|
J Biol Chem, Vol. 275, Issue 20, 14882-14889, May 19, 2000
Glycosylphosphatidylinositol-anchored Glucanosyltransferases
Play an Active Role in the Biosynthesis of the Fungal Cell Wall*
Isabelle
Mouyna §,
Thierry
Fontaine ,
Marina
Vai¶ ,
Michel
Monod**,
William A.
Fonzi ,
Michel
Diaquin ,
Laura
Popolo¶ ,
Robbert P.
Hartland , and
Jean-Paul
Latgé
From the Institut Pasteur, Laboratoire des
Aspergillus, 25 Rue du Docteur Roux, 75724 Paris, Cedex 15, France,
¶ Università degli Studi di Milano, Dipartimento di
Fisiologia, e Biochimica Generali, Via Celoria 26, 20133 Milan, Italy, ** Laboratoire de Mycologie, Service de
Dermatologie, Hopital de Beaumont, 04-423 CHUV
1011 Lausanne, Switzerland, and
 Department of Microbiology and Immunology,
School of Medicine, Georgetown University Medical Center,
Washington, D. C. 20007
 |
ABSTRACT |
A novel 1,3- -glucanosyltransferase isolated
from the cell wall of Aspergillus fumigatus was recently
characterized. This enzyme splits internally a 1,3- -glucan molecule
and transfers the newly generated reducing end to the non-reducing end
of another 1,3- -glucan molecule forming a 1,3- linkage, resulting
in the elongation of 1,3- -glucan chains. The GEL1 gene
encoding this enzyme was cloned and sequenced. The predicted amino acid
sequence of Gel1p was homologous to several yeast protein families
encoded by GAS of Saccharomyces cerevisiae,
PHR of Candida albicans, and EPD of
Candida maltosa. Although the expression of these genes is
required for correct morphogenesis in yeast, the biochemical function
of the encoded proteins was unknown. The biochemical assays performed
on purified recombinant Gas1p, Phr1p, and Phr2p showed that these
proteins have a 1,3- -glucanosyltransferase activity similar to that
of Gel1p. Biochemical data and sequence analysis have shown that Gel1p
is attached to the membrane through a glycosylphosphatidylinositol in a
similar manner as the yeast homologous proteins. The activity has been
also detected in membrane preparations, showing that this
1,3- -glucanosyltransferase is indeed active in vivo. Our
results show that transglycosidases anchored to the plasma membrane via
glycosylphosphatidylinositols can play an active role in fungal cell
wall synthesis.
 |
INTRODUCTION |
The cell wall of the human opportunistic fungal pathogen
Aspergillus fumigatus is a complex structure mainly composed
of polysaccharides, 1,3- -glucan being the most abundant (1, 2). In a
way similar to other fungi, 1,3- -glucans of A. fumigatus
serve as a skeleton on which the other polysaccharides of the cell wall
(chitin and galactomannan) become anchored (3). In filamentous fungi
and in yeast, 1,3- -glucans are synthesized by a plasma
membrane-bound glucan synthase complex, which uses UDP-glucose as a
substrate and extrudes 1,3- -glucan chains through the membrane into
the periplasmic space (4, 5). Genes homologous to the FKS
genes of Saccharomyces cerevisiae, which encode the putative
catalytic subunit of 1,3- -glucan synthase, have been identified in
Aspergillus nidulans (6) and in A. fumigatus.1 However,
1,3- -glucan chains produced by the 1,3- -glucan synthase complex
remain unorganized and alkali-soluble until covalent linkages occur
between 1,3- -glucans and other cell wall components.
In a search for periplasmic transglycosidases responsible for linking
glucans to other cell wall molecules, a newly described 1,3- -glucanosyltransferase has been identified in A. fumigatus (7). It was isolated from a cell wall autolysate as a
49-kDa polypeptide. The enzyme acts first as an endoglucanase and then transfers the newly generated reducing end to the non-reducing end of
another laminarioligosaccharide forming a new 1,3- linkage. In this
study, we report the cloning and the sequencing of the GEL1
(for glucan elongating glucanosyltransferase)
gene. GEL1 encodes a glycosylphosphatidylinositol
(GPI)-anchored protein that is homologous
to several yeast proteins such as Gas1p of S. cerevisiae
(8-11) or Phrp of Candida albicans (12, 13). GAS1,
PHR1, and PHR2 gene products are required for correct
morphogenesis in yeast and were so far endowed with an unknown
biochemical function. Here we show that Gas1p, Phr1p, and Phr2p display
the same 1,3- -glucanosyltransferase activity as Gel1p of A. fumigatus.
 |
EXPERIMENTAL PROCEDURES |
Strains and Standard Growth Conditions--
A.
fumigatus strain CBS 144.89 was grown in Sabouraud liquid medium
(2% glucose + 1% mycopeptone, Biokar, Beauvais, France). The S. cerevisiae haploid strain WB2d (gas1::LEU2),
generated from the wild-type strain W303-1B (MAT ade2-1
his3-11, 15 trp1-1 ura3-1 leu2-3, 112 can1-100) by one-step
disruption (11), was the host strain for complementation experiments.
The strain of S. cerevisiae Exg2 (14), devoid
of the major exoglucanase activity, kindly provided by F. Del Rey was
used to detect the presence of the 1,3- -glucanosyltransferase
activity in the S. cerevisiae membranes. The S. cerevisiae strains and the wild-type C. albicans CAF3-1 (12) were grown on yeast nitrogen base (0.67%) medium containing 2% glucose, 0.5% casamino acids, and the required
supplements at 50 mg/ml (YNB) or in YPD medium (1% yeast extract, 2%
mycopeptone, 2% glucose). Cultures were performed in flasks incubated
at 25 °C at 200 rpm or in fermenters for 24 h at 25 °C, 500 rpm (7, 15). Escherichia coli JM 101 ( (lac pro
AB) thi strA supE endA sbcB hsdR F'
(traD36 proAB lacIq
lacZ M15)) was the host strain for recombinant DNA manipulations.
Cloning Procedures and DNA Manipulations--
A EMBL3 genomic
library of A. fumigatus was screened with
[ -32P]ATP-labeled degenerated oligonucleotides deduced
from the amino acid sequencing of the NH2-terminal and
internal peptides obtained after endolysin digestion of the 49-kDa
polypeptide previously purified (7). Cloning and sequencing procedures
were as described previously (15). The position of the introns was
determined after amplification of cDNA by PCR using primers deduced
from the genomic DNA sequence. The samples in a 100-µl reaction
volume containing 200 µM each of dNTP, 100 pmol of each
primer, 1 ng of cDNA, and 1 unit of Taq polymerase
(Amersham Pharmacia Biotech) were subjected to 30 cycles of
amplification consisting of the following steps: 1 min at 95 °C, 1 min at 55 °C, 1 min at 72 °C. The PCR products were subcloned in
pCR2.1 (TA Cloning kit, Invitrogen), and sequencing was performed as
described previously (15).
RNA Extraction and Reverse Transcription (RT)-PCR--
RNA was
isolated from mycelium of A. fumigatus grown in Sabouraud
liquid culture using a Qiagen RNA/DNA kit. Reverse transcription was
carried out with the Promega Reverse Transcription System kit following
the instructions of the manufacturer. A tube containing all the
reaction components and heat-inactivated (10 min at 94 °C) avian
myeloblastosis virus-RT was always included as a negative control to
check for the presence of contaminating DNA. The cDNA products were
then employed as target DNAs for amplifications as described
previously using two sets of primers as follows: PGel1a
5'-CCTCTGCTGCTCCCTACG-3'; PGel1b 5'-GTTGGTGTTGCAGCC-3' for
amplification of a 0.35-kb fragment of the GEL1 gene and
Pactin 1 5'-GGTGATGAGCCACAGTCCAAG-3'; Pactin 2 5'-GGGGACGACGTGGGTAACAAC-3' for amplification of a 0.3-kb
fragment of the actin gene as a control deduced from the A. nidulans gene (16). The RT-PCR products were resolved by
electrophoresis on 2% agarose gels and stained with ethidium bromide
for photography.
Complementation of gas1 of S. cerevisiae by A. fumigatus
GEL1--
A fragment of the GAS1 gene that contains the
promoter region, the start codon, and the signal sequence (11) was
amplified by PCR using a sequence-specific 5' primer containing
a HindIII site (underlined),
5'-ACTCAAGCTTATCGATTACTGGCATACAATGGT-3', and a 3' primer
with a SmaI site (underlined) after the last codon of the
signal sequence (at nucleotide +68),
5'-AATCCCGGGCAGTTGCGACGCCAGCAAA-3'. The resulting PCR
product of approximately 1 kb was then digested with HindIII
and SmaI and cloned into a
HindIII/SmaI-cut pGEM-7Zf(+) (Promega Corp.,
Madison, WI) to give plasmid pHSP. The coding region of the
GEL1 cDNA lacking the NH2 terminus was
PCR-amplified by the forward primer
5'-CAGGAATTCGACGACGTTACTCCCATCA-3' and the reverse primer
5'-ACTCTAGAATCCAAGAGGACGAGGCCAGC-3' with the
XbaI site (underlined) after the stop codon, generating a
fragment of about 1.3 kb with an EcoRI site (underlined)
introduced at nucleotide +73 (corresponding to alanine 25) to
facilitate the fusion with the 5' region of the GAS1 gene.
The resulting PCR product was subsequently digested with
EcoRI (filled with Klenow) and XbaI and
introduced into plasmid pHSP cut with SmaI and
XbaI. DNA sequencing confirmed the desired in frame fusion.
The GAS1/GEL1 fusion was then cloned in the high copy number
vector YEp24 and the resulting plasmid used to transform the WB2d
strain. Transformation of S. cerevisiae cells was carried
out by the lithium acetate procedure (17), and transformants were
selected on YNB without amino acid, 2% glucose, and auxotrophic
supplements. The transformed strain is indicated throughout the text as
WB2d (YEp-ScGEL1). Other strains harboring plasmids used
were WB2d (YEp-GAS1) (18) and WB2d (YEp), obtained after
transformation of WB2d with the YEp24 plasmid without insert.
Expression of Gel1p in Pichia pastoris--
P.
pastoris GS115 (Invitrogen) and the expression vector pKJ113 (19)
were used to express recombinant A. fumigatus Gel1p. The
full open reading frame of GEL1 (Gel1p452) and a
truncated form of GEL1 (Gel1p419) were
generated by PCR amplification of the gene with the forward primer
5'-TATCTCGAGCCCCCTCCATCAAGGCTCGTGACGACGTTACTCCCATCACT-3' and the reverse primer 1, 5'-CTAGGATCCTCACAAGAGGACGAGGCCAGC-3' (for the full
GEL1), or the reverse primer 2, 5'-GTAGGATCCCTAAGCGCCCTTGGAAGAGGTGGA-3' (for the
truncated form). The forward primer was complementary to nucleotides
+58 to +99 that incorporated an XhoI site (underlined) at
the 5' end. The reverse primer 1 was complementary to nucleotides 1339-1356 of the coding region, encompassing the codon form
Ala447 to Leu452, and the reverse primer 2 was
complementary to nucleotides 1237-1257 of the coding region,
encompassing the codon form Ser413 to Ala419.
It incorporated an in frame TAG stop codon and a BamHI site (underlined) at the 3' end. Thirty cycles consisting of 1 min at
95 °C melting step, a 1-min 60 °C annealing step, and 1-min 70 °C extension were run. The resulting PCR products were digested by XhoI and BamHI and cloned into the expression
vector pKJ113 digested by the same enzymes, generating the plasmid
pISAB1 and the plasmid pISAB2. P. pastoris spheroplasts were
transformed with 10 µg of pISAB1 or 10 µg of pISAB2 linearized by
EcoRI. Transformants were selected on histidine-deficient
medium and screened on minimal methanol plates for insertion of the
construct in the P. pastoris GS115 genome as described
previously (19). Production of r-Gel1p452 and
r-Gel1p419 placed under the control of the alcohol oxidase
promoter in P. pastoris was obtained consecutively to the
addition of 0.7% methanol to the culture medium (Invitrogen
manufacturer's instructions).
Biochemical Characterization of Gel1p--
To extract membrane
proteins of A. fumigatus or P. pastoris
expressing recombinant Gel1p, mycelium or yeast cells were
resuspended in a Tris-HCl, pH 7.5, buffer containing 0.25 M
sucrose, 1 mM MgCl2, 1 mM
phenylmethylsulfonyl fluoride and disrupted for 3 min with 1-mm
diameter glass bead in an MSK (Braun) cell breaker (or 10 min with
0.5-mm diameter glass for yeast cells).
The cell homogenates were then centrifuged for 10 min at 4,000 × g to remove the cell walls. The 4,000 × g
supernatants were centrifuged for 1 h at 36,000 × g, and the membrane pellets were suspended in the extraction
buffer and stored at 20 °C. GPI-PLC treatment of membrane extracts
was performed as recommended by Oxford Glycosystems (Abingdon, UK).
Briefly, 10 µl of membrane extract was incubated with 5 µl of
GPI-PLC and at least 10 volumes of buffer at 37 °C for 30 min to
4 h. Buffers were, respectively, 20 mM Tris-HCl, pH
7.4, 150 mM NaCl, 5 mM EDTA, and 0.1% Triton X-114 for the Trypanosoma brucei enzyme and 100 mM Tris, pH 7.5, 1 mM EDTA, 1 mM
dithiothreitol for the Bacillus thuringiensis enzyme.
GPI-PLC treatment was performed on intact or methanol (4 volumes)-denatured protein extract. Partitioning of membrane proteins
with Triton X-114 was done by a modification of the method of Bordier
(20). Briefly, 20 µl of a membrane extract was resuspended in 40 volumes of the extraction buffer containing 2% Triton X-114 (Sigma).
After 1 h at 4 °C, the suspension was incubated for 30 s
at 37 °C. The two phases were separated by a 30-s centrifugation; the aqueous phase was extracted 3 times after adding 0.02 volume of
concentrated Triton X-114, and the detergent phase was extracted 3 times with the extraction buffer. Proteins were precipitated with
trichloroacetic acid (5-10% final concentration) and washed with cold
acetone. SDS-polyacrylamide gel electrophoresis of the different
protein extracts was performed on a 10% separating gel with a 4%
stacking gel. Electrotransfer of proteins to nitrocellulose membrane
(0.2-µm pore size, cellulose nitrate (Schleicher & Schuell)) was done
overnight at 30 V in a 50 mM Tris, 200 mM
glycine, 20% methanol buffer (21). Two antisera used for Western
blotting were directed against the cross-reactive determinant (CRD)
specific for GPI proteins (Oxford Glycosystems) or Gel1p. Two
immunization protocols were used to produce the anti-transferase
antiserum. First, 20 µg of the 49-kDa polypeptide purified from the
cell wall autolysate were mixed in 0.9% NaCl (w/v) with an equal
volume of Freund's complete adjuvant and injected intradermally at
multiple sites in female Balb/c mice. Two booster injections of the
transferase in Freund's incomplete adjuvant (1:1 (v/v)) were
administered at 2-week intervals. Alternatively, rabbits were immunized
against a peptide INRAKPKESYNDVYC designed on the basis of sequence
data. Coupling of the peptide through cysteine to
m-maleimido-benzoyl-N-hydroxy-succinimide ester,
immunization of the animal, and titer determination of the antiserum
were performed by Eurogentec (Seraing, Belgium). Immunopurification of
the specific antipeptide antibodies was done after coupling the peptide
to epoxy-activated Sepharose (Amersham Pharmacia Biotech) following the
instructions of the manufacturer. Immunolabeling of blots was done
using the ECL Western blotting detection procedure of Amersham
Pharmacia Biotech.
Expression of Gas1p in S. cerevisiae--
The production of
Gas1p535, which is a truncated form of Gas1p lacking the
proposed GPI attachment site (Asn528) and the COOH-terminal
hydrophobic domain, was done using plasmid pS526 gp115
previously described (22). This plasmid, which contains an
SfuI site in the second codon upstream from
Asn528, was digested with SfuI and
HindIII, filled in, and used to transform the WB2d
(gas1::LEU2) strain. The transformed strain was
grown for 24 h in YNB medium, and the culture filtrate was stored frozen.
Expression of Phr1p and Phr2p in S. cerevisiae--
Recombinant
Phr1p and Phr2p were expressed from the galactose-inducible promoter of
vector pYES2 (Invitrogen). A truncated form of PHR1
was generated by PCR amplification of the gene with the forward
primer 5'-AAGAATTCCAAACTACAGGTTGAAGCCA-3' and the reverse
primer 5'-GAATTCTCGAGCTATTTAACTCCAGAGCTTGAGCT-3'. The forward primer was complementary to nucleotides 28 to 8, relative to the translational start codon, and incorporated an EcoRI
site (underlined) at the 5' end. The reverse primer was complementary to nucleotides 1540-1560 of the coding region, encompassing the codons
for Ser514 to Lys520. It incorporated an in
frame TAG stop codon adjacent to the Lys520 codon and an
XhoI site (underlined) at the 3' end. The resulting gene
encoded a carboxyl-truncated form of Phr1p which is secreted from the
cells due to the absence of the GPI attachment site. This product was
directionally cloned into the EcoRI and XhoI sites of pYES2. A truncated form of PHR2 was produced in an
analogous manner using the forward primer
5'-AAGAATTCATTCGATCGCTATGTTGTTGAA- 3' and the reverse
primer 5'-TTTCTCGAGTTATTATTTACTACCACTTGAACCAGA- 3'.
The forward primer was complementary to nucleotides 12 to +11.
The reverse primer was complementary to nucleotides 1528-1548 encompassing the codons for Ser510 to Lys516.
This primer incorporated two in frame TAA termination codons adjacent
to the Lys516 codon. The plasmids were transformed into
S. cerevisiae strain INVSC2 (MAT his3- 200
ura3-167) using a modified lithium acetate method (23) and
selecting for Ura+ transformants. Phr1p and Phr2p were
expressed after transfer of a 24-h culture of strains pYES2
PHR2 and pYES2 PHR1 to a 2% galactose-based medium.
Enzymatic Analysis of Recombinant Proteins--
Culture
filtrates containing the recombinant truncated forms of Gas1p, Phr1p,
Phr2p, and Gel1p (all lacking the GPI-anchoring COOH terminus) were
stored at 20 °C. To assay the enzymatic activity, purification of
the recombinant proteins was necessary since endogenous 1,3- -glucanase and 1,3/1,6- -glucanosyltransferase activities (15,
24) were always secreted in the culture medium by the yeast
heterologous host. Although released in a low amount in comparison to
the recombinant protein of interest, their presence would interfere
with the determination of the activity since these contaminating
enzymes acted on the laminarioligosaccharide substrate or/and reaction
products (data not shown).
Gas1p535 and Gel1p419 were purified with the
same chromatographic procedure. After dialysis against a 10 mM Tris-HCl, pH 7, buffer, the culture filtrates were
applied to an anion exchange chromatography column of DEAE-5PW
(TosoHaas, 8 × 75 mm) equilibrated in the same buffer at a flow
rate of 0.7 ml/min. The recombinant proteins were eluted with NaCl
gradient (0-250 mM in 50 min and 250-500 mM
in 10 min). Phr1p and Phr2p were purified with two chromatographic steps as follows. After dialysis against 10 mM Tris-HCl, pH
7, buffer, the culture filtrates were applied to an anion exchange chromatography column of DEAE-Sepharose Fast Flow (2.4 × 12 cm; Amersham Pharmacia Biotech) equilibrated in the same buffer at a flow
rate of 20 ml/h. The recombinant proteins were eluted with a linear
gradient of NaCl (0-500 mM, 500 ml). Then fractions
containing Phr1p or Phr2p were applied to a gel filtration column of
Superdex S-75 (HiLoad 26/60, Amersham Pharmacia Biotech) equilibrated
in 10 mM Tris-HCl, pH 7, 200 mM NaCl at a flow
rate of 0.4 ml/min. 1,3- -Glucanosyltransferase activity was analyzed
as described previously (7). Briefly, the purified proteins were
incubated at the concentrations of 0.05-0.16 mg/ml with 3 mM reduced laminarioligosaccharide of various degrees of
polymerization (8 to 14) in a 50 mM acetate buffer, pH 5.5, at 37 °C. Sequential aliquots of 2.5 µl supplemented with 40 µl
of 50 mM NaOH were analyzed by HPAEC with a CarboPAC-PA1 column (Dionex 4.6 × 250 mm) as described previously (7).
1,3- -Glucanosyltransferase Activity of Membrane
Extracts--
To verify that the 1,3- -glucanosyltransferase
activity was indeed expressed in situ, membrane extracts
were prepared from C. albicans, A. fumigatus, and
S. cerevisiae. Cells were resuspended and disrupted in a 200 mM Tris-HCl, pH 8, buffer containing 50 mM EDTA, 5 mg/ml bovine serum albumin, and 1 mM
phenylmethylsulfonyl fluoride using an MSK (Braun) cell breaker as
described above. The membrane pellet, recovered after two successive
60-min 20,000 × g centrifugation steps, was stored at
80 °C in the same buffer. For the assay, total membrane extract
(0.5 mg of protein) was resuspended in 50 µl of 100 mM
sodium acetate, pH 5.5, buffer containing 0.2% octyl glucoside. 17 µl of membrane suspension were incubated with 2 µl of
deoxynojirimycin to inhibit exo-1,3- -glucanase and 3 µl of 20 mM rG13, at 37 °C for 0, 1, 3, 7 and 20 h. At each time 2.5 µl of mixture were taken, and the enzymatic reaction was
stopped with 40 µl of 50 mM NaOH, and products were
analyzed by HPAEC using a Carbo PAC PA1 column (Dionex 4.6 × 250 mm) as described previously (7).
 |
RESULTS |
Isolation and Sequence Analysis of the GEL1 Gene Encoding the
1,3- -Glucanosyltransferase Gel1p--
The amino acid sequences of
the NH2-terminal peptide and of one internal peptide
obtained from the 49-kDa polypeptide (p49) isolated from the cell wall
autolysate (7) were DDVTPITVKGNAFFKGDERFY and DAPNWDVDNDALPAI,
respectively, and were used to design two degenerated oligonucleotide
probes (probe A, AAGGGYAAYGCYTTCTTYAAGGGYGAYGAGCGYTTCTA (KGNAFFKGDERFY); probe B, TCRTTRTCDACRTCCCARTT (NWDVDND)). Screening of
a EMBL 3a genomic library of A. fumigatus with probe A
identified three positive clones. Restriction enzyme analysis of
purified bacteriophage DNA revealed that the three clones had a common 2.2-kb XbaI fragment that hybridized with both probes A and B.
The 2.2-kb genomic DNA fragment contained the entire open reading frame
of the GEL1 gene. The primers P1 (5' GACGACGTTACTCCCATCACT 3') and P2 (5' GGGTATGAGAAGAACAAATCA 3'), deduced from the genomic DNA
sequence, were used to clone the corresponding cDNA by PCR. Analysis of the sequences of the complementary and genomic DNA showed
that the gene was 1356 nucleotides long and contained an open reading
frame predicting a 452-residue polypeptide with a theoretical molecular
mass of 44 kDa (Fig. 1). GEL1
gene contained one intron of 60 base pairs starting before nucleotide
598.

View larger version (117K):
[in this window]
[in a new window]
|
Fig. 1.
Comparison of the predicted amino acid
sequences of Gel1p of A. fumigatus with Gas1p and
homologs in S. cerevisiae, Phr1p and Phr2p of C. albicans, Epd1p and Epd2p in C. maltosa,
and P78785 and O13692 in S. pombe. Identical residues are
indicated by boxes. The amino and carboxyl hydrophobic termini
of Gel1p are underlined. The putative cleavage site of
secretory signal sequence and the putative GPI attachment site are
indicated by an arrow. The three potential
N-glycosylation sites of Gel1p are indicated by an
asterisk. The peptide sequence used as probe to screen the
genomic library is underlined.
|
|
FASTA and BLAST searches of the GenBankTM and EMBL data
banks showed significant homologies of Gel1p with a family of
GPI-anchored proteins (Gas1p to Gas5p of S. cerevisiae,
Phr1p and Phr2p of C. albicans, and Epd1p and Epd2p of
Candida maltosa (with 37, 34, 37, 49, 37, 36, 38, 33, and
35% identity, respectively)) playing a role in yeast morphogenesis
(8-13, 25, 26) and with two uncharacterized sequences of
Schizosaccharomyces pombe found in data base (P78785 and
O13692 with 45 and 35% identity, respectively) (Fig. 1). Gel1p was
shorter than the other proteins, and the highest homology was seen in
the first 325 amino acids. The position of the first 6 of the 13 cysteines was conserved between Gel1p and all the other homologous
yeast proteins. Several significant features are conserved among all
these proteins as follows: (i) a hydrophobic amino terminus
characteristic of secretory signal sequences, (ii) several putative
N-glycosylation sites, (iii) a COOH-terminal region rich in
serine residues that are potential sites for
O-glycosylation, and (iv) a hydrophobic carboxyl terminus
characteristic of GPI-anchored proteins.
The predicted protein Gel1p had both hydrophobic amino and carboxyl
termini, 17 and 26 amino acids long, respectively. The signal peptidase
cleavage site according to the ( 3, 1) rule (27) was
Ala19 for Gel1p, and the , + 1, and + 2 site for
GPI attachment based on the consensus predicted cleavage of GPI anchor
(28, 29) was Gly418, Ala419, and
Ala420 (Fig. 1). Three potential consensus
N-glycosylation sites were found located at amino acid
residues 249, 329, and 337, in agreement with previously published
biochemical data showing that Gel1p was N-glycosylated
(7).
RT-PCR data and Western blot analysis showed that Gel1p is
constitutively expressed, during exponential and linear growth (up to
48 h in our culture conditions). In addition, in contrast to
PHR, the expression of GEL is not pH-regulated
since a similar expression level was seen at pH 4 and 8 (data not shown).
Biochemical Data Confirmed That Gel1p Is
GPI-anchored--
Antisera were directed either against the entire p49
or one of its immunogenic peptides, labeled by Western blot, a protein with an apparent mass of 54 kDa in a membrane extract (data not shown).
Gel1p was recovered in the Triton X-114 fraction of a membrane extract
indicating that it was an integral membrane protein. Incubation of this
extract with commercial GPI-PLC resulted in the recovery of Gel1p in
the aqueous phase (Fig. 2A).
This band was also positive with the anti-CRD antibody which is
specific for a cyclic phosphate formed after the cleavage of the GPI
anchor by GPI-PLC (data not shown). All attempts to radiolabel Gel1p using [14C]inositol or [14C]ethanolamine
have failed thus preventing the biochemical isolation of the peptide
tail bound to GPI (data not shown). To get further confirmation on the
GPI-anchoring of Gel1p and particularly to identify the sites for
GPI-attachment, GEL1 (Gel1p452) and a truncated
form of GEL1 lacking the carboxyl terminus
(Gel1p419) were expressed in P. pastoris.
Western blot analysis using anti-Gel1p antibodies showed that (i)
Gel1p419 was recovered in the culture filtrate and (ii)
Gel1p452 was found in the Triton X-114 fraction of a
membrane extract from P. pastoris (Fig. 2B).
Treatment of this detergent extract with GPI-PLC resulted in the
release of Gel1p452 in the aqueous phase (Fig.
2B) associated to a CRD positivity of the GPI-PLC cleaved
rGel1p452 (data not shown). All together, these data showed
that Gel1p was bound to the membrane through a GPI anchor and suggested
that Gly418 was the amino acid responsible for GPI
attachment. These data were in agreement with the predictions obtained
from the amino acid sequence analysis.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 2.
Solubilization of membrane-bound Gel1p by
GPI-PLC. A, aqueous upper phase (A) and
detergent lower phase (D) after Triton X-114 partition of
GPI-PLC treated (+) or control ( ); immunolabeling with anti-Gel1p
antibody. B, Western blot of a Triton X-114 extract of a
membrane fraction of P. pastoris which expresses
Gel1p452 (with GPI-anchor) or Gel1p419 (without
GPI-anchor) in aqueous upper phase (A) and in detergent
lower phase (D) immunolabeled with anti-Gel1p antibody.
1st and 2nd lanes, Gel1p419;
3rd and 4th lanes,
Gel1p452; and 5th and 6th lanes,
Gel1p452 treated by GPI-PLC.
|
|
Gel1p either in its membrane-bound or GPI-PLC-cleaved forms migrated at
a slightly higher mass (54 kDa) than the p49 hydrophilic polypeptide
isolated originally from a cell wall autolysate (7). According to
sequence data, the signal peptidase cleavage site should occur after
the Ala19, whereas the NH2-terminal amino acid
identified in the biochemically purified p49 polypeptide was
Asp27. The exact identity of the NH2-terminal
sequence of the Gel1p was investigated with the strain of P. pastoris expressing Gel1p419. The coding region of the
GEL1 gene that was integrated in P. pastoris
started at nucleotide 49 corresponding to Val17. The
NH2-terminal amino acid sequence of the recombinant
secreted Gel1p obtained was APS. This result confirmed that the signal peptide of Gel1p was indeed composed of 19 amino acids with the NH2-terminal amino acid of the mature Gel1p being
Ala20 (Fig. 1). The loss of the NH2-terminal
peptide APSIKAR from the native protein resulted from a proteolytic
degradation. In addition, p49 reacted negatively with the anti-CRD
antibody suggesting that a peptide cleavage of Gel1p has also occurred
at the COOH terminus during autolysis. p49 is a hydrophilic, C- and
N-truncated form of Gel1p. Peptide cleavage may result from proteolytic
degradation occurring during the biochemical purification of the
protein but may also be an alternative for the differential regulation
of Gel1p anchoring to the membrane.
Gas1p, Phr1p, and Phr2p Share the Same Enzymatic Activity as
Gel1p--
The sequence homologies between Gel1p, Gas1p, Phr1p, and
Phr2p suggested that all these proteins shared the same biochemical function. Identification of the conserved regions in the sequences of
the homologous proteins and the previous discovery of the
glucanosyltransferase activity in a truncated hydrophilic Gel1p
polypeptide suggested that the COOH and NH2 termini were
not essential for the enzymatic activity. For this reason, the putative
enzymatic activity of the Gas1p, Phr1p, and Phr2p was compared with the
one of Gel1p using recombinant proteins expressed without a GPI
attachment signal (Gel1p419) and was therefore secreted in
the medium. These proteins were purified as polypeptides with mass of
60, 76, 94, and 125 kDa for Gel1p, Phr1p, Phr2p, and Gas1p,
respectively (Fig. 3).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 3.
SDS-polyacrylamide gel electrophoresis of
recombinant proteins Gel1p, Gas1p, Phr1p, and Phr2p stained with
Coomassie Blue as described by Neuhoff et al.
(41). The mass of each recombinant protein is indicated on
the right.
|
|
Analysis by HPAEC of the product resulting from the incubation of
recombinant proteins with reduced laminaritridecaose is shown in Fig.
4. Fig. 4A shows the enzymatic
kinetics obtained with the recombinant Gel1p. After 1 h
incubation, major initial products were rG6, rG7, rG8, rG18, rG19, and
rG20 in agreement with the two-step reaction scheme previously
described by Hartland et al. (7) (E + rG13 E.G5 + rG8 + E.G6 + rG7 + E.G7 + rG6; E.G5 + E.G6 + E.G7 + rG13 E + rG18 + rG19 + rG20) (E corresponds to the enzyme Gel1p, and the
oligosaccharides in bold are the reaction products). HPAEC data
indicated that all products contained only 1,3- linkages since the
introduction of a linkage different from the 1,3- -glucosidic linkage
will result in a shift in the retention time of the branched oligosaccharide (15, 30). Longer incubation time (8-20 h) with a 3 mM substrate concentration resulted in the production of a
range of oligosaccharides with a degree of polymerization from 5 to 40 (Fig. 4A). The complex HPAEC pattern seen with prolonged incubation showed that the initial transferase products can be reused
subsequently either as donors or acceptors resulting in a wide range of
transfer products with increasing size (degree of polymerization >30)
until they become alkali-insoluble. Analysis of the products resulting
from the incubation of recombinant protein Gas1p, Phr1p, and Phr2p with
reduced laminaritridecaose showed an HPAEC pattern identical to the one
obtained with the recombinant protein Gel1p, characterized by the sole
presence of laminarioligosaccharides (Fig. 4B).
Consequently, Gas1p, Phr1p, and Phr2p displayed a
1,3- -glucanosyltransferase activity similar to the one characterized
for Gel1p.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4.
HPAEC analysis of products from the
incubation of the recombinant Gel1p, Gas1p, Phr1p, and Phr2p with
reduced laminarioligosaccharides. 3, 3, 1, and 2 µg of
respective purified recombinant proteins were incubated with 3 mM reduced laminarioligosaccharide containing 13 glucose
units (rG13) in 20 µl of 50 mM
NaOAc, pH 5.5, at 37 °C. A 2.5-µl aliquot supplemented with 40 µl of 50 mM NaOH was analyzed by high pressure liquid
chromatography with a CarboPAC PA-1 column and a pulsed electrochemical
detector. A, analysis of product after 0, 1, 8, and 20 h of incubation with Gel1p. B, analysis of products obtained
with Gas1p, Phr1p, and Phr2p (T0 identical to
A).
|
|
To determine the minimal size of the oligosaccharide used in the
transfer reaction, which promotes the release of one oligosaccharide from the reducing end and the production of an unique transfer product,
recombinant proteins were incubated with laminarioligosaccharides of
different size. The minimum size of the laminarioligosaccharide recognized by the enzyme-binding site varied slightly with the protein;
it was 10, 9, 10, and 11 glucose units for Gas1p, Phr1p, Phr2p, and
Gel1p, respectively (data not shown).
Gelp and Homologous Yeast Proteins Are Functional in Vivo--
A
similar 1,3- -glucanosyltransferase activity has been demonstrated
for recombinant GPI-truncated Gel, Gas, and Phr proteins. It was then
essential to verify that the native GPI-anchored proteins were
functional. For this purpose, membrane extracts were incubated with
reduced laminarioligosaccharide (G13 and G14). HPAEC analysis showed that membrane extracts displayed a 1,3- -glucanosyltransferase activity. This activity was detected with membrane extracts from A. fumigatus, C. albicans, and S. cerevisiae (data not shown).
To gain further insight on the functionality of Gel1p in
vivo, the GEL1 cDNA was expressed in a
gas1 strain (WB2d) of S. cerevisiae. A major
band of about 62 kDa was detected by anti-Gel1p antiserum in total
extracts of yeast clones transformed with GEL1 under the
control of the GAS1 promoter (Fig.
5A). The absence of this band
in the gas1 strain indicated that the 62-kDa polypeptide corresponded to the GEL1 gene product. The lower mobility of
the recombinant protein compared with the native A. fumigatus Gel1p (54 kDa) suggested a higher degree of
mannosylation of the protein expressed in S. cerevisiae. A
similar modification was seen when Gel1p was expressed in P. pastoris (Fig. 2B). A null mutation in the
GAS1 gene caused several morphogenetic defects as follows: cells had an abnormal morphology, became round and larger, and were
defective in bud maturation and cell separation, assuming a clumped
aspect in stationary phase. The cells were more sensitive to Calcofluor
White and were more resistant to zymolyase (9). GEL1 was
able to rescue the morphological defects of the mutant gas1; upon microscopic analysis, transformed cells showed
a normal ellipsoidal shape, and in stationary phase very few clumped
cells were detected (data not shown). As shown in Fig. 5B,
GEL1 almost completely abolished the gas1
hypersensitivity to growth in the presence of Calcofluor White.
Complementation of the gas1 mutant by GEL1
resulted in a decrease of fluorescence consecutive to Calcofluor White
staining (data not shown), suggesting a decrease in the amount of
chitin brought about by the lack of Gas1p (31). To confirm this
observation, the chitin level in exponentially growing cells has been
quantified in the zymolyase-undigestible pellet of the alkali-insoluble
fraction. In gas1 cells harboring GEL1
cDNA, the level of glucosamine reached 1.4% (w/w of the pellet) indicating a reduction of the increase of chitin from 7 to ~3-fold with respect to gas1 control cells. In addition, the
ratio of total hexose concentration of the
alkali-soluble/alkali-insoluble fractions was reduced in the WB2d
strain harboring GEL1 cDNA in a trend similar to the
WB2d strain complemented with the GAS1 gene (data not
shown). Another phenotypic trait that was considered has been the
sensitivity of intact cells to zymolyase treatment. After 45 min of
incubation at 30 °C with zymolyase 100T (12.5 units/ml),
gas1 cells were almost completely resistant to the enzyme, as previously reported (9). The wild-type strain was very
sensitive with a 85% decrease in A660 nm,
whereas the cells expressing Gel1p showed a high (although
intermediate) sensitivity with a 60% decrease. Altogether, these data
indicate that Gel1p significantly reduced both the defects of
gas1 mutant and the compensatory responses induced by the
lack of Gas1p in S. cerevisiae, confirming that Gel1p is
functional in S. cerevisiae and that these two proteins
display similar enzymatic function both in vivo and in
vitro.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 5.
A, immunoblot analysis of S. cerevisiae extracts. Total extracts from exponentially growing
cells of WB2d (YEp) strain (lane a) and of WB2d
(YEp-ScGEL1) (lanes b) were analyzed by
immunoblotting with anti-Gel1p antibodies. The same amount of proteins
was loaded on each lane. B, sensitivity to Calcofluor White.
At a cell density of 5 × 106/ml, 5 µl of a
concentrated suspension of cells (lane 1), and of
10× (lane 2), 100× (lane
3), 1,000× (lane 4), and 10,000×
(lane 5) dilution was spotted on standard minimal
plates and minimal medium plates supplemented (CF) or not
(no CF) with 50 µg/ml Calcofluor White.
|
|
 |
DISCUSSION |
GEL1, which encodes a 1,3- -glucanosyltransferase previously
identified in A. fumigatus (7), is homologous to
GAS/PHR/EPD genes encoding a family of GPI-anchored proteins
required for correct morphogenesis in yeast. In Candida,
PHR and EPD are involved in conducting apical
growth since null mutants are affected in the formation of germ tubes
or pseudo-hyphal growth (12, 13, 25). Their biochemical function was
unknown until this study. We have now demonstrated that Gel1p, Phr1p,
Phr2p, and Gas1p display the same 1,3- -glucanosyltransferase
activity responsible for elongation of 1,3- -glucans. In addition,
complementation experiments have shown that the genes of these
different families encode structurally and functionally related
proteins as follows. (i) PHR1 and GEL1 can
complement gas1 mutation in S. cerevisiae
(Ref. 18 and this study). (ii) Engineered expression of PHR1
in a phr2 mutant strain and PHR2 in
phr1 mutant strain complement the defects in the opposing
mutant (12). These complementation studies have also confirmed the
absence of a functional role of the COOH-terminal serine/threonine
stretch and O-glycosylation in the enzymatic activity, as it
was already shown for Gas1p (22).
Although their enzymatic activity is common, the regulation of the
expression of the different encoding genes can be under the control of
different signals. In Candida, the pH and the nutritional composition of the culture medium play a major role (12, 13, 25). In
C. albicans, a differential role of the pH was not due to a
different pH optimum of the enzymatic activity of Phr1p and Phr2p since
both recombinant proteins presented an acidic pH optimum (around 5) and
both were inactive at pH 7.5 after 8 h incubation (data not
shown). In S. cerevisiae and in A. fumigatus,
expression of GAS1 and GEL1 seems constitutive
(Refs. 10, 32, and this study).
In S. cerevisiae, gas1 mutant has a reduced
growth rate that becomes more severe at neutral pH and is characterized
by a high percentage of budded cells at stationary phase. Several
biochemical arguments indicate that the organization of the cell wall
is altered including the following: (i) a decrease in the glucan
content and a modification of its structure suggested by differences in the ratio of 1,3/1,6- -glucan linkages and alkali solubility of cell
wall fractions; (ii) a release of 1,3- -glucan and/or
-glucosylated cell wall proteins in the culture medium; (iii) an
increase of chitin level; (iv) an increased incorporation of cell wall
mannoproteins, specifically of Cwp1p, which become cross-linked to
chitin instead of glucans (31, 33).
In C. albicans, deletion of PHR genes resulted in
pH-conditional defects in growth, morphogenesis, and virulence (12, 13, 34). PHR1 is expressed at neutral to alkaline pH. At
alkaline pH, the phr1 mutant is not able to conduct
apical growth of either yeast or hyphal growth forms. Cells become
larger and rounder, a phenotype reminiscent of the gas1
mutant. It was shown that the phenotypic defects of the mutants were
not associated with defective cytoskeletal polarization or secretion,
suggesting that PHR1 was involved in cell wall organization
(13). Cell wall analysis of the phr1 mutant showed a
doubling in the ratio between the alkali-soluble and -insoluble
glucans, an increase in the chitin level, and a substantial reduction
in 1,6- -glucan (35). As the gas1 mutant,
phr1 mutant is hypersensitive to Calcofluor White and to
Nikkomycin Z.
In contrast to PHR1, PHR2 is only expressed at
acidic pH ( 5) (12). A phr2 mutant manifests
pH-conditional defects in growth analogous to those of a
PHR1 mutation but at acidic pH rather than alkaline pH
values. The mutant exhibits reduced growth at pH 6. Arrest of growth is
associated with an isotropic enlargement of the cells and altered bud
morphology, but yeast remains viable at the restrictive pH. Analysis of
the cell wall has not been performed for phr2 mutant.
In C. maltosa, a epd1 mutant showed a reduced
growth rate at pH 4 with morphological defects of the cells (large and
round yeast with multiple buds) similar to gas1 mutant
(9, 25). At pH 7, no morphological differences were noted. Transition
of yeast to pseudohyphal growth was abolished in the epd1
mutant at pH 4 but not at pH 7. This pattern is somehow reminiscent of phr2 mutant except that epd1 mutant grows
at pH 4, whereas phr2 does not. The cell wall of the
epd1 mutant is characterized by an increase in chitin and
a decrease in 1,6- -glucans. However, in contrast to
phr1 and gas1 cells, the levels of both
alkali-soluble and alkali-insoluble glucan fractions were reduced
(25).
Recent data obtained in the chemical characterization of the structural
polysaccharides of the cell wall of A. fumigatus3 and previous
studies on the cell wall of S. cerevisiae (37, 38) suggested
that the chronological events involved in the synthesis and
postsynthetic modifications of the cell wall 1,3- -glucans are as
follows: (i) biosynthesis of linear 1,3- -glucans; (ii) branching of
1,3- -glucans through 1,6- linkages; (iii) elongation of
1,3- -glucan side chains; and (iv) cross-linking of other polymers (chitin and galactomannan in A. fumigatus or chitin and
1,6- -glucan and proteins in S. cerevisiae) onto the
non-reducing ends of 1,3- -glucan side chains (Fig.
6).

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 6.
Chronological events involved in the
synthesis and postsynthetic modifications of the cell wall
1,3- -glucans. (i) Biosynthesis
of linear 1,3- -glucans; (ii) branching of 1,3- -glucans
through 1,6- linkages; (iii) elongation of 1,3- -glucan
side chains; and (iv) cross-linking of other polymers
(chitin and galactomannan in A. fumigatus, or chitin,
1,6- -glucan, and proteins in S. cerevisiae) onto
non-reducing ends of 1,3- -glucan side chains. P,
proteins.
|
|
Our working hypothesis for the biological function of Gelp, Gasp, and
Phrp is that the 1,3- -glucanosyltransferase is involved in the
elongation of 1,3- -glucan side chains (step iii in the biosynthetic
pathway). By doing so, it would increase the number of 1,3- -glucan
side chains with free non-reducing ends available for cross-linking
with other polysaccharides. Based on this model, mutation in the
encoding gene(s) in yeast would induce perturbations in the
cross-linking events in the cell wall as follows: (i) the reduction of
the 1,3- -glucan and 1,6- -glucan concentration in the
alkali-insoluble fraction leading to an increase in the ratio of
alkali-soluble to alkali-insoluble glucans; (ii) the secretion in the
culture medium of -glucan and glycoproteins normally covalently bound to the branched polysaccharide core of the cell wall. These events have been observed in gas and phr
mutants. Increases of the chitin level and its cross-linking to
1,6- -glycosylated mannoproteins also seen in these mutants are
expected to be due to a set of compensatory reactions to palliate the
cell wall defect due to the mutation. Such compensatory changes seem
common in cell wall (33, 39).
Another putative function for GEL/GAS/PHR could be a role in
cell expansion since null yeast mutants showed altered polarized growth. Hydrolysis of the existing cell wall structure is obviously required for hyphal branching, conidial germination, or yeast buddings
and the way the fungal cell wall is plasticized remains to date a
mystery. Indeed, all null 1,3- -glucanase mutants obtained up to date
do not have a phenotype
(40).4 The
glucanosyltransferase activity could be responsible for such modifications in the cell wall and be responsible for an equilibrium between hydrolysis of cell wall polymers and elongation of existing polymers allowing for an apical growth.
This study emphasized the role of GPI-anchored proteins in cell wall
morphogenesis. A dual function has been now established for these
proteins: some members of this family (such as Gel1p, Gas1p, Phr1p, and
Phr2p) have a 1,3- -glucanosyltransferase activity responsible for
the modification of the existing polymers of the cell wall, whereas
others, such as Krep, are involved in the de novo synthesis
of new polymers. Some GPI-anchored proteins without known enzymatic
function (like Ag 1, Cwp1p, or Cwp2p) are covalently incorporated to
the cell wall after cleavage of the GPI anchor and become part of
three-dimensional network composed by cell wall polymers (36, 42,
43).
 |
ACKNOWLEDGEMENT |
We thank J. d'Alayer for performing the amino
acid sequencing.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF072700.
§
To whom correspondence should be addressed: Laboratoire des
Aspergillus, 25 Rue du Docteur Roux, 75724 Paris Cedex 15, France. Tel.: (33) 0145688225; Fax: (33) 0140613419; E-mail: imouyna@ pasteur.fr.
Supported in part by MURST-Università degli Studi di
Milano Cofin 1997 and by Murst.
1
A. Beauvais, unpublished observations.
3
Fontaine, T., C. Simenel, G. Dubreucq, O. Adam,
M. Delepierre, J. Lemoine, C. E. Vorgias, M. Diaquin, and J. P. Latgé (2000) J. Biol. Chem., in press.
4
I. Mouyna, T. Fontaine, B. Henrissat, J. Sarfati, and J. P. Latgé, submitted for publication.
 |
ABBREVIATIONS |
The abbreviations used are:
GPI, glycosylphosphatidylinositol;
PLC, phospholipase C;
PCR, polymerase
chain reaction;
RT-PCR, reverse transcription-PCR;
kb, kilobase pair;
CRD, cross-reactive determinant;
HPAEC, high performance anion exchange
chromatography.
 |
REFERENCES |
| 1.
|
Hearn, V. M.,
and Sietsma, J. H.
(1994)
Microbiology
140,
789-795[Abstract/Free Full Text]
|
| 2.
|
Latgé, J. P.,
Debeaupuis, J. P.,
Moutaouakil, M.,
Diaquin, M.,
Sarfati, J.,
Prevost, M. C.,
Wieruszeski, J. M.,
Leroy, Y.,
and Fournet, B.
(1991)
NATO ASI Ser.
53,
143-151
|
| 3.
|
Fontaine, T.,
Mouyna, I.,
Hartland, R. P.,
Paris, S.,
and Latgé, J. P.
(1997)
Biochem. Soc. Trans.
25,
194-199[Medline]
[Order article via Infotrieve]
|
| 4.
|
Beauvais, A.,
Drake, R.,
Ng, K.,
Diaquin, M.,
and Latgé, J. P.
(1993)
J. Gen. Microbiol.
139,
3071-3078[Abstract/Free Full Text]
|
| 5.
|
Klis, F. M.
(1994)
Yeast
10,
851-869[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Kelly, R.,
Register, E.,
Hsu, M. J.,
Kurtz, M.,
and Nielsen, J.
(1996)
J. Bacteriol.
178,
4381-4391[Abstract/Free Full Text]
|
| 7.
|
Hartland, R. P.,
Fontaine, T.,
Debeaupuis, J.-P.,
Simenel, C.,
Delepierre, M.,
and Latgé, J.-P.
(1996)
J. Biol. Chem.
271,
26843-26849[Abstract/Free Full Text]
|
| 8.
|
Nuoffer, C.,
Jeno, P.,
Conzelmann, A.,
Horvath, A.,
and Riezman, H.
(1991)
Mol. Cell. Biol.
11,
27-37[Abstract/Free Full Text]
|
| 9.
|
Popolo, L.,
Vai, M.,
Gatti, E.,
Porello, S.,
Bonfante, P.,
Balestrini, R.,
and Alberghina, L.
(1993)
J. Bacteriol.
175,
1879-1885[Abstract/Free Full Text]
|
| 10.
|
Ram, A. F. J.,
Brekelmans, S. S. C.,
Oehlen, L. J. W. M.,
and Klis, F. M.
(1995)
FEBS Lett.
358,
165-170[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Vai, M.,
Gatti, E.,
Lacana, E.,
Popolo, L.,
and Alberghina, L.
(1991)
J. Biol. Chem.
266,
12242-12248[Abstract/Free Full Text]
|
| 12.
|
Muhlschlegel, F. A.,
and Fonzi, W. A.
(1997)
Mol. Cell. Biol.
17,
5960-5967[Abstract]
|
| 13.
|
Saporito-Irwin, S. M.,
Birse, C. E.,
Sypherd, P. S.,
and Fonzi, W. A.
(1995)
Mol. Cell. Biol.
15,
601-613[Abstract]
|
| 14.
|
San Segundo, P.,
Correa, J.,
Vazquez de Aldana, C. R.,
and del Rey, F.
(1993)
J. Bacteriol.
175,
3823-3837[Abstract/Free Full Text]
|
| 15.
|
Mouyna, I.,
Hartland, R. P.,
Fontaine, T.,
Diaquin, M.,
Simenel, C.,
Delepierre, M.,
Henrissat, B.,
and Latgé, J. P.
(1998)
Microbiology
144,
3171-3180[Abstract/Free Full Text]
|
| 16.
|
Fidel, S.,
Doonan, J. H.,
and Morris, N. R.
(1988)
Gene (Amst.)
70,
283-293[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Hill, J.,
Jan, K. A.,
Donald, G.,
and Griffiths, E.
(1991)
Nucleic Acids Res.
19,
5791[Free Full Text]
|
| 18.
|
Vai, M.,
Orlandi, I.,
Cavadini, P.,
Alberghina, L.,
and Popolo, L.
(1996)
Yeast
12,
361-368[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Borg-von Zepelin, M.,
Beggah, S.,
Boggian, K.,
Sanglard, D.,
and Monod, M.
(1998)
Mol. Microbiol.
28,
543-554[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Bordier, C.
(1981)
J. Biol. Chem.
256,
1604-1607[Abstract/Free Full Text]
|
| 21.
|
Towbin, H.,
Staehelin, T.,
and Gordon, J.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
4350-4354[Abstract/Free Full Text]
|
| 22.
|
Gatti, E.,
Popolo, L.,
Vai, M.,
Rota, N.,
and Alberghina, L.
(1994)
J. Biol. Chem.
269,
19695-19700[Abstract/Free Full Text]
|
| 23.
|
Gietz, D.,
St. Jean, A.,
Woods, R. A.,
and Schiestl, R. H.
(1992)
Nucleic Acids Res.
20,
1425[Free Full Text]
|
| 24.
|
Goldman, R. C.,
Sullivan, P. A.,
Zakula, D.,
and Capobianco, J. O.
(1995)
Eur. J. Biochem.
227,
372-378[Medline]
[Order article via Infotrieve]
|
| 25.
|
Nakazawa, T.,
Horiuchi, H.,
Ohta, A.,
and Takagi, M.
(1998)
J. Bacteriol.
180,
2079-2086[Abstract/Free Full Text]
|
| 26.
|
Vai, M.,
Popolo, L.,
Grandori, E.,
Lacana, E.,
and Alberghina, L.
(1990)
Biochim. Biophys. Acta
1038,
277-285[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Von Heijne, G.
(1986)
Nucleic Acids Res.
14,
4683-4690[Abstract/Free Full Text]
|
| 28.
|
Gerber, L. D.,
Kodukula, K.,
and Udenfriend, S.
(1992)
J. Biol. Chem.
267,
12168-12173[Abstract/Free Full Text]
|
| 29.
|
Nuoffer, C.,
Horvath, A.,
and Riezman, H.
(1993)
J. Biol. Chem.
268,
10558-10563[Abstract/Free Full Text]
|
| 30.
|
Koizumi, K.,
Kubota, Y.,
Tanimoto, T.,
and Okada, Y.
(1989)
J. Chromatogr.
464,
365-373[Medline]
[Order article via Infotrieve]
|
| 31.
|
Popolo, L.,
Gilardelli, D.,
Bonfante, P.,
and Vai, M.
(1997)
J. Bacteriol.
179,
463-469[Abstract/Free Full Text]
|
| 32.
|
Popolo, L.,
Cavadini, P.,
Vai, M.,
and Alberghina, L.
(1993)
Curr. Genet.
24,
382-387[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Ram, A. F. J.,
Kapteyn, J. C.,
Montijn, R. C.,
Caro, H. P.,
Douwes, J. E.,
Baginsky, W.,
Mazur, P.,
Van den Ende, H.,
and Klis, F. M.
(1998)
J. Bacteriol.
180,
1418-1424[Abstract/Free Full Text]
|
| 34.
|
Ghannoum, M. A.,
Spellberg, B.,
Saporito-Irwin, S. M.,
and Fonzi, W. A.
(1995)
Infect. Immun.
63,
4528-4530[Abstract]
|
| 35.
|
Popolo, L.,
and Vai, M.
(1998)
J. Bacteriol.
180,
163-166[Abstract/Free Full Text]
|
| 36.
|
Van der Vaart, J. M.,
van Schagen, F. S.,
Mooren, A. T. A.,
Chapman, J. W.,
Klis, F. M.,
and Verrips, C. T.
(1996)
Biochim. Biophys. Acta
1291,
206-214[Medline]
[Order article via Infotrieve]
|
| 37.
|
Kollar, R.,
Petrakova, E.,
Ashwell, G.,
Robbins, P. W.,
and Cabib, E.
(1995)
J. Biol. Chem.
270,
1170-1178[Abstract/Free Full Text]
|
| 38.
|
Kollar, R.,
Reinhold, B. B.,
Petrakova, E.,
Yeh, H. J. C.,
Ashwell, G.,
Drgonova, J.,
Kapteyn, J. C.,
Klis, F. M.,
and Cabib, E.
(1997)
J. Biol. Chem.
272,
17762-17775[Abstract/Free Full Text]
|
| 39.
|
Kapteyn, J. C.,
Ram, A. F. M.,
Groos, E. M.,
Kollar, R.,
Montijn, R. C.,
Van den Ende, H.,
Llobell, A.,
and Klis, F. M.
(1997)
J. Bacteriol.
179,
6279-6284[Abstract/Free Full Text]
|
| 40.
|
Larriba, G.,
Andaluz, E.,
Cueva, R.,
and Basco, R. D.
(1995)
FEMS Microbiol. Lett.
125,
121-126[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Neuhoff, V.,
Stamm, R.,
and Eibl, H.
(1985)
Electrophoresis
6,
427-448[CrossRef]
|
| 42.
|
Lu, C. F.,
Montijn, R. C.,
Brown, J. L.,
Klis, F. M.,
Kurjan, J.,
Bussey, H.,
and Lipke, P. N.
(1995)
J. Cell Biol.
128,
333-340[Abstract/Free Full Text]
|
| 43.
|
Van der Vaart, J. M.,
Caro, L. H. P.,
Chapman, J. W.,
Klis, F. M.,
and Verrips, C. T.
(1995)
J. Bacteriol.
177,
3104-3110[Abstract/Free Full Text]
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Zhang, D. Feng, W. Fang, H. Ouyang, Y. Luo, T. Du, and C. Jin
Comparative proteomic analysis of an Aspergillus fumigatus mutant deficient in glucosidase I (AfCwh41)
Microbiology,
July 1, 2009;
155(7):
2157 - 2167.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Hurtado-Guerrero, A. W. Schuttelkopf, I. Mouyna, A. F. M. Ibrahim, S. Shepherd, T. Fontaine, J.-P. Latge, and D. M. F. van Aalten
Molecular Mechanisms of Yeast Cell Wall Glucan Remodeling
J. Biol. Chem.,
March 27, 2009;
284(13):
8461 - 8469.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Cabib, V. Farkas, O. Kosik, N. Blanco, J. Arroyo, and P. McPhie
Assembly of the Yeast Cell Wall: Crh1p AND Crh2p ACT AS TRANSGLYCOSYLASES IN VIVO AND IN VITRO
J. Biol. Chem.,
October 31, 2008;
283(44):
29859 - 29872.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. L. Chaffin
Candida albicans Cell Wall Proteins
Microbiol. Mol. Biol. Rev.,
September 1, 2008;
72(3):
495 - 544.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jiang, H. Ouyang, H. Zhou, and C. Jin
GDP-mannose pyrophosphorylase is essential for cell wall integrity, morphogenesis and viability of Aspergillus fumigatus
Microbiology,
September 1, 2008;
154(9):
2730 - 2739.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Hirayama, M. Fujita, T. Yoko-o, and Y. Jigami
O-Mannosylation is Required for Degradation of the Endoplasmic Reticulum-associated Degradation Substrate Gas1*p via the Ubiquitin/Proteasome Pathway in Saccharomyces cerevisiae
J. Biochem.,
April 1, 2008;
143(4):
555 - 567.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Kim, M. P. Nandakumar, and M. R. Marten
The state of proteome profiling in the fungal genus Aspergillus
Brief Funct Genomic Proteomic,
March 1, 2008;
7(2):
87 - 94.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. S. Sagaram, B. D. Shaw, and W.-B. Shim
Fusarium verticillioides GAP1, a gene encoding a putative glycolipid-anchored surface protein, participates in conidiation and cell wall structure but not virulence
Microbiology,
September 1, 2007;
153(9):
2850 - 2861.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. van der Kaaij, X.-L. Yuan, A. Franken, A. F. J. Ram, P. J. Punt, M. J. E. C. van der Maarel, and L. Dijkhuizen
Two Novel, Putatively Cell Wall-Associated and Glycosylphosphatidylinositol-Anchored {alpha}-Glucanotransferase Enzymes of Aspergillus niger
Eukaryot. Cell,
July 1, 2007;
6(7):
1178 - 1188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Dranginis, J. M. Rauceo, J. E. Coronado, and P. N. Lipke
A Biochemical Guide to Yeast Adhesins: Glycoproteins for Social and Antisocial Occasions
Microbiol. Mol. Biol. Rev.,
June 1, 2007;
71(2):
282 - 294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Ragni, A. Coluccio, E. Rolli, J. M. Rodriguez-Pena, G. Colasante, J. Arroyo, A. M. Neiman, and L. Popolo
GAS2 and GAS4, a Pair of Developmentally Regulated Genes Required for Spore Wall Assembly in Saccharomyces cerevisiae
Eukaryot. Cell,
February 1, 2007;
6(2):
302 - 316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Pardini, P. W. J. De Groot, A. T. Coste, M. Karababa, F. M. Klis, C. G. de Koster, and D. Sanglard
The CRH Family Coding for Cell Wall Glycosylphosphatidylinositol Proteins with a Predicted Transglycosidase Domain Affects Cell Wall Organization and Virulence of Candida albicans
J. Biol. Chem.,
December 29, 2006;
281(52):
40399 - 40411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Varelas, D. Stuart, M. J. Ellison, and C. Ptak
The Cdc34/SCF Ubiquitination Complex Mediates Saccharomyces cerevisiae Cell Wall Integrity
Genetics,
December 1, 2006;
174(4):
1825 - 1839.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-W. Liu, S.-W. Lee, and F.-J. S. Lee
Arl1p is involved in transport of the GPI-anchored protein Gas1p from the late Golgi to the plasma membrane
J. Cell Sci.,
September 15, 2006;
119(18):
3845 - 3855.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Lesage and H. Bussey
Cell Wall Assembly in Saccharomyces cerevisiae
Microbiol. Mol. Biol. Rev.,
June 1, 2006;
70(2):
317 - 343.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Chabane, J. Sarfati, O. Ibrahim-Granet, C. Du, C. Schmidt, I. Mouyna, M.-C. Prevost, R. Calderone, and J.-P. Latge
Glycosylphosphatidylinositol-Anchored Ecm33p Influences Conidial Cell Wall Biosynthesis in Aspergillus fumigatus.
Appl. Envir. Microbiol.,
May 1, 2006;
72(5):
3259 - 3267.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Castrejon, A. Gomez, M. Sanz, A. Duran, and C. Roncero
The RIM101 Pathway Contributes to Yeast Cell Wall Assembly and Its Function Becomes Essential in the Absence of Mitogen-Activated Protein Kinase Slt2p
Eukaryot. Cell,
March 1, 2006;
5(3):
507 - 517.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Bowman, A. Piwowar, M. Al Dabbous, J. Vierula, and S. J. Free
Mutational Analysis of the Glycosylphosphatidylinositol (GPI) Anchor Pathway Demonstrates that GPI-Anchored Proteins Are Required for Cell Wall Biogenesis and Normal Hyphal Growth in Neurospora crassa
Eukaryot. Cell,
March 1, 2006;
5(3):
587 - 600.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Slattery, D. Liko, and W. Heideman
The Function and Properties of the Azf1 Transcriptional Regulator Change with Growth Conditions in Saccharomyces cerevisiae
Eukaryot. Cell,
February 1, 2006;
5(2):
313 - 320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Chasse, P. Flanary, S. C. Parnell, N. Hao, J. Y. Cha, D. P. Siderovski, and H. G. Dohlman
Genome-Scale Analysis Reveals Sst2 as the Principal Regulator of Mating Pheromone Signaling in the Yeast Saccharomyces cerevisiae
Eukaryot. Cell,
February 1, 2006;
5(2):
330 - 346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Y. Yin, P. W. J. de Groot, H. L. Dekker, L. de Jong, F. M. Klis, and C. G. de Koster
Comprehensive Proteomic Analysis of Saccharomyces cerevisiae Cell Walls: IDENTIFICATION OF PROTEINS COVALENTLY ATTACHED VIA GLYCOSYLPHOSPHATIDYLINOSITOL REMNANTS OR MILD ALKALI-SENSITIVE LINKAGES
J. Biol. Chem.,
May 27, 2005;
280(21):
20894 - 20901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Zhong, J. Gvozdenovic-Jeremic, P. Webster, J. Zhou, and M. L. Greenberg
Loss of Function of KRE5 Suppresses Temperature Sensitivity of Mutants Lacking Mitochondrial Anionic Lipids
Mol. Biol. Cell,
February 1, 2005;
16(2):
665 - 675.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Grimme, P. A. Colussi, C. H. Taron, and P. Orlean
Deficiencies in the essential Smp3 mannosyltransferase block glycosylphosphatidylinositol assembly and lead to defects in growth and cell wall biogenesis in Candida albicans
Microbiology,
October 1, 2004;
150(10):
3115 - 3128.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Teparic, I. Stuparevic, and V. Mrsa
Increased mortality of Saccharomyces cerevisiae cell wall protein mutants
Microbiology,
October 1, 2004;
150(10):
3145 - 3150.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sestak, I. Hagen, W. Tanner, and S. Strahl
Scw10p, a cell-wall glucanase/transglucosidase important for cell-wall stability in Saccharomyces cerevisiae
Microbiology,
October 1, 2004;
150(10):
3197 - 3208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. W. J. de Groot, A. D. de Boer, J. Cunningham, H. L. Dekker, L. de Jong, K. J. Hellingwerf, C. de Koster, and F. M. Klis
Proteomic Analysis of Candida albicans Cell Walls Reveals Covalently Bound Carbohydrate-Active Enzymes and Adhesins
Eukaryot. Cell,
August 1, 2004;
3(4):
955 - 965.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Mizutani, A. Nojima, M. Yamamoto, K. Furukawa, T. Fujioka, Y. Yamagata, K. Abe, and T. Nakajima
Disordered Cell Integrity Signaling Caused by Disruption of the kexB Gene in Aspergillus oryzae
Eukaryot. Cell,
August 1, 2004;
3(4):
1036 - 1048.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Adams
Fungal cell wall chitinases and glucanases
Microbiology,
July 1, 2004;
150(7):
2029 - 2035.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Lesage, A.-M. Sdicu, P. Menard, J. Shapiro, S. Hussein, and H. Bussey
Analysis of {beta}-1,3-Glucan Assembly in Saccharomyces cerevisiae Using a Synthetic Interaction Network and Altered Sensitivity to Caspofungin
Genetics,
May 1, 2004;
167(1):
35 - 49.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Jaques, T. Fukamizo, D. Hall, R. C. Barton, G. M. Escott, T. Parkinson, C. A. Hitchcock, and D. J. Adams
Disruption of the gene encoding the ChiB1 chitinase of Aspergillus fumigatus and characterization of a recombinant gene product
Microbiology,
October 1, 2003;
149(10):
2931 - 2939.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Ramon and W. A. Fonzi
Diverged Binding Specificity of Rim101p, the Candida albicans Ortholog of PacC
Eukaryot. Cell,
August 1, 2003;
2(4):
718 - 728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fontaine, T. Magnin, A. Melhert, D. Lamont, J.-p. Latge, and M. A.J. Ferguson
Structures of the glycosylphosphatidylinositol membrane anchors from Aspergillus fumigatus membrane proteins
Glycobiology,
March 1, 2003;
13(3):
169 - 177.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Penalva and H. N. Arst Jr.
Regulation of Gene Expression by Ambient pH in Filamentous Fungi and Yeasts
Microbiol. Mol. Biol. Rev.,
September 1, 2002;
66(3):
426 - 446.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bernard, I. Mouyna, G. Dubreucq, J.-P. Debeaupuis, T. Fontaine, C. Vorgias, C. Fuglsang, and J.-P. Latge
Characterization of a cell-wall acid phosphatase (PhoAp) in Aspergillus fumigatus
Microbiology,
September 1, 2002;
148(9):
2819 - 2829.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. McNemar and W. A. Fonzi
Conserved Serine/Threonine Kinase Encoded by CBK1 Regulates Expression of Several Hypha-Associated Transcripts and Genes Encoding Cell Wall Proteins in Candida albicans
J. Bacteriol.,
April 1, 2002;
184(7):
2058 - 2061.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Storey, K. L. Clay, T. Kutateladze, R. C. Murphy, M. Overduin, and D. R. Voelker
Phosphatidylethanolamine Has an Essential Role in Saccharomyces cerevisiae That Is Independent of Its Ability to Form Hexagonal Phase Structures
J. Biol. Chem.,
December 14, 2001;
276(51):
48539 - 48548.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Kottom, C. F. Thomas Jr., and A. H. Limper
Characterization of Pneumocystis carinii PHR1, a pH-Regulated Gene Important for Cell Wall Integrity
J. Bacteriol.,
December 1, 2001;
183(23):
6740 - 6745.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-Y. Yuen, C.-M. Chan, K.-M. Chan, P. C. Y. Woo, X.-Y. Che, A. S. P. Leung, and L. Cao
Characterization of AFMP1: a Novel Target for Serodiagnosis of Aspergillosis
J. Clin. Microbiol.,
November 1, 2001;
39(11):
3830 - 3837.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Weig, K. Haynes, T. R. Rogers, O. Kurzai, M. Frosch, and F. A. Muhlschlegel
A GAS-like gene family in the pathogenic fungus Candida glabrata
Microbiology,
August 1, 2001;
147(8):
2007 - 2019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Smits, H. van den Ende, and F. M. Klis
Differential regulation of cell wall biogenesis during growth and development in yeast
Microbiology,
April 1, 2001;
147(4):
781 - 794.
[Full Text]
|
 |
|

|
 |

|
 |
 
M-H. Valdivieso, L. Ferrario, M. Vai, A. Duran, and L. Popolo
Chitin Synthesis in a gas1 Mutant of Saccharomyces cerevisiae
J. Bacteriol.,
September 1, 2000;
182(17):
4752 - 4757.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L.-L. Du and P. Novick
Pag1p, a Novel Protein Associated with Protein Kinase Cbk1p, Is Required for Cell Morphogenesis and Proliferation in Saccharomyces cerevisiae
Mol. Biol. Cell,
February 1, 2002;
13(2):
503 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|