J Biol Chem, Vol. 275, Issue 2, 861-866, January 14, 2000

Siglec-8
A NOVEL EOSINOPHIL-SPECIFIC MEMBER OF THE IMMUNOGLOBULIN SUPERFAMILY^*

Helen Floyd, Jian Ni^§, Ann L. Cornish, Zhizhen Zeng^§, Ding Liu^§, Kenneth C. Carter^§, Jane Steel^¶, and Paul R. Crocker

From  The Wellcome Trust Biocentre at Dundee, Department of Biochemistry, University of Dundee, Dundee DD1 5EH, Scotland, United Kingdom, ^§ Human Genome Sciences, Inc., Rockville, Maryland 20850-3338, and the ^¶ Imperial Cancer Research Fund, 44 Lincoln's Inn Fields, London WC1, United Kingdom

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We describe the characterization of siglec-8, a novel sialic acid-binding immunoglobulin-like lectin that is expressed specifically by eosinophils. A full-length cDNA encoding siglec-8 was isolated from a human eosinophil cDNA library. Siglec-8 is predicted to contain three extracellular immunoglobulin-like domains, a transmembrane region, and a cytoplasmic tail of 47 amino acids. The siglec-8 gene mapped on chromosome 19q13.33-41, closely linked to genes encoding CD33 (siglec-3), siglec-5, siglec-6, and siglec-7. When siglec-8 was expressed on COS cells or as a recombinant protein fused to the Fc region of human IgG₁, it was able to mediate sialic acid-dependent binding to human erythrocytes and to soluble sialoglycoconjugates. Using specific monoclonal antibodies, siglec-8 could be detected only on eosinophils and hence appears to be the first example of an eosinophil-specific transmembrane receptor.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Sialic acid binding Ig-like lectins (siglecs)¹ are type 1 membrane proteins that constitute a distinct subset of the Ig superfamily and are characterized by their sequence similarities and abilities to bind sialic acids in glycoproteins and glycolipids (1). In mammals, the group currently comprises sialoadhesin/siglec-1 (2), CD22/siglec-2 (3), CD33/siglec-3 (4), myelin-associated glycoprotein (MAG/siglec-4) (5), and siglec-5 (6), -6 (7), and -7 (8). Siglec-7 was also characterized independently as the inhibitory natural killer (NK) receptor, p75/AIRM1 (9). In addition, the gene encoding another siglec-like sequence, OBBP-like protein has been reported (GenBank^TM/EMBL accession no. AF135027), but there is no information on its binding activity. Each of these proteins has an extracellular region made up of a membrane distal V-set domain followed by varying numbers of C2-set domains, which range from 16 in sialoadhesin to 1 in CD33. In the cases of sialoadhesin (11), CD22 (12), MAG (13), and CD33 (14), the sialic acid binding site has been mapped to the V-set domain, and for sialoadhesin (15) it has been further characterized at the molecular level by x-ray crystallography.

Apart from MAG, which is found exclusively in the nervous system, all siglecs characterized to date are expressed on discrete subsets of hemopoietic cells and can provide useful lineage-restricted markers. Thus, CD22 is present only on mature B cells (16), sialoadhesin is found on macrophage subsets (17), CD33 is a marker of early committed myeloid progenitor cells (18), siglec-5 is expressed by monocytes and mature neutrophils (6), siglec-6 is on B cells (7), and siglec-7 is expressed by NK cells (8, 9) and monocytes (8). These expression patterns indicate discrete functions among hemopoietic cell subsets, but apart from CD22, a well characterized negative regulator of B cell activation (reviewed in Ref. 19), the biological functions of siglecs expressed in the hemopoietic system are unknown. Proposed functions include cell-cell interactions through recognition of sialylated glycoconjugates on other cells. However, a number of studies have also shown that cell-cell adhesion mediated by siglecs can be modulated by cis-interactions with sialic acids present in the host plasma membrane; this is particularly striking for CD22, CD33, and siglec-5, whose binding activities can be greatly increased if host cells are pretreated with sialidase to remove the cis-competing sialic acids (4, 6, 20).

In addition to potential roles in cellular interactions, there is growing evidence that, similar to CD22, the more recently characterized siglecs are involved in signaling functions. Falco and colleagues (9) identified siglec-7 in a screen for receptors that can inhibit the cytotoxic function of NK cells. The cytoplasmic tails of CD33/siglec-3 and siglec-5, -6, and -7 have two well conserved tyrosine-based motifs that are similar to signaling motifs in other leukocyte receptors (21). The tyrosine residues of CD33 and siglec-7 can be phosphorylated, leading to recruitment of the tyrosine phosphatases SHP-1 and SHP-2 in the case of CD33 (14) and SHP-1 in the case of siglec-7 (9).

In this study, we describe the characterization of siglec-8, a new member of the siglec family. This protein is able to mediate sialic acid-dependent binding to cells and soluble glycoconjugates either when expressed on COS cells or as a recombinant protein immobilized on plastic. Using two mAbs raised to the extracellular region of siglec-8, we demonstrate that this protein is expressed specifically on eosinophilic granulocytes, indicating a specialized role of siglec-8 in eosinophil biology.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Unless indicated otherwise, all reagents were purchased from Sigma. Protein A-Sepharose, protein G-Sepharose, dextran T70, and Percoll were purchased from Amersham Pharmacia Biotech, Vibrio cholerae sialidase from Calbiochem, and ¹²⁵I-labeled streptavidin (20-40 mCi/mg) and ECL^TM detection kits from Amersham Pharmacia Biotech. Protran nitrocellulose paper was from Schleicher & Schuell. Biotinylated polyacrylamide (PAA) glycoconjugates carrying either NeuAc2,3Gal1,4Glc (2,3 SL-PAA), NeuAc2,6Gal1,4Glc (2,6 SL-PAA), or lactose (L-PAA) were purchased from Syntesome (Munich, Germany). These conjugates have a molecular mass of ~30 kDa and contain 20% mol of saccharide and 5% mol of biotin. Phycoerythrin-conjugated anti-CD16 mAb was purchased from Serotec (Kidlington, UK). Anti-CD16 mAb-coupled magnetic microbeads were from Miltenyi Biotech (Bisley, UK). Streptavidin-coupled to horseradish peroxidase was from Vector (Peterborough, UK). 4-12% gradient gels were purchased from Novex (San Diego, CA). The NHS-Sulfo-Biotin was from Pierce. Immulon 3 microtiter plates were from Dynatech Laboratories Inc. (Chantilly, VA). The pIGplus plasmid was purchased from R & D Systems (Abingdon, UK), and pcDNA3 plasmid was from British Biotechnology (Oxford, UK). The IgM-Fc plasmid was generously provided by Dr. E. Kawasaki (Procept Inc., Cambridge, MA). A cDNA encoding full-length complement receptor type I (CR1) in the pcDM8 vector was kindly provided by Professor D. Fearon (Cambridge, UK).

Identification and Characterization of siglec-8 cDNA-- Using the amino acid sequence of CD33, a specific homology search was performed against a data base containing more than one million expression sequence tags (ESTs) obtained from over 700 different cDNA libraries. A full-length clone in pSPORT1 (Life Technologies Inc.) encoding one of the CD33-like sequences identified in the search was isolated from a human eosinophil library and designated pHEONN73. A computer search of nucleotide and protein sequences was carried out using the Blast GeneSearch (National Center for Biotechnology Information, National Institutes of Health, Bethesda, MD). Manipulations of sequences and alignments were performed using Baylor College of Medicine molecular biology software available on the internet (Human Genome Center, Baylor College of Medicine, Houston, TX).

Northern Blot Analysis-- A 826-base pair XhoI fragment, corresponding to the last 347 bases of the coding sequence and the first 479 bases of 3' untranslated sequence from pHEONN73, was labeled with ³²P by random priming using the Ready-To-Go DNA labeling system (Amersham Pharmacia Biotech) and two human multiple tissue Northern blots from CLONTECH (Palo Alto, CA) were hybridized according to the manufacturers' instructions. The blots contained approximately 2 µg of poly(A)⁺ RNA/lane from the following tissues: peripheral blood leukocytes, colon, small intestine, ovary, testis, prostate, thymus, spleen, pancreas, and kidney.

Chromosomal Mapping by FISH-- The chromosomal localization of the siglec-8 gene was determined by single-copy gene fluorescence in situ hybridization (FISH) to human male metaphase chromosome spreads as described (6).

Preparation of Recombinant siglec-8-- Recombinant chimeras containing the entire extracellular region of siglec-8 fused to either the Fc region of human IgG₁ (siglec-8-Fc) or the Fc region of human IgM (siglec-8-Fc-IgM) were generated by PCR using pHEONN73 as template. For siglec-8-Fc, the following forward and reverse primers were used (5'-3'): ACAAGCTTGCGCCTTCAAACCCAGACATG and ACTCTAGATTGTGATACAGGTCTTGAGGT. The PCR product was cloned in-frame into the pIGplus vector, which encodes a Factor Xa cleavage site between the extracellular region and the hinge region of the Fc portion of human IgG₁. For siglec-8-Fc-IgM protein, the same forward primer and the reverse primer (5'-3') ACGGATCCTTGTGATACAGGTCTTGAGGT were used; the PCR product likewise was cloned in-frame into the IgM plasmid. Plasmids were transfected into COS-1 cells by DEAE-transfection, and Fc-proteins were purified from the conditioned supernatants as described for IgG-based chimeras or by affinity chromatography on anti-IgM-Sepharose in the case of siglec-8-Fc-IgM.

Human RBC Binding Assays-- For binding assays to siglec-8 expressed in COS cells, a SalI-NotI fragment containing the entire cDNA insert from pHEONN73 was blunted and cloned into the EcoRV site of pcDNA3. COS-1 cells were transiently transfected with this plasmid, and binding assays with RBC carried out 48 h later as described (5). For solid-phase binding assays, untreated or sialidase-treated RBC were added to wells of microtiter plates that had been coated with Fc-proteins via anti-human Fc IgG (5). After 30 min at room temperature, unbound cells were removed by washing and bound RBC quantified as described (5).

Binding Assays with Polyacrylamide Glycoconjugates-- COS cells were transfected transiently with full-length cDNAs encoding either siglec-8 or human CR1 (CD35) as a control. After two days the COS cells were treated with V. cholerae sialidase as described (5). 10⁶ cells were incubated with a predetermined saturating concentration (20 µg/ml) of 2,3 SL-PAA, 2,6 SL-PAA, or L-PAA for 1 h at room temperature. Wells were washed in phosphate-buffered saline containing 0.2% bovine serum albumin and incubated with ¹²⁵I-labeled streptavidin in the same buffer at 0.5 µCi/ml for 1 h at 4 °C. After washing three times in phosphate-buffered saline containing 0.2% bovine serum albumin, bound radioactivity was solubilized by adding 0.1 M NaOH and counted using a Beckman -counter. The percentage of COS cells expressing the transfected cDNAs was between 20 and 30% as determined by FACS analysis.

Generation of Monoclonal Antibodies to siglec-8-- Purified recombinant siglec-8-Fc was cleaved with Factor Xa (6), and the purified extracellular region was used to immunize a group of three female BALB/C mice, using 2 µg of protein/injection following a standard procedure (22). The mice were boosted intravenously with 10 µg of siglec-8-IgM-Fc and given a final injection 2 weeks later with 10 µg of intact siglec-8-Fc. Fusions were carried out 4 days later using the SP2 myeloma as described (22). Supernatants containing anti-siglec-8 mAbs were screened by ELISA using siglec-8-Fc bound to plastic wells as described above for the adhesion assay. Positive hybridomas were cloned three times by limiting dilution. Immunoprecipitations from lysates of surface biotinylated cells were carried out as described (22).

Cells-- The Imperial Cancer Research Fund Cell Production Service provided the following cell lines: COS-1, 293T, U251MG, A2780, HL-60, U937, THP-1, Daudi, Jurkat, K562, and KG1b. The Copeletti and H71b cell lines were from Dr. A. Prescott, SySy5y, HeLa, and MRC-5 lines from Dr. S. Ponnambalam, and HaCat cells were provided by Dr. B. Lane. Stable CHO cell lines expressing CD33 and siglec-5, -7, and -8 were generated as described (8). COS-1 cells were cultured in Dulbecco's modified Eagle's medium with 5% heat-inactivated fetal calf serum (FCS), and CHO cells were cultured in Ham's F-10 medium with 5% FCS. Other cell lines were cultured in RPMI 1640 medium with 5 or 10% FCS. Human red blood cells (RBC) were obtained from healthy donors and stored at 4 °C in Alsever's solution for up to 2 weeks.

Isolation of Blood Leukocytes and Eosinophils-- Human blood leukocytes were obtained from whole blood by sedimentation of RBC in 6% dextran T70. Granulocytes were enriched on Percoll step gradients as described (23), and eosinophils were isolated from the enriched cells by negative selection on a MACS magnetic column using anti-CD16 microbeads (Miltenyi Biotech) according to the manufacturer's instructions. This selection resulted in a population of cells that contained 91-95% eosinophils as assessed by staining of cytospins with 1% aqueous eosin and Mayer's hematoxylin.

FACS Analysis-- Single and double labeling were performed using standard protocols (24). Following staining, cells were fixed in 2% formaldehyde and analyzed on a Becton Dickinson FacScan with CellQuest software.

Siglec-8 Expression on Eosinophils and Basophils-- Granulocytes were stained with anti-siglec-8 mAb followed by fluorescein isothiocyanate-anti-mouse F(ab')₂. After a 5-min incubation in Kimura's stain, which labels eosinophils green and basophils cerise (25), the stained cells were analyzed for the presence of siglec-8 using a combination of light and fluorescence microscopy. The percentages of eosinophils and basophils expressing siglec-8 were determined from counts of more than 100 cells in each of three independent experiments.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Characterization of siglec-8-- pHEONN73, a clone derived from a human eosinophil cDNA library, was identified as an EST sharing a high degree of sequence similarity with human CD33 cDNA. Examination of its full-length sequence of 2930 base pairs revealed a single long open reading frame encoding a type 1 transmembrane protein of 431 amino acids belonging to the Ig superfamily. Based on its sequence similarity with other siglecs and its ability to bind sialic acid (see below), this protein has been designated siglec-8 (Fig. 1). The extracellular region of siglec-8 contains a hydrophobic signal peptide and three Ig-like domains consisting of an N-terminal V-set domain and two C2-set domains. There are three potential N-linked glycosylation sites. Following the transmembrane region, there is a cytoplasmic tail of 47 amino acids.

View larger version (97K): [in this window] [in a new window]   Fig. 1.   Predicted protein sequence of siglec-8 and alignment with closely related siglecs and a siglec-like sequence (OBBP-like). Alignment was performed with the ClustalW multiple sequence alignment program and optimized by eye. Residues that are identical in one-half or more of the proteins are boxed in black, and residues that are similar are in gray. Asterisks indicate the positions of the cysteine residues characteristic of siglecs. Open circles are positioned above residues that are likely to be important for sialic acid binding, as revealed in the crystal structure of sialoadhesin complexed with 3'-sialyllactose (15). Potential N-linked glycosylation sites on siglec-8 are shown by open boxes. Vertical lines indicate positions of intron-exon boundaries as deduced from the sequence of the gene encoding OBBP-like protein. Positions of the predicted domain boundaries, transmembrane region, and cytoplasmic tail are shown. Strand assignments of -strands in domains 1 and 2 are indicated. GenBankTM/EMBL accession numbers are as follows: siglec-8, AF195092; siglec-7, AF170485; OBBP-like, AF135027; siglec-5, AF170484; CD33, M23197; CD33L1/OBBP-1/siglec-6, D86358.

Homology of siglec-8 to Other Proteins-- In data base searches, the closest matches were, in rank order, siglec-7, OBBP-like, CD33, siglec-5, and siglec-6. In the extracellular region, these proteins were, respectively, 71, 68, 62, 54, and 52% identical. However, the cytoplasmic tail of siglec-8 was only partially similar to those of the above mentioned siglecs, extending for 31 amino acids and lacking the conserved tyrosine-based motifs present in the related proteins (Fig. 1). Because the region of homology in the cytoplasmic tail ended abruptly at a position corresponding to the end of an exon in the gene encoding OBBP-like protein (Fig. 1), we considered the possibility that the truncated cytoplasmic tail in siglec-8 was due to alternative splicing. However, PCR experiments, using a human eosinophil cDNA library as template and primers that flank the potential truncation site, failed to reveal evidence for alternative splicing. Under the conditions used, a single fragment was amplified that was indistinguishable in size from that amplified using pHEONN73 cDNA as template (data not shown).

