JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M001117200 on March 20, 2000

J. Biol. Chem., Vol. 275, Issue 22, 16730-16737, June 2, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/22/16730    most recent
M001117200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Galvan, M.
Right arrow Articles by Baum, L. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Galvan, M.
Right arrow Articles by Baum, L. G.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Expression of a Specific Glycosyltransferase Enzyme Regulates T Cell Death Mediated by Galectin-1*

Marisa GalvanDagger §, Shigeru Tsuboi, Minoru Fukuda, and Linda G. BaumDagger ||

From the Dagger  Department of Pathology and Laboratory Medicine, UCLA School of Medicine, Los Angeles, California 90095 and  The Glycobiology Program, The Burnham Institute, La Jolla, California 92037

Received for publication, February 9, 2000, and in revised form, March 17, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Galectin-1 induces apoptosis of immature thymocytes and activated T cells, suggesting that galectin-1 regulates cell death in the thymus during selection and in the periphery following an immune response. Although it is known that galectin-1 recognizes lactosamine (Gal-GlcNAc) as a minimal ligand, this disaccharide is ubiquitously expressed on a variety of cell surface glycoproteins. Thus, susceptibility to galectin-1 may be regulated by the presentation of lactosamine on specific oligosaccharide structures created by specific glycosyltransferase enzymes. The core 2 beta -1,6-N-acetylglucosaminyltransferase (core 2 GnT) creates a branched structure on O-glycans that can be elongated to present multiple lactosamine sequences. In the thymus, the core 2 GnT is expressed in galectin-1-sensitive thymocyte subsets. In the periphery, an oligosaccharide epitope created by the core 2 GnT is expressed on galectin-1-sensitive activated T-cells. In this report, we demonstrate that expression of the core 2 GnT was necessary and sufficient for galectin-1-induced death of murine T cell lines. In addition, overexpression of the core 2 GnT in mice increased the susceptibility of double positive thymocytes to galectin-1. These data demonstrate that expression of a specific glycosyltransferase can control susceptibility to galectin-1, suggesting that developmentally regulated glycosyltransferase expression may be a mechanism to modulate cell death during T cell development and function.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Selection and maturation in the thymus is a complex and deadly process. The majority of thymocytes are either non-selected or negatively selected and die in the thymus via apoptosis (for reviews, see Refs. 1-3). Our laboratory and others have previously shown that galectin-1, a lectin expressed in the thymus, spleen, lymph nodes, and other tissues, can induce apoptosis of immature thymocytes but not mature thymocytes. This suggests that galectin-1 may participate in apoptosis of negatively selected and non-selected thymocyte populations (4, 5). Galectin-1 also induces apoptosis of activated T cells but not resting T cells, implying that galectin-1 may also play a role in terminating an immune response in the periphery (6).

To understand the mechanism of galectin-1-induced apoptosis, it is critical to define the oligosaccharide ligands on the surface of T cells that are recognized by galectin-1. Previous studies have shown that lactosamine (Galbeta 1-4GlcNAc) is the preferred minimal saccharide ligand bound by galectin-1. Galectin-1 has a relatively low affinity for single N-acetyllactosamine sequences; however, galectin-1 binds with high avidity to glycans containing multiple N-acetyllactosamine units and preferentially binds glycoproteins containing linear polylactosamine sequences (7-11). These linear polylactosamine sequences can be found on O-linked and N-linked glycans (Scheme 1). On O-glycans, the addition of polylactosamine sequences is primarily controlled by the activity of the core 2 beta -1,6-N-acetylglucosaminyltransferase (core 2 GnT)1 (12-14). This enzyme transfers a GlcNAc residue to a GalNAc residue on the core 1 O-glycan structure, creating the core 2 branch (15). Subsequently, repeating lactosamine sequences can be added to this branch (16, 17). The beta -1,6-N-acetylglucosaminyltransferase V enzyme (GnT V) can regulate the formation of linear polylactosamine chains on N-glycans (18). The GnT V enzyme transfers a GlcNAc to a mannose residue on the trimannosyl core of N-linked glycans, creating a branched acceptor on which polylactosamine can be added to either the GlcNAcbeta -1,2-Man or GlcNAcbeta -1,6-Man sequences (19-22). In the human thymus, expression of the core 2 GnT is largely restricted to cortical thymocytes (23). In contrast, GnT V is expressed in all subsets of human thymocytes.2 Expression of the core 2 GnT has also been shown to regulate leukocyte function in the periphery. T lymphocytes from core 2 GnT transgenic mice demonstrated reduced immune responses, resulting from alterations in cell-cell interactions (24). In addition, recent work has found that the epitope created by the core 2 GnT is not detected on naive peripheral T cells but is expressed at high levels on antigen-specific effector T cells following an immune response. This epitope is not detected on antigen-specific memory T cells, suggesting that core 2 GnT expression is important in discriminating between effector and memory T cells (25). However, the precise functions of the core 2 GnT and GnT V in thymocyte development have not been elucidated.


View larger version (10K):
[in this window]
[in a new window]
  		Scheme 1.   Linear polylactosamine sequences can be found on O-linked and N-linked glycans. A, the creation of linear polylactosamine units on O-glycans is primarily dependent on the activity of the core 2 GnT. The core 2 GnT enzyme transfers a GlcNAc to the GalNAc on core 1 O-glycans, creating the core 2 branch. Multiple lactosamine units are then added to the core 2 branch. B, GnT V is largely responsible for the creation of linear polylactosamine units on N-glycans. GnT V transfers a GlcNAc to a mannose residue on the trimannosyl core, allowing for the subsequent addition of polylactosamine sequences. The sites of the core 2 GnT and GnT V activities are indicated by bold arrows.

