 1, 2000; 64(3): 515 - 547. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Wolfe and C. Haass The Role of Presenilins in gamma -Secretase Activity J. Biol. Chem., February 16, 2001; 276(8): 5413 - 5416. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |