HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 22, 16543-16549, June 2, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/22/16543    most recent M001810200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Li-Hawkins, J. Articles by Russell, D. W. Search for Related Content PubMed PubMed Citation Articles by Li-Hawkins, J. Articles by Russell, D. W. Social Bookmarking                      What's this?

Expression Cloning of an Oxysterol 7-Hydroxylase Selective for 24-Hydroxycholesterol^*

Jia Li-Hawkins, Erik G. Lund, Amy D. Bronson, and David W. Russell

From the Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas 75235-9046

Received for publication, March 3, 2000, and in revised form, March 27, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The synthesis of 7-hydroxylated bile acids from oxysterols requires an oxysterol 7-hydroxylase encoded by the Cyp7b1 locus. As expected, mice deficient in this enzyme have elevated plasma and tissue levels of 25- and 27-hydroxycholesterol; however, levels of another major oxysterol, 24-hydroxycholesterol, are not increased in these mice, suggesting the presence of another oxysterol 7-hydroxylase. Here, we describe the cloning and characterization of murine and human cDNAs and genes that encode a second oxysterol 7-hydroxylase. The genes contain 12 exons and are located on chromosome 6 in the human (CYP39A1 locus) and in a syntenic position on chromosome 17 in the mouse (Cyp39a1 locus). CYP39A1 is a microsomal cytochrome P450 enzyme that has preference for 24-hydroxycholesterol and is expressed in the liver. The levels of hepatic CYP39A1 mRNA do not change in response to dietary cholesterol, bile acids, or a bile acid-binding resin, unlike those encoding other sterol 7-hydroxylases. Hepatic CYP39A1 expression is sexually dimorphic (female > male), which is opposite that of CYP7B1 (male > female). We conclude that oxysterol 7-hydroxylases with different substrate specificities exist in mice and humans and that sexually dimorphic expression patterns of these enzymes in the mouse may underlie differences in bile acid metabolism between the sexes.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Two metabolic pathways that differ in their initial steps produce 7-hydroxylated bile acids (1). In one pathway, cholesterol (5-cholesten-3-ol) is first converted into 7-hydroxycholesterol (cholest-5-ene-3,7-diol) by the enzyme cholesterol 7-hydroxylase, which is encoded by the Cyp7a1 gene in mice. In the other pathway, cholesterol is first converted into one of several oxysterols prior to being 7-hydroxylated by oxysterol 7-hydroxylase, which is encoded by the Cyp7b1 gene. The 7-hydroxylated intermediates produced by these different initiating steps are subsequently converted into primary bile acids by a series of shared enzymes in the liver (2).

Cholesterol 7-hydroxylase shows a marked preference for cholesterol as a substrate and is only weakly active against other sterols (3), whereas oxysterol 7-hydroxylase prefers 25-hydroxycholesterol (cholest-5-ene-3,25-diol) and 27-hydroxycholesterol (cholest-5-ene-3,27-diol) (4, 5). In agreement with the latter preference, Cyp7b1 knockout mice accumulate these two oxysterols in their plasma and tissues (6). The levels of the other major oxysterol, 24-hydroxycholesterol (cholest-5-ene-3,24-diol), are near normal in these animals (6). In contrast, a human with a complete absence of oxysterol 7-hydroxylase activity accumulated 24-hydroxycholesterol as well as 25- and 27-hydroxycholesterol in his plasma (7). These observations suggest that the human enzyme, unlike the mouse enzyme, may act on all three oxysterol substrates.

The observed differences in the oxysterol accumulation patterns in mice and humans that express no oxysterol 7-hydroxylase are not due to differences in the biosynthesis of oxysterols, as cholesterol 24-hydroxylase, cholesterol 25-hydroxylase, and sterol 27-hydroxylase are present in both species (8-10). The sequence of cholesterol 24-hydroxylase is the most highly conserved between mice and humans (95% identity), and in both, expression of the enzyme is limited to the brain (8). This preservation of expression and form suggests that 24-hydroxycholesterol and 24-hydroxylase play important physiological roles in mammals, perhaps participating in the turnover of cholesterol in the central nervous system (11).

To determine why Cyp7b1^/ mice do not accumulate 24-hydroxycholesterol, we examined oxysterol 7-hydroxylase activity in the livers of knockout animals. A hepatic activity was detected that produced 7-hydroxylated 24-hydroxycholesterol. Here, we report these results and the isolation by expression cloning (9) of murine and human cDNAs encoding this new enzyme activity.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Enzyme Assays-- Total liver protein homogenates were prepared, and oxysterol 7-hydroxylase activities were measured as described (4). The concentration of oxysterol substrate was 1 µM in the reaction. 25-[³H]Hydroxycholesterol (81.5 Ci/mmol) was purchased from NEN Life Science Products. 22R-[³H]Hydroxycholesterol (15 Ci/mmol), 24,25-[³H]epoxycholesterol (76 Ci/mmol), and 27-[³H]hydroxycholesterol (80 Ci/mmol) were synthesized by NEN Life Science Products. 24-[³H]Hydroxycholesterol (50 Ci/mmol) was synthesized by American Radiolabeled Chemicals (St. Louis, MO).