Although it is clear that galectin-1 preferentially binds to polylactosamine sequences, it is not known whether N-linked or O-linked polylactosamine sequences on T cell surface glycoproteins participate in galectin-1 apoptosis. Because the core 2 GnT and GnT V can both create the oligosaccharide scaffolds on which polylactosamine units can be added, we asked whether expression of these two enzymes regulates the susceptibility of T cells to galectin-1. To examine the roles of the core 2 GnT and GnT V in galectin-1 apoptosis, we used two murine cell lines, the BW5147 T cell lymphoma and a derivative of this line, PHAR2.1. The PHAR2.1 cell line was generated by mutagenesis and selection for resistance to the cytotoxic lectin phaseolus agglutinin-L that recognizes the oligosaccharide structure generated by GnT V (26). BW5147 cells have high levels of GnT V activity, whereas PHAR2.1 cells lack GnT V activity (27). Conversely, we have found that PHAR2.1 cells express the core 2 GnT, whereas BW5147 cells do not. These two cell lines allowed us to begin to define the oligosaccharide structures required for galectin-1-induced apoptosis.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Reagents and Cells-- Galectin-1 was prepared as described previously (6).

The BW5147.3 (BW5147) cell line was purchased from ATCC (Manassas, VA). The PHAR2.1 cell line was the gift of Dr. Michael Pierce (University of Georgia, Athens, GA). The murine BW5147 and PHAR2.1 T cell lines were cultured in DMEM supplemented with 10% fetal calf serum, 2 mM L-glutamine, 100 units/ml penicillin, 0.1 mg/ml streptomycin, and 1 mM minimum Eagle's medium/sodium pyruvate solution. Cells were grown at 37 °C with 10% CO2.

For phenotypic analysis by flow cytometry, BW5147, PHAR2.1, and core 2 GnT-transfected cells were suspended in 2% bovine serum albumin, 0.01 M phosphate buffer, 0.15 M NaCl, pH 7.5 (PBA) and incubated with 1B11 antibody (anti-mouse CD43, high molecular weight, activation-associated form), S7 antibody (anti-mouse CD43, low molecular weight form), or rat IgG2a isotype control (PharMingen, San Diego, CA). The 1B11 antibody was conjugated to either FITC or PE. Antibodies were used at concentrations recommended by the manufacturer. Cells were washed in cold PBA and resuspended in PBA containing 2 µg/ml 7-aminoactinomycin D (7AAD; Molecular Probes, Eugene, OR). Cells were immediately analyzed on a Becton Dickinson FACScan flow cytometer.

To assess the level of 1B11 expression on double positive (DP) thymocytes, thymocytes were harvested from mice, single cell suspensions were prepared, and thymocytes were incubated with PE-conjugated 1B11 antibody, FITC-conjugated anti-CD4 (anti-L3T4) antibody, and allophycocyanin-conjugated anti-CD8 (anti-Lyt-2.2) antibody (PharMingen). Thymocytes were washed in cold PBA and resuspended in PBA containing 2 µg/ml 7AAD, and 10,000 cells were immediately acquired on a Becton Dickinson FACS caliber. Cells were gated on viable CD8+, CD4+ cells.

The Lck-mC2GnT transgenic mice, overexpressing the core 2 GnT in T cells, were on the FVB/N background and were described previously (24). Age-matched, wild-type FVB/N mice were used as controls. The core 2 GnT transgenic mice used in this study were 5-8 weeks old.

Galectin-1 Apoptosis Assays-- The BW5147 and PHAR2.1 cell lines were treated with galectin-1 as described previously with the following modifications (4, 6). Briefly, 105 cells were incubated with 20 µM galectin-1 in 1.6 mM dithiothreitol/DMEM or in 1.6 mM dithiothreitol/DMEM alone as a control for 4-8 h at 37 °C. 0.1 M beta -lactose (final concentration) was added to dissociate galectin-1 from the cells, and cells were washed with 0.01 M phosphate buffer, pH 7.5, 0.15 M NaCl. Apoptotic cells were identified using annexin V and propidium iodide according to the manufacturer's instructions (R & D Systems, Minneapolis, MN). Samples were analyzed on a FACScan flow cytometer. In glycosylation inhibition experiments, cells were cultured for 68-72 h with 2 mM benzyl-alpha -GalNAc (Sigma) in 0.2% Me2SO/DMEM or with 0.2% Me2SO/DMEM as a control. Cells were then treated with galectin-1 as described above.

Murine thymocytes were harvested, and single cell suspensions were prepared. Cells were incubated with galectin-1 for 5-6 h at 37 °C. Thymocytes were resuspended in 0.1 M beta -lactose; washed once with 0.01 M phosphate buffer, pH 7.5, 0.15 M NaCl; and incubated with FITC-conjugated anti-mouse CD8 (anti-Lyt-2.2) and PE-conjugated anti-mouse CD4 (anti-L3T4) (PharMingen) for 30 min at 4 °C. Antibodies were used at concentrations recommended by the manufacturer. To detect viable cells, thymocytes were incubated with 2 µg/ml 7AAD. Thymocytes were immediately analyzed by flow cytometry on a Becton Dickinson FACScan cytometer. 5,000 or 10,000 cells were acquired for each sample.

Reverse Transcriptase-PCR Analysis-- First strand cDNA synthesis was performed using the Ready to Go T-primed first strand kit (Amersham Pharmacia Biotech) using 5 µg of total RNA from either BW5147 cells or PHAR2.1 cells as template. cDNA was amplified by PCR using primers that were designed based on the core 2 GnT cDNA sequence: (sense) 5'AGCCTGCTGGGACATGTCATC3' and (antisense) 5'CCTGATGAAAGAGGCACAGTCA3' (28) (GenBankTM accession number U19265). PCR was performed using the PCR-Script Amp cloning kit (Stratagene, La Jolla, CA). The PCR conditions were as follows: 35 cycles of 94 °C for 45 s, 60 °C for 45 s, and 72 °C for 1.5 min. Equal amounts of PCR product were run on a 2% agarose gel.

Transfection-- Murine core 2 GnT cDNA was subcloned into the PstI and XbaI site of the pcDNA3.1/Zeo(+) vector (Invitrogen, Carlsbad, CA) (24). BW5147 cells were transfected with the vector containing the core 2 GnT cDNA or with vector only by standard electroporation methods. 10-15 µg of linearized vector was added to cells contained in electroporation cuvettes, and cells were pulsed for 1 s with a voltage/capacitance setting of 330 V/1000 millifarads using an Invitrogen Electroporator II. Cells were added to 20 ml of complete DMEM and cultured for 2 days. Cells were split 1:10 into fresh DMEM containing Zeocin (final concentration of 500 µg/ml) to select for transfectants. Cells were washed with selective media every 3 days. Individual clones were isolated by limiting dilution.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

T Cells That Are Susceptible to Galectin-1-induced Apoptosis Express Core 2 O-linked Oligosaccharides-- Because galectin-1 preferentially binds to polylactosamine sequences in solution, we asked whether polylactosamine sequences on T cell surface glycoproteins are important for galectin-1-induced death. We examined two murine T cell lines to determine whether differential expression of two key enzymes that regulate the expression of polylactosamine also regulates susceptibility to galectin-1-induced apoptosis. As previously shown, BW5147 cells express GnT V, whereas PHAR2.1 cells do not express GnT V (27). Unexpectedly, we found that BW5147 and PHAR2.1 cells also differed in expression of the core 2 GnT. PHAR2.1 cells displayed a high level of binding of the 1B11 antibody (Fig. 1A). The 1B11 antibody recognizes an epitope on O-glycans created by the core 2 GnT on CD43 (29, 30). In contrast, there was negligible binding of 1B11 to parental BW5147 cells. In addition, reverse transcriptase-PCR analysis confirmed that PHAR2.1 cells expressed core 2 GnT mRNA, whereas core 2 GnT mRNA was not detected in BW5147 cells (Fig. 1B).


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 1.   Core 2 GnT expression correlates with galectin-1 susceptibility, whereas GnT V expression is not required for galectin-1 apoptosis. A, PHAR2.1 cells express core 2 O-glycans, whereas BW5147 cells do not. Cells were stained with PE-conjugated 1B11 antibody and analyzed by flow cytometry. The 1B11 antibody, which binds an epitope created by the core 2 GnT on CD43, was used to detect the presence of core 2 O-glycans. B, reverse transcriptase-PCR analysis demonstrates core 2 GnT mRNA expression in the PHAR2.1 cell line. Core 2 GnT mRNA was not detected in BW5147 cells. The primers used predict an amplification product of 512 base pairs, which is seen in the lane containing the PHAR2.1 sample. beta -Actin expression was used to monitor the efficiency of the reverse transcriptase-PCRs and to ensure equal amounts of starting RNA. C, galectin-1 induces apoptosis of PHAR2.1 cells but not BW5147 cells. Cells were incubated with 20 µM galectin-1 or buffer control and analyzed as described under "Experimental Procedures." Percent apoptosis was determined by calculating the quotient of the percent annexin V-negative cells in the galectin-1-treated samples divided by the percent annexin V negative cells in the buffer control samples, subtracting from 1, and multiplying by 100. Error bars indicate the S.D. of triplicate determinations. The results shown are from three representative experiments in which cells were incubated with galectin-1 for 4, 6, or 8 h.

To determine whether expression of the core 2 GnT or GnT V was necessary for galectin-1-mediated death, we examined the BW5147 and PHAR2.1 cell lines for susceptibility to galectin-1 apoptosis. BW5147 cells and PHAR2.1 cells were incubated with galectin-1 or control buffer for 4 h, and the degree of apoptosis was assessed using annexin V and propidium iodide. As shown in Fig. 1C, galectin-1 induced apoptosis of 40-70% of the PHAR2.1 cells after 4-8 h of incubation. In contrast, galectin-1 induced apoptosis of less than 10% of BW5147 cells. These results indicated that the oligosaccharide created by GnT V on N-glycans is not necessary for galectin-1-mediated death in these cell lines, because PHAR2.1 cells, which do not express GnT V, were susceptible to galectin-1. However, these data suggested that the oligosaccharide branch created by the core 2 GnT on O-glycans, which is expressed by PHAR2.1 cells and not by BW5147 cells, is important for galectin-1-induced apoptosis.

O-Glycans Are Necessary for Galectin-1-induced Apoptosis of the PHAR2.1 Cell Line-- To determine whether O-glycans are necessary for galectin-1-mediated apoptosis, we inhibited O-linked glycosylation with benzyl-alpha -GalNAc (6) and examined treated cells for susceptibility to galectin-1. PHAR2.1 cells treated with benzyl-alpha -GalNAc had reduced 1B11 binding, demonstrating that O-glycosylation was inhibited in these cells (data not shown). The loss of O-glycosylation correlated with a loss of galectin-1 sensitivity of PHAR2.1 cells. As shown in Fig. 2, there was a marked decrease (greater than 90%) in galectin-1-induced apoptosis of PHAR2.1 cells cultured with benzyl-alpha -GalNAc compared with PHAR2.1 cells cultured without the inhibitor. In contrast, inhibition of O-glycan processing in BW5147 cells had little effect on the cells' susceptibility to galectin-1-induced death. These results demonstrated that O-glycans are important for galectin-1-induced apoptosis of PHAR2.1 cells. In addition, these results suggested that it is the core 2 O-glycans, which are abundant on PHAR2.1 cells but not on BW5147 cells, that are required for galectin-1-mediated apoptosis.


View larger version (13K):
[in this window]
[in a new window]
  		Fig. 2.   Decreased susceptibility of PHAR2.1 cells to galectin-1 apoptosis as a result of inhibiting O-glycan processing. Cells were cultured for 65-72 h with benzyl-alpha -GalNAc to inhibit O-linked elongation. Percent apoptosis was determined as described in Fig. 1. The error bars indicate the S.D. of triplicate determinations. The results shown are from two representative experiments (E1 and E2). DMSO, dimethyl sulfoxide.

Core 2 GnT Expression Is Necessary for Galectin-1-induced Death of the BW5147 Cell Line-- Because expression of the oligosaccharide created by the core 2 GnT correlated with susceptibility to galectin-1-induced apoptosis, we asked whether the expression of the core 2 GnT enzyme was sufficient to render BW5147 cells susceptible to galectin-1. BW5147 cells were transfected with a vector containing core 2 GnT cDNA or with vector alone (mock transfectant). Stable transfectants were selected by antibiotic resistance. Selected clones were examined for expression of core 2 O-glycans using the 1B11 antibody. As shown in Fig. 3A, BW5147 transfected cells (clone 2B) demonstrated increased binding of the 1B11 antibody compared with parental BW5147 cells. Mock transfectants demonstrated 1B11 binding at a level comparable with that seen for parental BW5147 cells.


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 3.   Core 2 GnT expression confers galectin-1 susceptibility in the BW5147 cell line. A, core 2 GnT-transfected BW5147 cells (clone 2B) demonstrated increased binding of the 1B11 antibody compared with BW5147 cells, indicating that the transfectants express the core 2 GnT. Mock cells, transfected with the vector only, did not bind increased levels of the 1B11 antibody. BW5147, PHAR2.1, mock transfected, and core 2 GnT-transfected cells were incubated with FITC-conjugated 1B11 or IgG isotype control antibody and analyzed by flow cytometry. B, the core 2 GnT-transfected BW5147 cells (clones 2A and 2B) were as susceptible to galectin-1-induced apoptosis as the PHAR2.1 cells. Note that mock transfected BW5147 cells remained insensitive to galectin-1. Percent apoptosis was determined as described in Fig. 1. The data graphed represent the average of 3-5 experiments, and the error bars represent the S.E.

Two independent clonal isolates of the core 2 GnT-transfected BW5147 cells, clones 2A and 2B, were tested for susceptibility to galectin-1-induced death. There was a dramatic increase in galectin-1-mediated apoptosis in the core 2 GnT transfected cells compared with the mock transfectants (Fig. 3B). After 4 h, galectin-1 induced apoptosis in 27 and 31% of the 2A cells and 2B cells, respectively, whereas less than 6% of the mock transfectants underwent galectin-1-induced apoptosis. Although the level of 1B11 staining of the core 2 GnT transfectants was less than that of the PHAR2.1 cells, the level of expression of the core 2 GnT in the transfectant cells was sufficient to render the cells susceptible to galectin-1 apoptosis.

Overexpression of the Core 2 GnT in Murine Thymocytes Results in Increased Galectin-1-induced Apoptosis-- Our group has previously shown that the core 2 GnT is highly expressed in the cortex of the human thymus, whereas there is minimal expression of the core 2 GnT in the medulla (23). Further, the majority of human and murine DP thymocytes express high levels of core 2 O-glycans, whereas single positive (SP) thymocytes do not (23, 29, 31). As shown in Fig. 4A, approximately 75% of DP thymocytes expressed the 1B11 epitope. Expression of the core 2 GnT in the DP thymic population correlates with susceptibility to galectin-1 apoptosis since human and murine DP thymocytes are most susceptible to galectin-1-mediated death (4, 5).


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 4.   Overexpression of the core 2 GnT rendered a subset of DP thymocytes susceptible to galectin-1 apoptosis. A, a fraction of DP thymocytes from wild-type mice does not express the epitope created by the core 2 GnT. Thymocytes from wild-type mice were incubated with PE-conjugated 1B11 antibody, FITC-conjugated anti-CD4 antibody, and allophycocyanin-conjugated anti-CD8 antibody. The DP thymocytes were gated (not shown), and the gated cells were analyzed for 1B11 expression. B, all thymocytes from core 2 GnT transgenic mice express core 2 O-glycans. Thymocytes from core 2 GnT and wild-type mice were incubated with FITC-conjugated 1B11 antibody and analyzed by flow cytometry. C, galectin-1 induced the death of a greater number of DP thymocytes from the core 2 GnT transgenic mice (67%) compared with wild-type mice (48%). However, SP thymocytes from both wild-type and core 2 GnT transgenic mice remained insensitive to galectin-1 apoptosis. The absolute number of cells in each subset is shown in each quadrant. D, results from three independent experiments showed that galectin-1 induced a greater percent cell loss of DP thymocytes from the core 2 GnT transgenic mice compared with DP thymocytes from wild-type mice. 2-3 core 2 GnT transgenic and wild-type mice were used in each experiment. In both C and D, single thymocyte suspensions were prepared, and the cells were incubated with galectin-1 for 6 h. Thymocytes were labeled with FITC-conjugated anti-CD8 and PE-conjugated anti-CD4 antibodies, and 7AAD uptake was used to detect viable cells. Nonviable cells were excluded from the data shown by selective gating on 7AAD negative cells. 70-80% of thymocytes from age-matched FVB/N wild-type mice and transgenic mice were CD4+CD8+ double positive (data not shown). The percent cell loss was determined by dividing the difference in the number of viable double positive thymocytes from the galectin-1-treated samples and the control treated sample by the number of viable double positive thymocytes from the control treated sample and multiplying by 100.