The two N-terminal Ig-like domains of siglec-8 contain the characteristic structural features of the siglec subgroup of Ig superfamily proteins (Fig. 1). There is precise conservation of the unusual pattern of cysteines found in these proteins (15), as well as the key amino acids involved in sialic acid binding, in particular the critical arginine at position 125 and the two conserved aromatic residues at positions 27 and 133 on the A and G strands of the V-set domain (Fig. 1).

Chromosomal Localization and Expression of the siglec-8 Gene-- The gene encoding siglec-8 was mapped by in situ hybridization on chromosome 19q13.33-q13.41 (data not shown), closely linked to the genes encoding human CD33, siglec-5, siglec-6, siglec-7, and OBBP-like protein (6, 8, 26, 27). When human multiple tissue Northern blots were hybridized with an 0.8-kilobase probe corresponding to the coding and 3' untranslated sequences, no specific bands were observed. This finding suggests that the mRNA is either poorly expressed or is expressed by rare cell type(s) at a level below that required for detection by Northern blotting.

Siglec-8 Mediates Sialic Acid-dependent Binding-- All siglecs so far characterized are able to mediate sialic acid-dependent binding to human RBC either when recombinant proteins are immobilized on plastic or following transient expression on the surface of COS cells (4-6, 8). Accordingly, immobilized siglec-8-Fc bound RBC in a concentration- and sialic acid-dependent manner (Fig. 2A). However, when siglec-8 was expressed in COS cells, only very occasional cells bound RBC, but, similar to other siglecs, this could be enhanced if the transfected cells were treated with sialidase before addition of the RBC (data not shown).

View larger version (17K): [in this window] [in a new window]   Fig. 2.   Sialic acid-dependent binding of siglec-8 to human RBC and soluble glycoconjugates. A, binding of siglec-8 immobilized on plastic to human RBC. Siglec-8-Fc (circles) and neural cell adhesion molecule-Fc (triangles) (used as a negative control) were coated at varying concentrations onto plastic wells of ELISA plates and incubated with untreated (filled symbols) or, for siglec-8 coated wells, with sialidase-treated human RBC (open circles). Unbound cells were washed off and RBC binding determined using the pseudoperoxidase activity of hemoglobin. Data show the means ± range of duplicate samples and are representative of three experiments performed. B, binding of siglec-8 expressed in COS cells to polyacrylamide glycoconjugates. COS cells were transiently transfected with siglec-8 or CR1 as a negative control, treated with sialidase to remove potentially inhibitory sialic acids, and incubated with PAA glycoconjugates linked either to 2,3 sialyllactose (2,3-PAA), 2,6 sialyllactose (2,6-PAA), or lactose-PAA (Lac-PAA) at 20 µg/ml. After washing, cells were incubated with 125I-labeled streptavidin, and specifically bound counts were determined. Data show the means ± S.D. of quadruplicates and are representative of three experiments performed.

To investigate the sialic acid linkage preference of siglec-8, COS-1 cells were transiently transfected with cDNAs encoding siglec-8 or CR1 as a negative control. Following sialidase treatment of the COS cells to remove potentially cis-inhibitory sialic acids, binding assays were carried out using biotinylated polyacrylamide, derivatized with 3'- or 6'-sialyllactose or with lactose (Fig. 2B). Siglec-8 showed a clear preference for 3'- over 6'-sialyllactose-conjugated PAA. No siglec-8-dependent binding was observed with lactose-conjugated PAA used as a control.

Siglec-8 Is Expressed Specifically on Human Eosinophils-- To examine the cellular expression of siglec-8, two monoclonal antibodies, 6B11 and 7C9, were generated to recombinant forms of the protein. FACS analyses with a panel of CHO cells expressing CD33 (siglec-3), siglec-5, siglec-7, and siglec-8 showed that both mAbs reacted only with siglec-8 (data not shown). Furthermore, in immunoprecipitations with stably transfected CHO cells expressing siglec-8, a single band was observed at ~45 kDa under reducing conditions and at 89 kDa under nonreducing conditions (data not shown); this suggests that, similar to CD33 (18) and siglec-5 (6), siglec-8 exists as a dimer at the cell surface.