To measure oxysterol 7-hydroxylase enzyme activity in cultured cells, 60-mm dishes of Chinese hamster ovary cells expressing the middle T antigen of the polyoma virus (CHOP cells (12)) (450,000 cells/dish) were transfected with 4.5 µg of the indicated expression vector using LipofectAMINE^TM (Life Technologies, Inc.) as a transfection reagent. Sixteen h later, ³H-labeled oxysterol substrate dissolved in ethanol was added to a final concentration of 1 µM to the media, and the incubation was continued for an additional 4-24 h. Media were harvested and extracted with 7 ml of chloroform/methanol (2:1, v/v); the organic phases were dried; and sterols were analyzed by thin-layer chromatography (4).

Expression Cloning-- A cDNA library was constructed from poly(A)⁺ mRNA isolated from the livers of three Cyp7b1^/ male mice in the pCMV5 expression vector (13). Individual dishes of CHOP cells (450,000 cells/60-mm dish) were transfected with 4.5 µg of cDNA and 0.5 µg of pVA1 using LipofectAMINE^TM. The pVA1 plasmid contains the adenovirus VA1 gene, whose RNA product stimulates the expression of transfected genes (9). After 3 h of incubation, the transfection mixture was replaced with 2.5 ml of Dulbecco's minimal essential medium/Ham's F-12 medium (1:1) containing 5% (v/v) fetal calf serum, 100 units/ml penicillin, 100 µg/ml streptomycin, and 1-2 µCi of 24-[³H]hydroxycholesterol. After 60 h of incubation at 37 °C, media were harvested, and sterols were analyzed by thin-layer chromatography. 210 primary pools containing ~100,000 individual cDNAs were screened in the first round. Positive pools were divided into progressively smaller subpools and analyzed by transfection to identify the target cDNA.

Chemical Analyses-- Gas chromatography-mass spectrometry analyses were performed on a Varian 3400 gas chromatograph equipped with an HP-5MS capillary column (30 m × 0.25 mm, 0.25-mm phase thickness) connected to a Finnigan SSQ700 mass spectrometer. The gas chromatography temperature program was 180 °C for 1 min, followed by a linear gradient of 10 °C/min to 300 °C and a final elution at 300 °C for 15 min. The injector port and transfer line temperatures were maintained at 280 °C, and the injector was operated in the splitless mode. Helium was used as carrier gas at an injector valve pressure of 6 pounds/square inch. The mass spectrometer was operated in the electron ionization mode with electron energy set at 70 eV and an ion source temperature of 150 °C.

CHOP cells were transfected with either CYP39A1 or CYP46 expression vectors as described above and incubated with sterols as indicated in the legend to Fig. 3. The cell medium was extracted with chloroform/methanol (2:1, v/v); the aqueous phase was aspirated; and the remaining organic phase was taken to dryness under a stream of nitrogen. Solids were redissolved in 1 ml of toluene and purified on Isolute Silica columns (14), with the modifications described in the accompanying paper (6). After derivatization to trimethylsilyl ethers, samples were analyzed by gas chromatography-mass spectrometry with the quadrupole scanned from m/z 50 to 650 at a rate of one scan/1.5 s.

Human CYP39A1 cDNA Cloning-- Data base searches revealed a human genomic DNA sequence (GenBank^TM/EBI Data Bank accession numbers AC008104 and AL035670) and an expressed sequence tag (R07010) that shared extended sequence identity with the murine CYP39A1 cDNA. The expressed sequence tag was used as a hybridization probe to screen a human cDNA library (CLONTECH, catalog no. HL5022T). Only cDNAs corresponding to the 3'-end of the CYP39A1 mRNA were isolated in this manner. To obtain a full-length cDNA, a reverse transcriptase-polymerase chain reaction strategy was pursued as follows. Based on the predicted sequence of exons within the human genomic DNA, two oligonucleotide primers were designed to amplify the coding region of the CYP39A1 gene. The oligonucleotide sequences were as follows: 5'-primer, CTGTTTCACACTTTTCTGCTTCTG; and 3'-primer, GAGCTCAGGTCTAGGTGCTGCCAGG. A polymerase chain reaction was performed on human liver Quick-Clone cDNA (CLONTECH, catalog no. 7113-1) using an Expand High Fidelity PCR system (Roche Molecular Biochemicals). The amplified human CYP39A1 cDNA was cloned into a plasmid vector prior to DNA sequence and expression analyses.

RNA Blotting-- Total RNA and poly(A)⁺ RNA were prepared as described (6). Mouse and human multiple-tissue RNA blots were purchased from CLONTECH. Hybridizations were performed in either ExpressHyb solution (CLONTECH) or hybridization buffer containing 5× Denhardt's solution, 0.75 M NaCl, 0.05 M NaH₂PO₄, 0.005 M EDTA, 1% (w/v) SDS, and 50% (v/v) formamide.

Antibody Production-- An 18-amino acid peptide (LHRNPKYFPEPESFKPER) derived from residues 373 to 390 of the cDNA-deduced sequence of the murine CYP39A1 protein (see Fig. 4A) was synthesized by Bio-Synthesis, Inc. (Lewisville, TX) as a multiple-antigen peptide. The multiple-antigen peptide was used to immunize two New Zealand White rabbits (male, 3 months old). For the initial injection, 250 µg of multiple-antigen peptide was emulsified with Freund's complete adjuvant and administered intramuscularly. Over the next several months, boosts containing the same amount of antigen in Freund's incomplete adjuvant were given at intervals of 2 weeks. Serum samples were collected, and the titer of the desired antibody was tested in immunoblotting experiments that employed extracts from 293 cells transfected with a murine CYP39A1 expression vector. The final antiserum recognized the recombinant CYP39A1 protein expressed in 293 cells and the native protein present in microsomal membranes from murine liver.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Previously, we measured the levels of oxysterols in the plasma of Cyp7b1^/ mice. The rank order of oxysterol accumulation in these animals was 25-hydroxycholesterol > 27-hydroxycholesterol 24-hydroxycholesterol (6). To determine if the low levels of 24-hydroxycholesterol were due to the presence of another enzyme that metabolized this oxysterol, tissue homogenates were prepared from the livers of wild-type and Cyp7b1^/ mice and incubated with 24-[³H]hydroxycholesterol. Sterols were then extracted from the reaction mixture and separated by thin-layer chromatography. A product was generated that migrated faster than the 24-hydroxycholesterol substrate when the assay contained homogenates from female wild-type mice (Fig. 1, lane 2). The position to which the metabolite migrated on the plate was consistent with a 7-hydroxylation event. Synthesis of this product required NADPH (lane 1). Homogenates from female Cyp7b1^/ knockout mice also contained an NADPH-dependent activity (lanes 3 and 4). Similar results were obtained when lysates from male liver were assayed (lanes 5-8), except that the amount of activity was ~3-fold lower than that in female tissue.

View larger version (70K): [in this window] [in a new window]   Fig. 1.   Metabolism of oxysterols in liver homogenates. Tissue lysates were prepared from mice of the indicated sex and Cyp7b1 genotype and assayed for their ability to metabolize 24-[3H]hydroxycholesterol (lanes 1-8) or 27-[3H]hydroxycholesterol (lanes 9-16). 250 µg of membrane protein was incubated with radiolabeled oxysterol substrate (1.0 µM) in the presence (+) or absence (-) of 1.5 mM NADPH in a final volume of 0.5 ml for 15 min at 37 °C. Sterol products were thereafter analyzed by thin-layer chromatography as described under "Experimental Procedures" and visualized by autoradiography using Kodak BIOMAXTM MS x-ray film and exposure at 80 °C for 16 h. The positions of the oxysterol substrates and products derived from them on the chromatogram are indicated on the left.

As a control experiment, the same lysates were incubated in the presence and absence of NADPH, but with the substrate 27-[³H]hydroxycholesterol. This oxysterol was converted into at least three products when proteins from male or female wild-type mice were included in a reaction with NADPH (Fig. 1, lanes 10 and 14), with male mice producing higher levels of metabolites than female mice. Calculation of the R_F values of the products suggested that they contained 7-hydroxyl groups (4, 5). The synthesis of these products was reduced substantially but not eliminated when homogenates from Cyp7b1^/ knockout mice were used (lanes 12 and 16), and in this case, the product amount was greater in homogenates from the female mice.

These data were consistent with the presence of an oxysterol hydroxylase in both wild-type and knockout mice that exhibited a preference for 24-hydroxycholesterol. To isolate cDNAs that encoded this putative 24-hydroxycholesterol 7-hydroxylase, a cDNA library was prepared in a eukaryotic expression vector from hepatic mRNA pooled from three Cyp7b1^/ mice. 210 pools of ~500 independent cDNAs each were transfected into CHOP cells, which were subsequently assayed for oxysterol 7-hydroxylase enzyme activity. Mock-transfected cells did not metabolize the substrate (Fig. 2, lane 1). However, among the cDNA pools, several expressed an activity that converted 24-hydroxycholesterol into two products (lane 2), which were identified tentatively as 7-hydroxylated 24-hydroxycholesterol and an additional metabolite (7,24-dihydroxycholest-4-ene-3-one) produced by the action of an endogenous 3-hydroxysteroid dehydrogenase in the CHOP cells. Time course studies indicated that the 7-hydroxylated 24-hydroxycholesterol product appeared first in the transfected cells and that this initial product was subsequently converted into 7,24-dihydroxycholest-4-ene-3-one (data not shown). The R_F value of the primary product made by the transfected cells was the same as that made in tissue homogenates (compare lanes 2 and 6). The active pool of cDNAs (lane 2) was sequentially subdivided and re-assayed to isolate a single cDNA that encoded the enzyme activity (lanes 3 and 4).

View larger version (42K): [in this window] [in a new window]   Fig. 2.   Isolation of murine oxysterol 7-hydroxylase cDNA by expression cloning. Pools containing the indicated number of independent cDNAs cloned into an expression vector were transfected into cultured CHOP cells. After 60 h, 24-[3H]hydroxycholesterol (1.0 µM) was added to the cells for 4 h, and sterol products were separated by thin-layer chromatography. Lane 1, results obtained with mock-transfected cells; lane 2, results obtained with an active pool of 500 cDNAs; lanes 3 and 4, results obtained with a pool of 80 cDNAs and a single pure cDNA encoding the target activity, respectively; lanes 5 and 6, controls illustrating the NADPH-dependent enzyme activity that acts on 24-hydroxycholesterol in hepatic lysates.

Gas chromatography-ionizing mass spectrometry was used to determine the chemical structure of the primary sterol product of the cDNA-encoded enzyme (Fig. 3). In these experiments, mock- or cDNA-transfected cells were incubated with the indicated sterol substrates, and after 24 h, products in the media were analyzed by gas chromatography-mass spectrometry. Mock-transfected cells did not metabolize 24-hydroxycholesterol (Fig. 3A). In contrast, cells transfected with the purified cDNA isolated by expression cloning converted 24-hydroxycholesterol into a primary product (labeled Product a in Fig. 3B), which eluted from the gas chromatography column just before the substrate. The ionization mass spectrogram of Product a was consistent with the presence of three hydroxyl groups on the sterol (Fig. 3D). Two of these three hydroxyl groups were present on the starting substrate (at carbons 3 and 24), and the enzyme expressed in the transfected cells added the third.

View larger version (28K): [in this window] [in a new window]   Fig. 3.   Chemical analyses of 7-hydroxylated oxysterols. A, sterols from the media of mock-transfected cells incubated with 24-hydroxycholesterol were extracted with organic solvent, derivatized, and subjected to gas chromatography-mass spectrometry. Only a single major peak corresponding to 24-hydroxycholesterol was detected. B, sterols from the media of cells transfected with the active cDNA isolated by expression cloning were analyzed. Two peaks were evident that corresponded to the starting substrate and a cDNA-specific product (labeled Product a). C, cells transfected with an expression vector encoding cholesterol 24-hydroxylase (CYP46) were incubated with 7-hydroxycholesterol, and the resulting media sterols were analyzed by gas chromatography-mass spectrometry. Among several sterols detected on the gas chromatogram, one (labeled Product b) eluted from the column at the same position as Product a in B. D, shown is the ionization spectrum of Product a. E, shown is the ionization spectrum of Product b. Note virtual identities between the two ionization spectra shown in D and E.

Thin-layer chromatography analyses of Product a suggested that the third hydroxyl group was located on carbon 7 (e.g. Fig. 1). However, we did not have access to an authentic 7-hydroxylated 24-hydroxycholesterol standard with which to compare the mass spectrogram of this product. To overcome this privation, advantage was taken of previous experiments showing that cholesterol 24-hydroxylase (CYP46) converted 7-hydroxycholesterol into a 24-hydroxylated product (Ref. 8 and data not shown). We reasoned that this product of the cholesterol 24-hydroxylase enzyme should have identical elution properties on a gas chromatography column and a virtually identical ionization spectrum as Product a arising from the cDNA-expressed enzyme. The data of Fig. 3C show that several sterols were produced when cholesterol 24-hydroxylase-expressing cells were incubated with 7-hydroxycholesterol. One of these (labeled Product b in the gas chromatogram tracing in Fig. 3C) eluted at the same position as Product a. The mass spectrogram of Product b (Fig. 3E) was identical to that of Product a (Fig. 3D). Taken together, these data indicate that the cDNA isolated in the experiments of Fig. 2 encoded a 7-hydroxylase that acted on 24-hydroxycholesterol.

Restriction endonuclease mapping of the expression plasmid encoding this activity indicated a 2.4-kb¹ cDNA insert. DNA sequence analysis of the insert revealed a 5'-untranslated sequence of 86 base pairs, a potential coding region of 1413 base pairs, and a 3'-untranslated sequence of 872 base pairs. The deduced amino acid sequence of the enzyme spanned 470 amino acids (Fig. 4A) and contained hallmark features of a microsomal cytochrome P450, including a hydrophobic amino terminus and an invariant cysteine residue (position 415) located toward the carboxyl terminus. The assembled full-length sequence was assigned the name CYP39A1 (cytochrome P450 39A1) (15).

View larger version (35K): [in this window] [in a new window]   Fig. 4.   Structure of murine and human oxysterol 7-hydroxylases. A, lineup of cDNA-deduced protein sequences of the murine (m; top line of doublet) and human (h; bottom line of doublet) enzymes. Sequence identities are indicated by vertical lines. Amino acids are numbered on the right. The GenBankTM/EBI Data Bank accession numbers for the murine and human sequences are AF237981 and AF237982, respectively. B, schematic of the intron-exon structure of the human gene. Exons are indicated by boxes, and introns by interconnecting straight lines. The amino acids at each intron-exon junction are indicated above the schematic. The schematic is drawn to scale. C, sequence identities between sterol 7-hydroxylases. Amino acid alignments were performed between the indicated pairs of enzymes using the Jotum Hein method in the MegAlignTM computer program.

Further data base searches revealed a human expressed sequence tag (accession number R07010) that shares sequence identity with the murine cDNA and an extended human genomic DNA sequence (accession numbers AC008104 and AL035670), which appeared to span the entire gene. Comparisons of the murine cDNA with human cDNAs isolated by screening a liver cDNA library with the expressed sequence tag and comparisons of these cDNAs with the human genomic sequence produced the amino acid sequence of the human enzyme (Fig. 4A). A human CYP39A1 cDNA expressed in 293 cells produced an enzyme activity that converted 24-hydroxycholesterol into a 7-hydroxylated product (data not shown). Comparisons with the genomic sequences in the data base also allowed a refinement of the intron-exon structure of the gene predicted previously. A schematic of the ~150-kb human gene is shown in Fig. 4B.

Analyses of radiation hybrid panel DNAs indicated that the human gene (CYP39A1) is located on chromosome 6, tightly linked (lod score = 12.7) to the D6S1540 marker, whereas the murine gene (Cyp39a1) is located in a syntenic position on chromosome 17, tightly linked (lod score = 19) to the D17Mit51 marker (data not shown). The chromosomal location of the human gene deduced here agrees with that reported for the genomic DNA sequence in the data base.

The mouse and human CYP39A1 amino acid sequences were 75% identical and 83% similar (Fig. 4C). These proteins were most closely related (~30% identity) to the oxysterol 7-hydroxylase encoded by the Cyp7b1 gene and, to a lesser extent, the cholesterol 7-hydroxylase encoded by the Cyp7a1 gene (~19-27% identity) (Fig. 4C).

The sequence similarities between CYP39A1 and CYP7B1 and the fact that they are both oxysterol 7-hydroxylases raised questions concerning their substrate preferences. To address this issue, the murine CYP7B1 and CYP39A1 cDNAs were expressed in cultured cells, and the ability of the transfected cells to 7-hydroxylate various side chain oxysterols was assessed. The data of Fig. 5 (first through fifth lanes) indicate that mock-transfected cells metabolized very little of the five different oxysterols tested in these experiments. In contrast, cells transfected with the CYP7B1 cDNA metabolized all substrates with a rank order of 25-hydroxycholesterol > 27-hydroxycholesterol > 24,25-epoxycholesterol > 22-hydroxycholesterol > 24-hydroxycholesterol (sixth through tenth lanes). Cells expressing the CYP39A1 cDNA avidly metabolized 24-hydroxycholesterol (twelfth lane), but showed little or no activity toward the other four oxysterols (eleventh through fifteenth lanes). These data suggest that the CYP7B1 oxysterol 7-hydroxylase had broad oxysterol substrate specificity, whereas the CYP39A1 oxysterol 7-hydroxylase was largely restricted to 24-hydroxycholesterol.

View larger version (72K): [in this window] [in a new window]   Fig. 5.   Substrate specificities of oxysterol 7-hydroxylase enzymes. cDNAs encoding the murine (m) CYP7B1 or CYP39A1 enzymes were introduced into cultured CHOP cells. After 16 h, the transfected cells were incubated with the indicated radiolabeled sterols (1.0 µM) for a period of 4 h at 37 °C. Sterols were then extracted from the media, separated by thin-layer chromatography, and visualized by autoradiography. Percentage conversion of substrate into products was estimated after phosphoimage analyses of the thin-layer chromatography plate.

The tissue distribution and regulation of the murine CYP39A1 mRNA were examined by RNA blotting. Analysis of eight tissues revealed a single hybridizing species of ~2.5 kb that was present only in the liver (Fig. 6A). Analysis of mRNA from 12 human tissues using a CYP39A1 cDNA probe revealed a single mRNA (~2.4 kb) with a similar liver-specific expression pattern (data not shown). Feeding mice diets supplemented with 2% cholesterol, 0.5% cholate, 2% cholesterol plus 0.5% cholate, or 2% colestipol did not change the levels of hepatic CYP39A1 mRNA relative to those in normal chow-fed animals (Fig. 6B, first through fifth lanes). Dietary supplements also did not change the levels of hepatic CYP39A1 mRNA in mice lacking the CYP7B1 oxysterol 7-hydroxylase (Fig. 6B, sixth through tenth lanes).

View larger version (39K): [in this window] [in a new window]   Fig. 6.   Blot hybridization of oxysterol 7-hydroxylase mRNA. A, tissue distribution of CYP39A1 mRNA in the mouse. A blot containing 2 µg of poly(A)+ mRNA from each of eight murine tissues was hybridized to a radiolabeled probe from the CYP39A1 cDNA (upper panel). A single mRNA of 2.4 kb was detected in the liver. Control experiments with a -actin probe indicated that mRNA was present in all lanes of the blot (lower panel). B, response of CYP39A1 mRNA to dietary supplements. Mice (six males per diet, 3 months of age) were maintained on diets supplemented with the indicated sterols or bile acid-binding resin (colestipol) for 10 days. Thereafter, liver mRNA was extracted and analyzed by blot hybridization using a CYP39A1 cDNA probe (upper panel) or a control probe (cyclophilin; lower panel). A single CYP39A1 mRNA was detected in each lane that did not change in amount with the different diets. C, sexual dimorphism in hepatic CYP39A1 oxysterol 7-hydroxylase expression. Aliquots of poly(A)+ mRNA (5 µg) were purified from the livers of mice of the indicated sex and Cyp7b1 oxysterol 7-hydroxylase genotype and analyzed by blot hybridization using a CYP39A1 cDNA probe. The blot was stripped and reprobed with a cyclophilin cDNA probe. Hybridization signals were quantitated by phosphoimaging and are expressed as a CYP39A1/cyclophilin ratio (upper panel). CYP39A1 protein levels were determined by immunoblot analyses of microsomal protein (75-150 µg) using an anti-peptide antibody as described under "Experimental Procedures." CYP39A1 enhanced chemiluminescence signals were normalized to immunoglobulin heavy chain-binding protein levels and are expressed as a ratio (middle panel). Enzyme activity levels were measured in hepatic extracts (500 µg of protein) using 24-[3H]hydroxycholesterol (1.0 µM) as substrate, 1.5 mM NADPH as cofactor, and incubation times ranging from 5 to 20 min. CYP39A1-specific activities were calculated from the linear portion of the curves (lower panel).

A final series of experiments confirmed the sexually dimorphic expression pattern of the CYP39A1 oxysterol 7-hydroxylase at multiple levels. As shown by the data in Fig. 6C (upper panel), the level of this mRNA in wild-type mice was ~3-fold higher in female versus male liver. Immunoblotting experiments with an anti-peptide antibody directed against the CYP39A protein confirmed an increased protein level in females (Fig. 6C, middle panel), as did enzyme activity measurements (Fig. 6C, lower panel). These parameters were unchanged in Cyp7b1^/ mice, indicating that loss of the CYP7B1 oxysterol 7-hydroxylase was not compensated for by increased expression of the CYP39A1 oxysterol 7-hydroxylase (Fig. 6C).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

This study reports the cloning of murine and human cDNAs encoding an oxysterol 7-hydroxylase with specificity for 24-hydroxycholesterol. These enzymes contain 470 amino acids, share 75% sequence identity, and represent a new subfamily of cytochrome P450 proteins (CYP39A1). The human CYP39A1 gene contains 12 exons and spans ~150 kb of DNA on chromosome 6 in the region of the human leukocyte antigen genes, whereas the mouse Cyp39a1 gene is located in a similar position on chromosome 17. The expression of CYP39A1 appears to be limited to the liver and is sexually dimorphic in the mouse, with higher levels of CYP39A1 mRNA and enzyme activity in females. Based on previous studies showing that 24-hydroxycholesterol is converted by the liver into more polar sterols that are most likely bile acids (16-18) and the spectrum of metabolites arising from this oxysterol in transfected cells expressing a CYP39A1 cDNA (e.g. Fig. 2), we believe that the physiological role of this enzyme is to synthesize bile acids.

The current findings bring to three the number of sterol 7-hydroxylases that participate in the synthesis of bile acids. All are cytochromes P450 of the endoplasmic reticulum. Cholesterol 7-hydroxylase (19) and the CYP39A1 oxysterol 7-hydroxylase (Fig. 6A) are expressed only in the liver, whereas the expression pattern of the CYP7B1 oxysterol 7-hydroxylase is more widespread and differs between species (1, 20-23). These three sterol 7-hydroxylases share 19-41% sequence identity (Fig. 4C) and are clearly related at a functional level. An analysis of their gene structures and chromosomal map positions suggests that they may have arisen by two different evolutionary mechanisms. The human cholesterol 7-hydroxylase and CYP7B1 oxysterol 7-hydroxylase genes have identical intron-exon structures and are closely linked on chromosome 8 (7, 24), indicating that they may derive from an ancient duplication event. In contrast, the human CYP39A1 oxysterol 7-hydroxylase gene contains 12 exons (Fig. 4B) and is located on chromosome 6, which suggests that this gene arose independently of the other two. Tracing the species-specific distribution of these three enzymes in the future may reveal information regarding the marked diversity of bile acids in different species. A homologue of the CYP39A1 oxysterol 7-hydroxylase is present in the chicken (GenBank^TM/EBI Data Bank accession number AI979980), and enzyme activity measurements suggest that chickens and other birds also contain the CYP7B1 oxysterol 7-hydroxylase (4).