To investigate whether increased expression of the core 2 GnT in vivo would regulate susceptibility to galectin-1-mediated cell death, we examined thymocytes from core 2 GnT transgenic mice. In these mice, core 2 GnT expression is regulated by the Lck promoter so that overexpression of the core 2 GnT is limited to thymocytes and T cells (24). As shown in Fig. 4B, there is a high level of expression of the 1B11 epitope on all thymocytes from the core 2 GnT transgenic mice. To investigate whether core 2 GnT overexpression affected susceptibility to galectin-1, thymocytes from the core 2 GnT transgenic mice and wild-type mice were incubated with galectin-1 or control buffer, and the number of viable DP and SP thymocytes in the galectin-1-treated samples and the control samples was determined. As shown in Fig. 4C, there was no significant galectin-1-induced cell loss of SP thymocytes from either the wild-type or the core 2 GnT mice. However, analysis of the DP thymocyte population demonstrated that galectin-1 eliminated a greater percentage of the DP thymocytes from the transgenic mice (67% cell loss) than from the wild-type mice (48% cell loss). In three independent experiments, we observed a 20-60% increase in the level of galectin-1-induced apoptosis in the DP thymocyte population from the core 2 GnT transgenic mice compared with that in the DP thymocyte population from wild-type mice (Fig. 4D). Thus, overexpression of the core 2 GnT resulted in increased susceptibility of DP thymocytes to galectin-1 but did not affect the susceptibility of SP thymocytes to galectin-1.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

There are several factors that may regulate susceptibility to galectin-1-induced cell death. First, differential expression of the glycosyltransferases that create the oligosaccharide structure(s) recognized by galectin-1 will modulate the susceptibility of cells to galectin-1. Glycosylation may control other forms of cell death as well. Keppler et al. (32) showed that expression of the alpha -2,6-sialyltransferase regulated the susceptibility of B cell lines to Fas-induced apoptosis. Second, the oligosaccharide structures created by the glycosyltransferases must be linked to glycolipids or glycoproteins on the T cell surface that can transduce the death signal. Finally, the T cell must express the internal components of the apoptotic machinery for the galectin-1 death signal to be sent to completion.

The aim of the present study was to identify the oligosaccharide ligands that participate in the transduction of the galectin-1 death signal by focusing on the enzymes that regulate polylactosamine synthesis, GnT V and the core 2 GnT. As shown in Fig. 1C, BW5147 cells that did not express the core 2 GnT were not susceptible to galectin-1. In contrast, PHAR2.1 cells that expressed the core 2 GnT were highly susceptible to galectin-1. By 8 h, greater than 70% of cells died in response to galectin-1. Inhibition of O-glycan processing in PHAR2.1 cells resulted in a dramatic decrease in galectin-1-mediated death. Finally, overexpression of the core 2 GnT in BW5147 cells was sufficient to make these cells susceptible to galectin-1-induced death. These data demonstrated that the ligand created by the core 2 GnT is necessary for galectin-1-induced apoptosis in these murine T cell lines.

The core 2 GnT is an intriguing candidate for regulating T cell susceptibility to galectin-1 during development in the thymus and as T cells function in the periphery. The core 2 GnT is highly expressed in DP thymocytes and activated peripheral T cells (23, 29, 31, 33), the two populations of T lymphocytes that are susceptible to galectin-1 (4-6). As shown in Fig. 4 (C and D), we found increased galectin-1-induced cell death of DP thymocytes from the core 2 GnT transgenic mice compared with DP thymocytes from wild-type mice. This indicated that expression of the core 2 GnT could confer galectin-1 susceptibility to a subset of DP thymocytes. However, SP thymocytes from core 2 GnT transgenic mice remained insensitive to galectin-1 apoptosis. Therefore, expression of the core 2 GnT alone is not sufficient to render mature thymocytes susceptible to galectin-1 apoptosis.

These data reveal that the regulation of galectin-1 susceptibility occurs at several cellular levels. Because overexpression of the core 2 GnT in mature SP thymocytes did not render these cells susceptible to galectin-1, SP thymocytes may not have the internal apoptotic machinery required for galectin-1-induced cell death. The intracellular galectin-1 death pathway may be blocked at some point, or a separate anti-apoptotic signal could override the galectin-1 death message.

In contrast, DP thymocytes have the internal apoptotic pathway required for galectin-1-mediated cell death. If DP thymocytes express the core 2 GnT, galectin-1 binding can trigger the death pathway. However, in wild-type mice, a subset of DP thymocytes does not express the core 2 GnT and thus may not synthesize an essential galectin-1 ligand. Ellies et al. (31) have shown that expression of the core 2 GnT is down-regulated during positive selection of murine thymocytes. When we examined DP thymocytes from wild-type mice for expression of core 2 O-glycans, there was a small population of DP thymocytes (approximately 25%) that had diminished expression of core 2 O-glycans (Fig. 4A). This fraction is roughly equivalent to the fraction of thymocytes from the core 2 GnT transgenic mice demonstrating increased susceptibility to galectin-1 (Fig. 4C). These data indicate that there is a subset of DP thymocytes that remains susceptible to galectin-1 if the saccharide ligand created by the core 2 GnT is expressed. Thus, our results suggest that in thymic development there is a narrow developmental window during which loss of core 2 GnT expression precedes down-regulation of the galectin-1 apoptotic machinery. The 20-60% increase in galectin-1-induced cell death of the DP thymocytes from the core 2 GnT mice compared with that from wild-type mice (Fig. 4, C and D) may appear modest. However, this difference could have a significant biological effect during the selection process, where the additional loss of DP thymocytes could adversely impact the total repertoire.