Because the related siglecs are expressed by hemopoietic cell subsets, we initially focused our attention on peripheral blood leukocytes. Using either mAb, FACS analysis showed that siglec-8 was absent from lymphocytes, monocytes, and neutrophils but could be detected on the CD16-negative eosinophils that constitute 1-5% of the granulocyte fraction (Fig. 3). Specific expression of siglec-8 on eosinophils was found with 10 different healthy donors in 15 independent experiments.

View larger version (25K): [in this window] [in a new window]   Fig. 3.   FACS analyses of siglec-8 expression on human blood leukocytes. A, forward scatter versus side scatter profile of purified blood leukocytes. The R1 window corresponds to lymphocytes and NK cells, R2 to monocytes, and R3 to granulocytes. The fluorescence dot plots in B show double labeling of cells in the R1, R2, and R3 windows with anti-CD16-phycoerythrin and anti-siglec-8 mAb 7C9 followed by fluorescein isothiocyanate-conjugated anti-mouse IgG. Cells in the lymphocyte and monocyte windows are negative for siglec-8. In the granulocyte window, siglec-8 is specifically expressed on the CD16-negative population of eosinophils. Values in the quadrants show the percentages of each gated population.

Direct evidence that siglec-8 is expressed on eosinophils was obtained from FACS analyses of eosinophils that had been purified by negative selection with anti-CD16 magnetic beads (Fig. 4). Interestingly, siglec-5, which is expressed by neutrophils (6), was absent from the eosinophils (Fig. 4), showing that siglec-5 and -8 are expressed reciprocally on granulocyte populations. Because basophils are closely related to eosinophils, it was important to determine whether basophils also expressed siglec-8. Using Kimura's stain (25) to distinguish the two cell types, 92 ± 14% of eosinophils and 0 ± 0% basophils (means ± S.D.) were found to express siglec-8 by immunofluorescence analysis, thereby showing that siglec-8 was absent from basophils.

View larger version (54K): [in this window] [in a new window]   Fig. 4.   Expression of siglec-8 on purified eosinophils. A, eosinophils were purified from granulocytes by negative selection using CD16 immunobeads and analyzed for staining with the anti-siglec-8 mAb, 7C9, or or anti-siglec-5 mAb, 1A5. Eosinophils express siglec-8 uniformly but are negative for siglec-5, which gave a staining pattern identical to that obtained with mouse IgG used as a negative control (not shown). B, micrographs from hematoxylin and eosin-stained preparations of total blood leukocytes (left), CD16-selected neutrophils (center), and purified eosinophils (right). Arrows depict eosinophils before and after purification.

Finally, several hemopoietic and nonhemopoietic human cell lines were screened by FACS to investigate siglec-8 expression. These included HL-60 (myelomonocytic), U937 (promonocytic), THP-1 (monocytic), Daudi (B lymphoblastoid), Jurkat (T lymphoblastoid), HUT78 (T cell), Mono-Mac-6 (monocytic), K562 (erythro-myeloid), KG1b (early myeloid), Copeletti (eye lens epithelium), U251MG (glioma), SySy5y (neuronal), HaCat (keratinocyte), HeLa (epithelial), A2780 (ovarian cancer), MRC-5 (fibroblast), H71b (corneal), 293T (kidney fibroblast), and MCF-7 (breast cancer). In no case was staining observed when using either mAb to siglec-8 (data not shown). In conclusion, the results of these studies show that, among mature hemopoietic cells, siglec-8 is expressed specifically by eosinophils and is absent from a wide range of hemopoietic and nonhemopoietic cell lines.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The siglecs represent an expanding family of sialic acid binding receptors that are largely expressed on discrete subsets of hemopoietic cells. Remarkably, siglec-8, whose cDNA was isolated from an eosinophil library, appears to be expressed specifically by eosinophils. Although the expression of siglec-8 on other cell types cannot be excluded, several lines of evidence presented here indicate that this molecule is normally only expressed by eosinophils. Of approximately 2 million ESTs derived from more than 700 cDNA libraries, siglec-8 has only been represented once, unlike other siglecs for which multiple ESTs have been identified.² Also, on multiple tissue Northern blots, no specific bands could be detected. Although eosinophils are potentially long-lived cells present in many tissues, the lack of detectable mRNA from all 10 tissues examined may reflect the relative paucity of these cells in tissues and/or low level transcription of the siglec-8 gene in mature eosinophils. Further studies are required to determine whether siglec-8 is expressed on tissue eosinophils at levels equivalent to those observed on resting, circulating eosinophils. It was not possible to investigate this in the present study because the epitope(s) recognized by the anti-siglec-8 mAbs was unusually sensitive to commonly used alcohol- and aldehyde-based fixatives needed for preserving tissue architecture.³ Finally, in a wide screen of cell lines of both hemopoietic and nonhemopoietic origins, siglec-8 was undetectable at the cell surface. Even basophils, a cell type closely related to eosinophils, failed to express siglec-8. Interestingly, siglec-8 appears to be the only siglec characterized thus far that is expressed on eosinophils, suggesting that the protein may serve a nonredundant role in eosinophil biology.