Despite the sequence similarities between the three sterol 7-hydroxylases of bile acid synthesis, the enzymes have different substrate preferences. Cholesterol 7-hydroxylase oxidizes cholesterol, whereas the CYP7B1 enzyme acts preferentially on 25- and 27-hydroxycholesterol (4, 5), and the CYP39A1 enzyme prefers 24-hydroxycholesterol (Fig. 5). It is important to point out that these are preferences and not absolute specificities, as the two oxysterol 7-hydroxylases will metabolize different side chain oxysterols at some level when assayed in tissue homogenates (Fig. 1) or when expressed in cultured cells (Fig. 5). That the same or similar preferences exist in vivo is supported by the accumulation of 25- and 27-hydroxycholesterol, but not 24-hydroxycholesterol, in mice lacking the CYP7B1 oxysterol 7-hydroxylase (6). This outcome predicts that mice with a null mutation in the Cyp39a1 gene may accumulate 24-hydroxycholesterol, but not the other two oxysterols.

The accumulation of all three oxysterols in a human subject lacking the CYP7B1 oxysterol 7-hydroxylase (7) may reflect a broader substrate specificity of this enzyme, a difference in the expression of the CYP39A1 enzyme, or a consequence of hepatic failure caused by hyperoxysterolemia in this individual. It should also be pointed out that only a single subject with this deficiency has been identified and that the phenotypes of other affected individuals may be different.

The majority of circulating 24-hydroxycholesterol in the mouse (8), rat (16), and human (17) is made in the brain. The brain is the most cholesterol-rich tissue in mammals and, unlike peripheral tissues, cannot exchange cholesterol with circulating lipoprotein particles (11). The synthesis of 24-hydroxycholesterol is thought to represent a pathway by which excess cholesterol is mobilized to escape the confines of the blood-brain barrier and central nervous system (17). The presence of an oxysterol 7-hydroxylase with selectivity for 24-hydroxycholesterol in the liver suggests that the major pathway by which the body excretes brain-derived cholesterol is via the liver into the bile. A similar metabolic pathway exists for 27-hydroxycholesterol, which is produced chiefly in the lung (25) and then converted to bile acids in the liver by the CYP7B1 oxysterol 7-hydroxylase. The fact that conserved tissue-specific synthesis and degradative pathways exist for oxysterols underscores their potential roles as mediators of reverse cholesterol transport.

The three sterol 7-hydroxylase genes of bile acid metabolism are regulated differently. The cholesterol 7-hydroxylase gene is subject to negative feedback regulation by bile acids and to positive feed-forward regulation by cholesterol in mice and rats (19). Transcription from the CYP7B1 oxysterol 7-hydroxylase gene is only modestly down-regulated by bile acids (4), and the levels of CYP39A1 oxysterol 7-hydroxylase mRNA do not change in response to bile acids, cholesterol, or bile acid-binding resins (Fig. 6A). Finally, CYP39A1 is more abundant in female mice. whereas CYP39B1 is more abundant in male mice (Figs. 1 and 6). Sexually dimorphic expression patterns of the CYP7B1 and CYP39A1 oxysterol 7-hydroxylases, together with their substrate preferences, may thus underlie differences in bile acid metabolism that exist between male and female mice (26, 27).

	ACKNOWLEDGEMENTS

We thank Jill Abadia, Kristi M. Cala, and Daphne L. Davis for excellent technical assistance; David Mangelsdorf for radioactive substrates; David Nelson for comparisons of cytochrome P450 sequences; and Mike Brown, Joe Goldstein, and Helen Hobbs for critical reading of the manuscript.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant HL 20948, Robert A. Welch Foundation Grant I-0971, and the William M. Keck Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF237981 and AF237982.

To whom correspondence should be addressed: Dept. of Molecular Genetics, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235-9046. Tel.: 214-648-2007; Fax: 214-648-6899; E-mail: Russell@utsw.swmed.edu.

Published, JBC Papers in Press, March 27, 2000, DOI 10.1074/jbc.M001810200

	ABBREVIATIONS

The abbreviation used is: kb, kilobase pair(s).

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				T. Kotti, D. D. Head, C. E. McKenna, and D. W. Russell Biphasic requirement for geranylgeraniol in hippocampal long-term potentiation PNAS, August 12, 2008; 105(32): 11394 - 11399. [Abstract] [Full Text] [PDF]

				M. Depke, G. Fusch, G. Domanska, R. Geffers, U. Volker, C. Schuett, and C. Kiank Hypermetabolic Syndrome as a Consequence of Repeated Psychological Stress in Mice Endocrinology, June 1, 2008; 149(6): 2714 - 2723. [Abstract] [Full Text] [PDF]

				K. H. Clodfelter, M. G. Holloway, P. Hodor, S.-H. Park, W. J. Ray, and D. J. Waxman Sex-Dependent Liver Gene Expression Is Extensive and Largely Dependent upon Signal Transducer and Activator of Transcription 5b (STAT5b): STAT5b-Dependent Activation of Male Genes and Repression of Female Genes Revealed by Microarray Analysis Mol. Endocrinol., June 1, 2006; 20(6): 1333 - 1351. [Abstract] [Full Text] [PDF]

				T. J. Kotti, D. M. O. Ramirez, B. E. Pfeiffer, K. M. Huber, and D. W. Russell Brain cholesterol turnover required for geranylgeraniol production and learning in mice PNAS, March 7, 2006; 103(10): 3869 - 3874. [Abstract] [Full Text] [PDF]

				N. K. MacLennan, L. Rahib, C. Shin, Z. Fang, S. Horvath, J. Dean, J. C. Liao, E. R.B. McCabe, and K. M. Dipple Targeted disruption of glycerol kinase gene in mice: expression analysis in liver shows alterations in network partners related to glycerol kinase activity Hum. Mol. Genet., February 1, 2006; 15(3): 405 - 415. [Abstract] [Full Text] [PDF]

				Y. Inoue, A.-M. Yu, S. H. Yim, X. Ma, K. W. Krausz, J. Inoue, C. C. Xiang, M. J. Brownstein, G. Eggertsen, I. Bjorkhem, et al. Regulation of bile acid biosynthesis by hepatocyte nuclear factor 4{alpha} J. Lipid Res., January 1, 2006; 47(1): 215 - 227. [Abstract] [Full Text] [PDF]

				Y. Omoto, R. Lathe, M. Warner, and J.-A. Gustafsson Early onset of puberty and early ovarian failure in CYP7B1 knockout mice PNAS, February 22, 2005; 102(8): 2814 - 2819. [Abstract] [Full Text] [PDF]

				N. Mano, Y. Sato, M. Nagata, T. Goto, and J. Goto Bioconversion of 3{beta}-hydroxy-5-cholenoic acid into chenodeoxycholic acid by rat brain enzyme systems J. Lipid Res., September 1, 2004; 45(9): 1741 - 1748. [Abstract] [Full Text] [PDF]

				M. P. Waalkes, J. Liu, H. Chen, Y. Xie, W. E. Achanzar, Y.-S. Zhou, M.-L. Cheng, and B. A. Diwan Estrogen Signaling in Livers of Male Mice With Hepatocellular Carcinoma Induced by Exposure to Arsenic In Utero J Natl Cancer Inst, March 17, 2004; 96(6): 466 - 474. [Abstract] [Full Text] [PDF]

				M. Norlin, S. von Bahr, I. Bjorkhem, and K. Wikvall On the substrate specificity of human CYP27A1: implications for bile acid and cholestanol formation J. Lipid Res., August 1, 2003; 44(8): 1515 - 1522. [Abstract] [Full Text] [PDF]

				E. G. Lund, C. Xie, T. Kotti, S. D. Turley, J. M. Dietschy, and D. W. Russell Knockout of the Cholesterol 24-Hydroxylase Gene in Mice Reveals a Brain-specific Mechanism of Cholesterol Turnover J. Biol. Chem., June 13, 2003; 278(25): 22980 - 22988. [Abstract] [Full Text] [PDF]

				M. Fuchs Bile Acid Regulation of Hepatic Physiology: III. Regulation of bile acid synthesis: past progress and future challenges Am J Physiol Gastrointest Liver Physiol, April 1, 2003; 284(4): G551 - G557. [Abstract] [Full Text] [PDF]

				S. Meaney, K. Bodin, U. Diczfalusy, and I. Bjorkhem On the rate of translocation in vitro and kinetics in vivo of the major oxysterols in human circulation: critical importance of the position of the oxygen function J. Lipid Res., December 1, 2002; 43(12): 2130 - 2135. [Abstract] [Full Text] [PDF]

				J. Y. L. Chiang Bile Acid Regulation of Gene Expression: Roles of Nuclear Hormone Receptors Endocr. Rev., August 1, 2002; 23(4): 443 - 463. [Abstract] [Full Text] [PDF]

				M. Norlin Expression of key enzymes in bile acid biosynthesis during development: CYP7B1-mediated activities show tissue-specific differences J. Lipid Res., May 1, 2002; 43(5): 721 - 731. [Abstract] [Full Text] [PDF]

R. A. Davis, J. H. Miyake, T. Y. Hui, and N. J. Spann Regulation of cholesterol-7{alpha}-hydroxylase: BAREly missing a SHP J. Lipid Res., April 1, 2002; 43(4): 5