Expression of specific T cell surface glycoproteins containing the core 2 O-linked oligosaccharides may be another factor regulating galectin-1-mediated apoptosis. The core 2 GnT is known to modify oligosaccharide structures on a number of T cell glycoproteins including CD43 and CD45 (30, 34). CD45 and CD43 are heavily glycosylated proteins that are expressed at high levels on the surface of the BW5147 and PHAR2.1 cell lines (data not shown). Furthermore, regulated changes in the oligosaccharide structures that decorate CD45 and CD43 have been shown to occur during thymic development and T cell activation in the periphery (23, 31, 35). We have recently shown that CD45 and CD43 are receptors for galectin-1 on T cells (36). Addition of core 2 O-glycans to CD45 or CD43 may allow the cross-linking and movement of these glycoproteins on the cell surface that occurs following galectin-1 binding (36).

The core GnT appears to play an important role in many immune processes. Expression of the core 2 GnT enzyme has recently been shown to be necessary for proper function of the innate immune system, since this enzyme can also regulate synthesis of ligands for the selectin family of cell adhesion molecules (37). Disregulation of core 2 GnT expression has been observed in several immune disorders, such as Wiskott-Aldrich syndrome, leukemia, and AIDS (38-42). Mukasa et al. (43) have recently found that core 2 GnT expression is increased on a subset of human peripheral T cells compared with naive T cells. Importantly, the 1B11 antibody, which recognizes an epitope created by the core 2 GnT, appears to discriminate effector T cells from memory T cells (25). This implies that core 2 GnT activity is high in effector cells but low in memory cells (26). The expression of core 2 O-glycans on effector cells may contribute to the elimination of these cells by galectin-1 following an immune response, whereas memory T cells that lack core 2 O-glycans would escape galectin-1-mediated death. Work is under way in our laboratory to address this. Differential expression of the core 2 GnT may regulate the susceptibility of T cells to apoptosis both during thymic development and during an immune response in the periphery.

    ACKNOWLEDGEMENTS

We thank Ingrid Schmid and Nathan Regimbal of the Flow Cytometry Core Laboratory at UCLA for technical assistance.

    Note Added in Proof

Recent studies have demonstrated increased expression of core 2 O-glycans associated with increased apoptosis of CD8 T cells in ST3Gal I-deficient mice (Priatel, J. J., Chui, D., Hiraoka, N., Simmons, C. J. T., Richardson, K. B., Page, D. M., Fukuda, M., Varki, N. M., and Marth, J. D. (2000) Immunity 12, 273-283).

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grants R37CA33000 (to M. F.) and R01AI40118 (to L. G. B.), Grant RPG-97-049-01 from the American Cancer Society (to L. G. B.), and a Glycoscience Research Award from Neose Technologies (to L. G. B.). Work performed in the Flow Cytometry Core Laboratory was supported in part by the Jonsson Comprehensive Cancer Center Core Grant NIH-CA16042.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by National Institutes of Health Grant CA09120-21.

|| To whom correspondence should be addressed: Dept. of Pathology and Laboratory Medicine, UCLA School of Medicine, 10833 Le Conte Ave., Los Angeles, CA 90095. Tel.: 310-206-5985; Fax: 310-206-0657; E-mail: lbaum@mednet.ucla.edu.

Published, JBC Papers in Press, March 20, 2000, DOI 10.1074/jbc.M001117200

2 M. Pang, M. Pierce, and L. G. Baum, unpublished data.

    ABBREVIATIONS

The abbreviations used are: core 2 GnT, core 2 beta -1,6-N-acetylglucosaminyltransferase; GnT V, beta -1,6-N-acetylglucosaminyltransferase V; DMEM, Dulbecco's modified Eagle's medium; PBA, phosphate-buffered saline with 2% bovine serum albumin; FITC, fluorescein isothiocyanate; PE, phosphatidylethanolamine; 7AAD, 7-aminoactinomycin D; DP, double positive; SP, single positive; PCR, polymerase chain reaction.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Jameson, S. C., and Bevan, M. J. (1998) Curr. Opin. Immunol. 10, 214-219
2. Saito, T., and Watanabe, N. (1998) Crit. Rev. Immunol. 18, 359-370
3. Kisielow, P., and von Boehmer, H. (1995) Adv. Immunol. 58, 87-209
4. Perillo, N. L., Uittenbogaart, C. H., Nguyen, J. T., and Baum, L. G. (1997) J. Exp. Med. 185, 1851-1858
5. Vespa, G. N. R., Lewis, L., Kozak, K. R., Moran, M., Nguyen, J. T., Baum, L. G., and Miceli, M. C. (1999) J. Immunol. 162, 799-806
6. Perillo, N. L., Pace, K. E., Seilhamer, J. J., and Baum, L. G. (1995) Nature 378, 736-738
7. Merkle, R. K., and Cummings, R. D. (1988) J. Biol. Chem. 263, 16143-16149
8. Oda, Y., and Kasai, K. (1984) Biochem. Biophys. Res. Commun. 123, 1215-1220
9. Sparrow, C. P., Leffler, H., and Barondes, S. H. (1987) J. Biol. Chem. 262, 7383-7390
10. Barondes, S. H., Cooper, D. N., Gitt, M. A., and Leffler, H. (1994) J. Biol. Chem. 269, 20807-20810
11. Di Virgilio, S., Glushka, J., Moremen, K., and Pierce, M. (1999) Glycobiology 9, 353-364
12. Fukuda, M., Carlsson, S. R., Klock, J. C., and Dell, A. (1986) J. Biol. Chem. 261, 12796-12800
13. Bierhuizen, M. F., Maemura, K., and Fukuda, M. (1994) J. Biol. Chem. 269, 4473-4479
14. Yousefi, S., Higgins, E., Daoling, Z., Pollex-Krüger, A., Hindsgaul, O., and Dennis, J. W. (1991) J. Biol. Chem. 266, 1772-1782
15. Schachter, H., and Brockhausen, I. (1992) in Glycoconjugates: Composition, Structure and Function (Allen, H. J. , and Kisalius, E. C., eds) , pp. 263-332, Marcel Dekker, Inc., New York
16. Maemura, K., and Fukuda, M. (1992) J. Biol. Chem. 267, 24379-24386
17. Ujita, M., McAuliffe, J., Schwientek, T., Almeida, R., Hindsgaul, O., Clausen, H., and Fukuda, M. (1998) J. Biol. Chem. 273, 34843-34849
18. Shoreibah, M. G., Peng, G. S., Adler, B., Weinstein, J., Basu, R., Cupples, R., Wen, D., Browne, J. D., Buckhaults, P., Fregien, N., and Pierce, M. (1993) J. Biol. Chem. 268, 15381-15385
19. Ujita, M., McAuliffe, J., Hindsgaul, O., Sasaki, K., Fukuda, M. N., and Fukuda, M. (1999) J. Biol. Chem. 274, 16717-16726
20. Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S., and Kobata, A. (1984) J. Biol. Chem. 259, 10834-10840
21. van den Eijnden, D. H., Koenderman, A. H. L., and Schiphorst, W. E. C. M. (1988) J. Biol. Chem. 263, 12461-12471
22. Do, K. Y., Fregien, N., Pierce, M., and Cummings, R. D. (1994) J. Biol. Chem. 269, 23456-23464
23. Baum, L. G., Pang, M., Perillo, N. L., Wu, T., Delegeane, A., Uittenbogaart, C., Fukuda, M., and Seilhamer, J. J. (1995) J. Exp. Med. 181, 877-886
24. Tsuboi, S., and Fukuda, M. (1997) EMBO J. 16, 6364-6373
25. Harrington, L. E., Galvan, M., Baum, L. G., Altman, J. D., and Ahmed, R. (2000) J. Exp. Med. 191, 1241-1246
26. Trowbridge, I., Hyman, R., Ferson, T., and Mazauskas, C. (1978) Eur. J. Immunol. 8, 716-723
27. Cummings, R. D., Trowbridge, I. S., and Kornfeld, S. (1982) J. Biol. Chem. 257, 13421-13427
28. Sekine, M., Nara, K., and Suzuki, A. (1997) J. Biol. Chem. 272, 27246-27252
29. Tomlinson-Jones, A., Federsppiel, B., Ellies, L. G., Williams, M. J., Burgener, R., Duronio, V., Smith, C. A., Takei, F., and Ziltener, H. J. (1994) J. Immunol. 153, 3426-3439
30. Carlow, D. A., Ardman, B., and Ziltener, H. J. (1999) J. Immunol. 163, 1441-1448
31. Ellies, L. G., Tao, W., Fellinger, W., Teh, H.-S., and Ziltener, H. J. (1996) Blood 88, 1725-1732
32. Keppler, O. T., Peter, M. E., Hinderlich, G. M., Stehling, P., Schmitz, I., Schwartz-Albiez, R., Reutter, W., and Pawlita, M. (1999) Glycobiology 9, 557-569
33. Piller, F., Piller, V., Fox, R. I., and Fukuda, M. (1988) J. Biol. Chem. 263, 15146-15150
34. Barran, P., Fellinger, W., Warren, C. E., Dennis, J. W., and Ziltener, H. J. (1997) Glycobiology 7, 129-136
35. Baum, L. G., Derbin, K., Perillo, N. L., Wu, T., Pang, M., and Uittenbogaart, C. (1996) J. Biol. Chem. 271, 10793-10799
36. Pace, K. E., Lee, C., Stewart, P. L., and Baum, L. G. (1999) J. Immunol. 163, 3801-3811
37. Ellies, L. G., Tsuboi, S., Petryniak, B., Lowe, J. B., Fukuda, M., and Marth, J. D. (1998) Immunity 9, 881-890
38. Piller, F., Le Deist, F., Weinberg, K., Parkman, R., and Fukuda, M. (1991) J. Exp. Med. 173, 1501-1510
39. Higgins, E. A., Siminovitch, K. A., Zhuang, D., Brockhausen, I., and Dennis, J. W. (1991) J. Biol. Chem. 266, 6280-6290
40. Saitoh, O., Piller, F., Fox, R. I., and Fukuda, M. (1991) Blood 77, 1491-1499
41. Fox, R. I., Hueniken, M., Fong, S., Behar, S., Royston, I., Singhal, S. K., and Thompson, L. (1983) J. Immunol. 131, 762-767
42. Brockhausen, I., Kuhns, W., Schachter, H., Matta, K. L., Sutherland, D. R., and Baker, M. A. (1991) Cancer Res. 51, 1257-1263
43. Mukasa, R., Homma, T., Ohtsuki, T., Hosono, O., Souta, A., Kitamura, T., Fukuda, M., Watanabe, S., and Morimoto, C. (1999) Int. Immunol. 11, 417-426

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
S. Bi, L. A. Earl, L. Jacobs, and L. G. Baum
Structural Features of Galectin-9 and Galectin-1 That Determine Distinct T Cell Death Pathways
J. Biol. Chem., May 2, 2008; 283(18): 12248 - 12258.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. R. Stowell, Y. Qian, S. Karmakar, N. S. Koyama, M. Dias-Baruffi, H. Leffler, R. P. McEver, and R. D. Cummings
Differential Roles of Galectin-1 and Galectin-3 in Regulating Leukocyte Viability and Cytokine Secretion
J. Immunol., March 1, 2008; 180(5): 3091 - 3102.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
M. V. Tribulatti, J. Mucci, V. Cattaneo, F. Aguero, T. Gilmartin, S. R. Head, and O. Campetella
Galectin-8 Induces Apoptosis in the CD4highCD8high Thymocyte Subpopulation
Glycobiology, December 1, 2007; 17(12): 1404 - 1412.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
J. D. Hernandez, J. Klein, S. J. Van Dyken, J. D. Marth, and L. G. Baum
T-cell activation results in microheterogeneous changes in glycosylation of CD45
Int. Immunol., July 2, 2007; (2007) dxm053v1.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
H. F. Valenzuela, K. E. Pace, P. V. Cabrera, R. White, K. Porvari, H. Kaija, P. Vihko, and L. G. Baum
O-Glycosylation Regulates LNCaP Prostate Cancer Cell Susceptibility to Apoptosis Induced by Galectin-1
Cancer Res., July 1, 2007; 67(13): 6155 - 6162.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
H. Walzel, A. A. Fahmi, M. A. Eldesouky, E. F. Abou-Eladab, G. Waitz, J. Brock, and M. Tiedge
Effects of N-glycan processing inhibitors on signaling events and induction of apoptosis in galectin-1-stimulated Jurkat T lymphocytes
Glycobiology, December 1, 2006; 16(12): 1262 - 1271.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
I. Camby, M. Le Mercier, F. Lefranc, and R. Kiss
Galectin-1: a small protein with major functions
Glycobiology, November 1, 2006; 16(11): 137R - 157R.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. D. Hernandez, J. T. Nguyen, J. He, W. Wang, B. Ardman, J. M. Green, M. Fukuda, and L. G. Baum
Galectin-1 Binds Different CD43 Glycoforms to Cluster CD43 and Regulate T Cell Death
J. Immunol., October 15, 2006; 177(8): 5328 - 5336.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
P. V. Cabrera, M. Amano, J. Mitoma, J. Chan, J. Said, M. Fukuda, and L. G. Baum
Haploinsufficiency of C2GnT-I glycosyltransferase renders T lymphoma cells resistant to cell death
Blood, October 1, 2006; 108(7): 2399 - 2406.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. J. Perone, A. T. Larregina, W. J. Shufesky, G. D. Papworth, M. L. G. Sullivan, A. F. Zahorchak, D. B. Stolz, L. G. Baum, S. C. Watkins, A. W. Thomson, et al.
Transgenic galectin-1 induces maturation of dendritic cells that elicit contrasting responses in naive and activated T cells.
J. Immunol., June 15, 2006; 176(12): 7207 - 7220.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
S. K. Patnaik, B. Potvin, S. Carlsson, D. Sturm, H. Leffler, and P. Stanley
Complex N-glycans are the major ligands for galectin-1, -3, and -8 on Chinese hamster ovary cells
Glycobiology, April 1, 2006; 16(4): 305 - 317.
[Abstract] [Full Text] [PDF]

Home page
 Ann Rheum DisHome page
J M Ilarregui, G A Bianco, M A Toscano, and G A Rabinovich
The coming of age of galectins as immunomodulatory agents: impact of these carbohydrate binding proteins in T cell physiology and chronic inflammatory disorders
Ann Rheum Dis, November 1, 2005; 64(suppl_4): iv96 - iv103.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
S. Hagisawa, C. Ohyama, T. Takahashi, M. Endoh, T. Moriya, J. Nakayama, Y. Arai, and M. Fukuda
Expression of core 2 {beta}1,6-N-acetylglucosaminyltransferase facilitates prostate cancer progression
Glycobiology, October 1, 2005; 15(10): 1016 - 1024.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Mucci, E. Mocetti, M. S. Leguizamon, and O. Campetella
A Sexual Dimorphism in Intrathymic Sialylation Survey Is Revealed by the trans-Sialidase from Trypanosoma cruzi
J. Immunol., April 15, 2005; 174(8): 4545 - 4550.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P. Matarrese, A. Tinari, E. Mormone, G. A. Bianco, M. A. Toscano, B. Ascione, G. A. Rabinovich, and W. Malorni
Galectin-1 Sensitizes Resting Human T Lymphocytes to Fas (CD95)-mediated Cell Death via Mitochondrial Hyperpolarization, Budding, and Fission
J. Biol. Chem., February 25, 2005; 280(8): 6969 - 6985.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Leppanen, S. Stowell, O. Blixt, and R. D. Cummings
Dimeric Galectin-1 Binds with High Affinity to {alpha}2,3-Sialylated and Non-sialylated Terminal N-Acetyllactosamine Units on Surface-bound Extended Glycans
J. Biol. Chem., February 18, 2005; 280(7): 5549 - 5562.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Amado, Q. Yan, E. M. Comelli, B. E. Collins, and J. C. Paulson
Peanut Agglutinin High Phenotype of Activated CD8+ T Cells Results from de Novo Synthesis of CD45 Glycans
J. Biol. Chem., August 27, 2004; 279(35): 36689 - 36697.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
S. R. Stowell, M. Dias-Baruffi, L. Penttila, O. Renkonen, A. K. Nyame, and R. D. Cummings
Human galectin-1 recognition of poly-N-acetyllactosamine and chimeric polysaccharides
Glycobiology, February 1, 2004; 14(2): 157 - 167.
[Abstract] [Full Text] [PDF]