Eosinophils are thought to be important cells in a variety of inflammatory reactions because they possess a wide array of functional responses that can cause tissue damage, both to foreign invaders as well as host tissues (reviewed in Ref. 28). Thus, they have long been considered an important component of host defenses to certain parasitic diseases, such as those caused by helminthic parasites, but their presence can be detrimental in certain autoimmune diseases such as asthma. Although further studies are needed to investigate the potential functions of siglec-8 in eosinophil biology, the ability of this receptor to bind sialic acids suggests a potential role in cellular interactions, as proposed for the other siglecs. For example, CD22 on B cells has recently been shown to be involved in bone marrow endothelial cell interactions, leading to selective homing of B cells to this tissue (29). Further studies are needed to determine whether, in an analogous manner, siglec-8 can bind sialylated ligands on endothelial cells, thereby providing an additional, eosinophil-specific mechanism for transendothelial migration. It is also possible that siglec-8 can bind other, non-carbohydrate ligands, as has been shown recently with siglec-6, which shows low but significant affinity for the cytokine leptin (7).

Besides their postulated involvement in cell-cell interactions, several siglecs have been implicated in signaling functions. CD33 (siglec-3) and siglec-5, -6, and -7 possess highly conserved tyrosine-based motifs in their cytoplasmic tails. Where studied, the tyrosine residues can be phosphorylated, leading to recruitment of the tyrosine phosphatases SHP-1 and SHP-2 in the case of CD33 (14) and SHP-1 only in the case of siglec-7 (9). It is striking that siglec-8, despite being highly related in the extracellular region, lacks these tyrosine-based motifs. Thus, if siglec-8 is involved in signaling functions on eosinophils, this would be expected to be through a different mechanism than that used by the related siglecs.

	ACKNOWLEDGEMENTS

We are grateful to Craig Stocks for contributions during the initial phase of this work, Gareth Forbes and Stuart Dubock for help with binding assays, Jiquan Zhang for assistance with Northern blot analysis, and Gavin Nicoll for help with FACS analysis. We thank Andrew Wardlaw for advice on eosinophil staining procedures, Simon Powis for help with immunoprecipitations, and Amanda Mackenzie for assistance in producing CHO cell lines.

	FOOTNOTES

^* This work was supported by The Wellcome Trust and the Imperial Cancer Research Fund.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 44-1382-345781; Fax: 44-1382-345855; E-mail: p.r.crocker@dundee.ac.uk.

² J. Ni, unpublished observations.

³ H. Floyd, unpublished observations.

	ABBREVIATIONS

The abbreviations used are: siglec, sialic acid binding Ig-like lectin; CHO, Chinese hamster ovary cells; CR1, complement receptor type 1; EST, expressed sequence tag; PAA, biotinylated polyacrylamide; L-PAA, Gal1,4Glc coupled to PAA; mAb, monoclonal antibody; MAG, myelin-associated glycoprotein; siglec-8-Fc, the three extracellular domains of siglec-8 coupled to the Fc part of human IgG₁; 2, 3 SL-PAA, NeuAc2,3Gal1,4Glc coupled to PAA; 2, 6 SL-PAA, NeuAc2,6 Gal1,4Glc coupled to PAA; siglec-8-Fc-IgM, the three extracellular domains of siglec-8 coupled to the Fc part of human IgM; PCR, polymerase chain reaction; RBC, red blood cells; ELISA, enzyme-linked immunosorbent assay; FACS, fluorescence-activated cell sorter; FCS, fetal calf serum; NK cells, natural killer cells.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES