![]()
|
|
||||||||
J. Biol. Chem., Vol. 275, Issue 22, 16758-16766, June 2, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the a Division of Structural Biology and Biochemistry, Hospital for Sick Children, Toronto, Ontario M5G 1L5, Canada, the b Departments of Biochemistry and Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario M5G 1L5, Canada, the e Department of Biology, h Center for Ligand and Transcription, and Hormone Research Center, Chonnam National University, Kwangju 500-757, Korea, and the i Department of Biological Sciences and Tropical Marine Sciences Institute, National University of Singapore, 119260 Singapore
Received for publication, January 6, 2000, and in revised form, February 23, 2000
| |
ABSTRACT |
|---|
|
|
|---|
A zebrafish Ftz-F1 homologue, zFF1A (zebrafish Ff1a or
Nr5a2, a member of nuclear receptor superfamily) and its C-terminally truncated variant (zFF1B) were previously identified. Due to lack of
the identity box (I-box) and activation function 2 (AF-2) domain, zFF1B
lacks transactivation function and fails to synergize with estrogen
receptor (ER) in regulating promoters. It was speculated that the I-box
might be involved in the zFF1A/ER interaction. In the present study,
the function of the I-box was examined. In the absence of the I-box or
with an altered heptad 9, the AF-2 of zFF1A was not functional, either
in the presence or absence of ER. The GST pull-down assay showed that
zFF1A and its mutants exerted similar physical contacts with ER-LBD,
suggesting that the "dimerization" domain (I-box) is essential for
the transcriptional activity of zFF1A. Moreover, nuclear receptor
coactivator selectively activated zFF1 with the I-box but exerted no
effect on zFF1B, indicating that the I-box is able to interact with the
coactivators. By deletion study and analysis of the identified domains
in GAL4-DNA binding domain, other regions of zFF1A critical for its AF
were also delineated. Consistent with the mutation analysis, AF-2 was active only in the presence of the I-box. We also identified a novel AF
domain (AF-3) located in the hinge region (amino acids 155-267),
although the activity of AF-3 was inhibited by its flanking region. We
suggest that the D and E regions of zFF1A possess both positive
and negative transactivation functions, and interdomain "cross-talk" may confer the full transcriptional
activity of the protein.
The nuclear receptor (NR)1 superfamily
comprises a large set of ligand-regulated
transcription factors, whose modular structures provide functional
regions responsible for their activities (1). In general, they contain
an amino-terminal ligand-independent activation domain (region A/B,
or activation function 1 (AF-1)) that is not well conserved among
nuclear receptors; an evolutionarily conserved DNA binding domain
(DBD); a hinge region (region D); and a C-terminal ligand binding
domain (region E or LBD). Region E integrates multiple functions. In
addition to determining the ligand-binding properties of a particular
receptor, this region also specifies its dimerization properties (homo-
versus heterodimerization) and contains a
ligand-dependent transactivation function (activation function 2 (AF-2)). The crystal structures of E regions of several hormone receptors reveal a similar fold in LBDs, which may be a common
property of all NRs (2-4). This newly determined fold, termed the
"antiparallel In addition to a weak dimerization surface defined in DBD, a 40-amino
acid region has been mapped as a dimerization interface (identity box
(I-box)) within the carboxyl portion of LBDs of RAR, TR, COUP, and RXR
(6, 7). Coincidentally, this region matches almost perfectly with a
helical segment formed by H9 and H10, whereas a dimerization interface
is localized mainly in H10 of the LBD crystal structures (2, 4). These
experiments have revived interest in the ninth heptad, because it is
one of the nine heptad repeats that were predicted to organize a
leucine zipper-like structure mediating dimerization in RAR, VDR, and T3R (8-10), and heptad 9 is contained within H10.
For a large number of orphan nuclear receptors, high affinity
endogenous ligands have not been found, although many of them exert
transcriptional activities. Steroidogenic factor 1 (SF-1) belongs to
this group (11-13). SF-1 is a homologue of Drosophila Ftz-F1 (14, 15). Playing a key role in the development and differentiation of the adrenal gland, gonads, ventromedial
hypothalamus, and pituitary gonadotrope (16-20), mouse SF-1 (mSF-1) is
a transcription factor regulating a variety of genes (Ref. 21;
summarized in Ref. 22). Unlike many hormone nuclear receptors, mSF-1
binds to its DNA element as a monomer (23, 24). In addition, transient expression study revealed that truncation of the entire LBD of mSF-1
resulted in a constitutive activator of the Mülerian inhibiting substance gene promoter (17). Thus, the mechanism of mSF-1 in transcription could be different from that of other dimeric nuclear receptors.
Our laboratory previously identified the zebrafish Ftz-F1 homologue,
zFF1A (zebrafish Ff1a or Nr5A2 (25)) and its naturally truncated
variant, zFF1B. The lack of an I-box and AF-2 in zFF1B presumably
abolishes its activity and its failure to act in synergy with
ligand-bound ER on the salmon gonadotropin II Primers Constructs and PCR--
The zFF1A and B cDNAs, from the
original library screening (2), served as the templates for
amplification of their putative open reading frames by PCR, and the
primer 5'(A/B)Bm in combination with either 3'(A)Eo or 3'(B)Eo primer
was employed. The resulted ORF DNA fragments were subcloned into the
eukaryotic expression vector pCDNA3 (Invitrogen, San Diego, CA) at
its BamHI and EcoRI sites and named as A-ORF and
B-ORF. The A-ORF plasmid then served as template for construction of
deletions by PCR. For C-terminal series deletion, the upper strand
primer was 5'(A/B)Bm, and the lower strand primer included primers
1-516, 1-321, and 1-155. As a consequence of PCR and subcloning,
deletions 1-516, 1-321, and 1-155 were obtained. The construction of
the deletion 1-267 included two steps; the zFF1A ORF was first
amplified by primers 5'(A/B)Bm and 3'(A)Hn and ligated into pCDNA3
at the BamHI and EcoRV sites. Next, the resultant
plasmid was treated by HindIII restriction to eliminate a
region between 266 and 516. After ligation, deletion 1-267 was
obtained. For N-terminal deletion, primer
The pG5CAT reporter and pM fusion vector were from a mammalian
two-hybrid assay kit (CLONTECH). 155-516
represents an DNA insert encoding the entire D and E regions of zFF1A,
which was PCR-amplified from zFF1A cDNA by primers (155)Eo/(516)Xa.
To obtain the individual D and E encoding fragments, primers
(155)Eo/(267)Bm and (278)Eo/(516)Xa were employed in the PCRs,
respectively. Primers (436)Bm/(516)Xa and (498)Eo/(516)Xa amplified
I-box plus AF2 and AF-2 fragments, respectively, and ligation of the
I-box plus AF2 and D fragments resulted in the internal deletion of the
N-terminal portion of the E domain. To include Regions II and III with
I-box plus AF2, primers (322)Eo/(516)Xa were used instead of
(436)Bm/(516)Xa. The internal deletion fragment DE
LexA fusion vectors to express ER Yeast Two-hybrid Test--
For the yeast two-hybrid tests,
plasmids encoding LexA fusions and B42 fusions were cotransformed into
Saccharomyces cerevisiae EGY48 strain containing the LacZ
reporter plasmid, SH/18-34 (29). Plate and liquid assays of
GST Pull-down Assay--
The GST-ER Transfection and CAT Assay--
Plasmids such as the reporter
CAT constructs, mSF-1, and rainbow trout ER expression constructs were
reported previously (2, 22, 30, 31). The SRC-1a and TRAM-1 expression
constructs were gifts from Dr. M-J. Tsai (Baylor College of Medicine,
Houston) and Dr. A. Takeshita (Brigham and Women's Hospital, Boston),
respectively. Cell culture, transfection, hormone treatment, and CAT
assay were performed essentially as described previously (22). In
general, 1 µg of transcription factor expression plasmid, 5-10 µg
of CAT reporter plasmid, and 1 µg of pCMV The I-box May Regulate Interaction of zFF1A and ER by Hydrophobic
Contact--
We previously showed that both mSF-1 and zFF1A were able
to synergize with ligand-bound ER to up-regulate sGTHII
Because zFF1B lacked a synergistic interaction with ER, we postulated
that the interaction between zFF1A and ER might be at least partially
mediated by the I-box (6). We compared all vertebrate Ftz-F1 homologues
with other nuclear receptors that can form dimers, in the area of the
last several helices near the C terminus of LBDs (H9-H10, and H12).
Among the known Ftz-F1s, in addition to the completely conserved AF-2
core, the regions corresponding to the I-box are also conserved (Fig.
1). The overall conservation of the I-box
regions between Ftz-F1 homologues and other nuclear receptors is
moderate but is higher in the H10 region, especially in the hydrophobic
region of heptad 9. Comparison of zFF1A heptad 9 with that of other NRs
including ER revealed a high degree of conservation among the 9 amino acids (see boxed region of heptad 9 in
Fig. 1).
Both AF-2 and the I-box Determine the Major Activation Function of
zFF1A--
From cotransfection studies, it appeared that most of the
C-terminal 82 amino acids (positions 434-516) in zFF1A, including the
AF-2 helix, were critical for the zFF1A and ER synergy. In the absence
of AF-2 ( Heptad 9 (Amino Acids 474-482) in H10 Is Required for zFF1A
Transcriptional Activity--
Point mutations were introduced within
the conservation shown in Fig. 1 to assess the role of specific amino
acids in the I-box. Two mutants were constructed to analyze the
function of heptad 9. In L474A,L475A, leucines 474 and 475 were
substituted by an alanine, and in L478A,P479A, leucine 478 and proline
479 were substituted with alanine. Mutant L456A,L457A, in which two leucine residues of heptad 8 were converted into alanine, served as a
control (Fig. 2A). Only mutant L474A,L475A, in the presence of ER/E2, was unable to stimulate sGTHII
Mutant L474A/L475A showed transactivation activities far below that of
the wild-type protein in the absence of ER/E2 (Fig. 2C). Thus, deletion of the AF-2 or I-box or change of the
first double leucine residues in heptad 9 all resulted in the complete loss of transactivation function of zFF1A, confirming that the AF-2 and
I-box helices are functionally related.
The I-box and AF-2 Helices Do Not Mediate Direct zFF1A/ER
Interaction--
To test whether the interaction between ER and zFF1A
or zFF1A mutants could be attributed to the heptad 9 or the I-box,
glutathione S-transferase-ER-LBD was incubated with zFF1A or
its mutants were labeled with [35S]methionine by in
vitro translation. All zFF1 proteins (A-ORF, A( Other Regions of zFF1A Are Required for Transcriptional
Activity--
To delineate regions corresponding to the full
transactivation of zFF1A, a series of C-terminal deletion constructs
were made (Fig. 4). The removal of the
AF-2 region resulted in a significant loss of the transcriptional
activity of zFF1A (as seen in deletion 1-501). Further truncation of
67 amino acids from the C terminus completely abolished the activity of
zFF1A (deletion 1-434), whereas deletion to amino acid 155 (deletion
construct 1-155) resulted in transactivation similar to that of
deletion 1-501. This result suggested that the AF-2 is critical to the
activation function of zFF1A, whereas the contribution of the A/B
region is minor. Such a notion was supported by the N-terminal
truncation of the A/B region (deletion construct 43-516), because the
deletion did not change the activity of zFF1A. Only when the AF-2 motif
and A/B region were deleted simultaneously (deletion construct 43-434) was the activity of zFF1A drastically reduced (Fig. 4A).
An apparent increase in activity of zFF1 was obtained by C-terminal
deletion to amino acid 267 (deletion 1-267), whereas further deletion
abolished the regained activity (deletion construct 1-155). Therefore,
the activity of deletion 1-267 was due to a region between 155 and
267, which we named activation function 3, or AF-3. AF-3 could act
independently of the A/B region as demonstrated by deletion 43-321
(Fig. 4A).
To analyze whether the AFs and A/B region are involved in the
synergistic effect mediated by zFF1A with ER, all of the deletion constructs were tested in HeLa cells in the presence of
ER/E2 (Fig. 4B). In addition to the full-length
zFF1A (residues 1-516), deletions 1-501 (with A/B region and AF-3),
1-267 (A/B region and AF-3), 43-321 (AF-3), and 43-516 (AF-2 and
AF-3) still exerted variable synergy with ER, suggesting that both AF-2
and AF-3 contributed to the synergy. The A/B region alone (deletion
construct 1-155) did not show any synergy, but its removal in
deletions 43-516 and 43-321 decreased the synergy. This decrease
could be due to the weak transcriptional activity of the A/B region
(AF-1), whereas deletion 1-155 slightly enhanced the promoter activity
above the activity with ER alone (basal). The lack of any AFs might
explain why deletion of 43-155 was silent.
The region between 267 and 434, which encompasses regions II and III,
could serve as an inhibitor of AF-3 (deletion 43-434, Fig.
4A). The loss of synergy by deletions 1-434 and 43-434
might also reflect the inhibitory effect of region 267-434 (Fig.
4B). However, without the inhibitory region (IR), A( The Transcriptional Activity of zFF1 Depends on Several Activating
Functions--
We further fused individual AFs and their flanking
regions (Fig. 6A) to GAL4-DBD. The fusion constructs were
tested in HeLa cells, with the E1b-CAT reporter driven by five GAL4
binding sites. As summarized in Fig. 6B, consistent with our
earlier observations (above), the I-box was essential for AF-2 activity
(I-box plus AF-2; GAL4/436-516 versus AF-2 alone;
GAL4/498-516), and the AF-3 (GAL4/155-267) was an independent
activation domain. The transactivation of either I-box plus AF-2 or
AF-3 was not comparable with that of the entire D/E region
(GAL4/155-516). In addition, the entire E region (GAL4/278-516) also
showed limited activity, comparable with that of the I-box plus AF-2
alone. These data suggested a relatively weak activity of each AF and a
synergistic requirement of all AFs for the full activation of zFF1A.
However, internal deletion of the IR in GAL4/155-267;436-516 (AF-3,
I-box, and AF2 only) resulted in less transactivation than that of
GAL4/155-516. The lack of the intact IR in GAL4/322-516 appeared to
eliminate the activity of the I-box plus AF-2.
The I-box Mediates SRC-1 Recruitment to zFF1A--
The role of the
steroid receptor coactivator 1 (SRC-1) in potentiating the
transactivation of zFF1 was examined. In the presence of
E2, SRC-1 could potentiate ER activity on the sGTHII
To determine the role of SRC-1 in the synergistic interaction of
zFF1A/ER, AORF was cotransfected with both ER/E2 and SRC-1. There was a 2-fold increase of the synergistic effect of AORF/ER (on
sGTHII
In the presence of ER/SRC-1, A( To test the function of the zFF1A I-box, we have determined that
heptad 9 of zFF1A is required for AF-2 activity, although earlier
mutation studies indicated that several hydrophobic residues in heptad
9 of TR or RAR could determine their interaction with RXR (34-36). We
have further shown that the I-box and AF-2 of zFF1 are sufficient to
recruit SRC-1. We have also identified a novel activation function,
AF-3, that spans most of the D region of zFF1A (residues 155-266), and
we have delineated a region (residues 267-434) that may specifically
inhibit AF-3 activity, although the nature of inhibition is still
unclear. These results represent the first demonstration that both the
heptad 9 and hinge region, in addition to AF-2, are involved in
the transcriptional activity of a nuclear receptor with a monomeric DNA
binding feature. Our data stresses the notion that interdomain
communication (37), mediated by three segments (AF-3, I-box, and AF-2)
in the D/E region of zFF1A, confers the full transcriptional activity
of a nuclear receptor.
Our study of the I-box was prompted by the determination of the crystal
structure of nuclear receptor LBDs and the evidence that mSF-1
interacts with ERs (Table I). Consistent with a dimerization interface
found in H10 of the RXR LBD (2), the I-box has been mapped to the
H9-H10 region in LBDs of RXR, RAR, TR, and COUP and mediates
heterodimerization (7). In addition, the function of the I-box in the
homodimerization of HNF4 was also determined, although there is only
moderate conservation of the I-box between RXR and HNF4 (9).
Furthermore, ER has been proposed as a common interaction partner for
TR, RAR, RXR, and HNF4 via their LBDs (27). The loss of function of
zFF1B in synergy, due to deletion of both AF-2 and the I-box, thus
initially suggested that the I-box might contribute to the interaction
of zFF1A and ER either directly or indirectly through other
intermediary proteins. It now appears that rather than providing an
ER-interacting interface, the I-box, especially heptad 9 of zFF1A, is
directly related to AF-2 activity. Our GST pull-down assay further
rules out the possibility that the physical contact between zFF1A and
ER depends directly on the AF-2, I-box, or heptad 9. Further
experimentation is needed to determine which domain of zFF1 mediates
protein-protein interactions with ER Both SRC-1 and TRAM-1 (thyroid hormone receptor activator molecule (25,
33)) can potentiate zFF1A activity, but they show no effect on zFF1B
(Fig. 4 and data not shown). Furthermore, only A( In the elucidation of the nuclear receptor-coactivator complexes
assembled in response to hormonal signals, several leucine-rich motifs
(LXXLL) were found in the nuclear receptor interaction domains of SRC family members (39, 40). In SRC-1, three
LXXLL motifs have been shown to mediate direct contact with
ligand-bound steroid receptors. Because a leucine-rich motif in cyclin
D1 is able to recruit the coactivator to ER in the absence of
E2 (41), it is possible that SRC-1 interacts with any such
motifs on a given receptor. Since the heptad 9 is leucine-rich, highly
hydrophobic, and conserved among Ftz-F1s (Fig. 1), it is not surprising
that lack of this segment compromises the transcriptional activity of
zFF1 even in the presence of exogenous SRC-1.
A proximal activation function domain resides between residues 181 and
310 of xFF1rA (42), and a domain mapped upstream of AF-2 (residues
187-245) in mSF-1 was found to be essential for their transcriptional
activity (43, 44). These domains span parts of the D and E regions.
According to a sequence alignment of the LBDs in all nuclear receptors,
both domains overlap with the AF-2a domain of ER Our current study indicates that when linked to its own or a
heterologous DBD, the AF-3 (encompassing the entire D region), without
any overlap with the N terminus of the E region, can serve as an
activation domain. As expected, when tethered to GAL4-DBD, AF-2 alone
is not active at all. Moreover, the I-box and AF-2 together can confer
the major transactivation function of the E region. Our data further
indicate that without the I-box (A( It is intriguing to note that deletion of the IR region significantly
reduces zFF1 transactivation but does not appear to function in
coactivator recruitment. Therefore, the inability of zFF1B to respond
to SRC-1 is not due to the inhibitory domain per se but
rather the lack of both the I box and AF2. Alternatively, the IR
segment could simply act as a linker to ensure a proper comformational
change of the D/E region and communication between the AF-3 and I-box
plus AF-2, because partially deleting the IR results in a more severe
reduction.2 However, we
cannot rule out that the corepressor recruitment and/or
post-translational modification can be mediated by the IR. In fact, the
modifications play an important role in mSF-1 transcriptional activity.
No apparent ligand is needed for mSF-1 activity in many cellular
settings (i.e. mSF-1 is functional in various cell lines). Since evidence that oxysterols can serve as a bona fide
ligand remains controversial (12, 13), it is thought that mSF-1 may be
regulated by alternate mechanisms involving coactivators, corepressors, and signal transduction pathways.
Such a notion recently received support, because a constitutive
phosphorylation site (Ser203) in region 187-245, which can
be modified by the mitogen-activated protein kinase signaling pathway,
has been demonstrated to maximize the mSF-1-mediated transcription
(47). Like phosphoserines often found in the A/B regions of many
hormone NRs, phosphorylation of the hinge region by mitogen-activated
protein kinase results in ligand-independent activation and recruitment
of NR cofactors (47, 48). The phosphorylation of Ser203 in
the proximal AF of mSF-1 increases the binding of corepressor SMRT
(silencing mediator of retinoic
acid and thyroid hormone receptor) but shows less effect on
its coactivator association in vitro (47).
Interestingly, a serine/threonine mitogen-activated protein kinase
phosphorylation site PFVTSP (resembles the PXn(S/T)P consensus) is also found in region 155-267 of zFF1, but the location of the mitogen-activated protein kinase Ser/Pro consensus is quite different from that in mSF-1. Therefore, we suggest that the
recruitment of NR corepressors by AF-3 is likely and should be
important for the activity of zFF1B. Because NR corepressors can also
directly interact with the E regions of many NRs (49), the possibility that the inhibitory region (residues 267-434) may be responsible for
the corepressor recruitment to zFF1 is not excluded.
The proximal AF and LBD of mSF-1 are required for the interaction with
either SMRT or coactivators (43, 47). Therefore, mSF-1 transactivation
may be determined by both coactivators and corepressors in
vivo. Whether the same mechanism applies to zFF1 requires further
investigation. Nevertheless, the contribution of multiple subdomains in
the D/E region, especially the I-box, to the zFF1A transactivation may
represent a general mechanism of Ftz-F1 function.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-helical sandwich," consists of 12
-helices (H1-H12) packed in three layers, ultimately generating an internal hydrophobic ligand-binding cavity. The striking difference between the
ligand-bound and unbound LBD is the position of H12 (AF-2 helix). In
the absence of the ligand, the helix projects away from LBD but tightly
folds toward the LBD when ligand is bound. It is proposed that this
conformational change may yield an interacting surface for NR
coactivators (5).
subunit gene (sGTHII
) promoter (6). In the present study, we show that deletion
of the I-box or mutating it at heptad 9 drastically reduces the
transcriptional activity of zFF1A, but such a reduction is less
pronounced in the zFF1/ER synergy. Furthermore, wild-type zFF1A and its
mutants all retained interaction with ER-LBD. To delineate the
transactivation functions of zFF1A, we have defined a new activation
function in the D domain (AF-3) and a negative region between AF-3 and
the I-box. Our results suggest an unusual role of the "dimerization
domain" in Ftz-F1 homologues and suggest that zFF1A transactivation
is due to a coordination of multiple subdomains in the D and E regions.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
--
All oligonucleotide primers were synthesized in
Biotechnology Service Center, the Hospital for Sick Children (Toronto,
Canada). Primers designed for the zFF1A and B ORF amplification were as follows: 5'(A/B)Bm, AGAGGATCCATGCTGCCTAAAGTCG; 3'(A)Eo,
GCGAATTCTCAGGCACGTTTGG; 3'(B)Eo,
CCCAATTCTCTCTACTCACCCAAGC; and 3'(A)Hn,
GGCAAGCTTTCAGGCACGTTTGGCG (where either BamHI
(Bm), EcoRI (Eo), or HindIII (Hn) restriction site is underlined). Primers used for C-terminal deletions of zFF1A
protein were as follows: 1-501,
AAGAGAATTCTCAGGGCACGTCTCCGTTCAGGTGT; 1-155,
AGTGAATTCGCCCGGATCAAGGCTTTCT; 1-321, CATTAGGCCGAAAGTGTTGAG. The primer
used to obtain the N- terminal deletions (43-516, 43-155, 43-321,
and 43-434) of zFF1 was
(1-43), GACGGATCCATGGATGAGATGTGTCC. The
I-box internal deletion primers were AatII upstream
(TCTTGACGTCCAAGCTGAACAGCA and AatII downstream
(GCCGACGTCTACCTGTACTACAAAC) (where the AatII restriction sites are underlined) and T3 and T7 primers of pBluescript (Stratagene, La Jolla, CA). The point mutation primers designed to test
leucine residues in heptads 8 and 9 of zFF1A were as follows: mutIB-1,
AGACAAGTTCGGCCAGGCGGCGCTGCGGCTGCCGGAG; mutIB-3,
CCAGCTGCTGCTGCGGGCGGCGGAGATCCGCGCCAT; and
mutIB-4, AGCAGGTGAACGCGGCAGCGGCGGACTACGTGATGTGC
(where the underlines indicate the mutated nucleotides). For internal
deletions mutants of the putative inhibitory region, the following
primers were employed: (1)Hn, GCAAAGCTTATGCTGCCTAAAG; TC;
(321)Bm, AGCGGATCCGCACATTAGGCC; (412)Bm,
TGCGGATCCGCTCAGCAGCTC. Primers used to PCR-amplify the DNA
fragments encoding the D, E, I-box, and AF-2 regions of zFF1A and their
combinations were as follows: (155)Eo,
AAGGAATTCGCCATGACTCAAGTC; (267)Bm,
TGCGGATCCTTCTACGTAAGGGTA; (278)Eo,
TCGGAATTCTCCTTCCCTCACTTA; (322)Eo,
CTAGAATTCAAGATGGCTGACCAG; (436)Bm,
TCAGGATCCACGTGAAGAACCTGG; (498)Eo,
AAAGAATTCAACGGAGACGTGCCC; (516)Xa,
GGCTCTAGATCAGGCACGTTTGGC (where the BamHI
(Bm), EcoRI (Eo), or XbaI (Xa) site is
underlined). Primers used for sequencing confirmation of the
insert/vector junctions of GAL4/zFF1A fusion constructs were based on
pM plasmid (CLONTECH).
(1-43) was used, in
combination with either primer 3'(A)Eo, 1-321, 1-155, or 3'(B)Eo. The
PCR-amplified DNA fragments were then restricted by BamHI
and EcoRI and cloned back into pCDNA3. Deletion 1-434 was equivalent to zFF1BORF. The internal deletion A-
I-box was produced by three steps. First, the AatII upstream and
downstream primers were combined with either T3 or T7 primers of
pBluescript to PCR-amplify two fragments from full-length zFF1A
cDNA. An AatII restriction enzyme site was included at
5'-ends of both primers. Second, the DNA fragments with correct sizes
were treated by AatII restriction and ligated using T4
ligase (Life Technologies, Inc.). Finally, one-tenth of the ligation
mixture was taken to perform PCR with primers 5'(A/B)Bm and 3'(A)Eo and
the expected fragment A-
I-box was 156 base pairs shorter than wild
type or its predicted ORF, which should contain 462 amino acids without
the entire I-box. Point mutations were introduced into A-ORF by a
PCR-based mutagenesis method described elsewhere (26). Principally, a
mutagenic primer (mutIB-1, mutIB-3, or mutIB-4) was designed in the
region where mutation was introduced, and following PCR with primer
3'(A)Eo, a large DNA fragment (~130-200 base pairs) was obtained.
Using the "large fragment" primer, which was treated by
DpnI digestion to remove the possible parental plasmid
contamination, and primer 5'(A/B)Bm, the full-length ORF fragment with
the expected mutation was obtained by PCR. The mutated ORF DNA fragment
was then restricted by BamHI and EcoRI and
ligated into pCDNA3. The mutated region was confirmed by DNA
sequencing and restriction mapping. No unexpected mutations were found.
About 20 ng of A-ORF template and 2 units of Pfu polymerase
(Stratagene, La Jolla, CA) were used in each PCR, and the amplification
procedure generally consisted of 3 min of 95 °C followed by 20 cycles at 93 °C (1 min), 60 °C (1 min), and 75 °C (2 min). In
certain cases, such as the introduction of the point mutations and the
generation of the internal deletion, annealing and extension
temperatures were adjusted according to the Tm of
the primers used. Using PCR amplification of zFF1 AORF, the
internal deletion construct zFF1
IR was created by fusion of
(1)Hn/(321)Bm and (436)Bm/(516)Xa.
IR was made by
ligating fragments amplified by primers (155)Eo/(321)Bm and
(436)Bm/(516)Xa. For all subcloning, the PCR products were digested
with the respective enzymes and ligated in frame at the C terminus of
the Gal4 DBD. All of the PCR-derived clones were confirmed by
sequencing on both strands.
LBD and ER
, along with GST
fusion vector expressing ER
LBD, were previously described (27). A
PCR-amplified fragment of mSF-1 (28) was subcloned into
EcoRI-XhoI restriction sites of the B42 fusion
vector pJG4-5 (29).
-galactosidase expression were carried out as described (29).
Similar results were obtained in more than two similar experiments.
-LBD fusion or GST alone
was expressed in Escherichia coli, bound to
glutathione-Sepharose beads (Amersham Pharmacia Biotech) and incubated
with labeled zFF1 proteins expressed by in vitro translation
using the TNT-coupled transcription-translation system, with conditions
described by the manufacturer (Promega, Madison, WI). Specifically
bound proteins were eluted from the beads with 40 mM
reduced glutathione in 50 mM Tris (pH 8.0) and analyzed by
SDS-PAGE and autoradiography as described (29).
-gal plasmid (as internal
control) were included in each transfection, or the manufacturer's
instructions (CLONTECH) were followed. Coactivator
expression plasmid or an equal amount of pBluescript was added to test
the effect of the coactivator. All cells were grown in 6-cm dishes.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
promoter activity (6, 21). To verify the nature of the synergy, a yeast
two-hybrid test showed that mSF-1 interacted with both types of
estrogen receptor, ER
and ER
(Table
I). The interactions were estradiol
(E2)-independent, suggesting that repositioning of ER AF-2
in the presence of ligand is not essential for contact.
Interactions of SF-1 with ER
and ER
in yeast
-D-galactopyranoside (X-gal), and reproducible results
were obtained using colonies from a separate transformation. ++,
strongly blue colonies after 2 days of incubation and strong
interaction; +, light blue colonies after 2 days of incubation and
intermediate to weak interaction;
, white colonies and no
interaction.

View larger version (55K):
[in a new window]
Fig. 1.
Heptad 9 in the I-box of zFF1A.
Comparison of Ftz-F1 members and other nuclear receptors in H9, H10,
and H12 regions are shown. In addition to the complete conserved AF-2
core region in all vertebrate Ftz-F1 homologous members, the heptad 9 region also shows a considerably high similarity. This high identity is
best exampled when zFF1A, xFF1rA, RXR, dUSP, and COUP-TF1 are compared.
The alignment of NRs other than Ftz-F1s in the region was derived from
Wurtz et al. (4).
AF-2), the synergistic effect of zFF1A and ER on sGTHII
promoter was no longer significant (Fig.
2B). In the absence of both
AF-2 and the I-box, the synergistic effect mediated by ER and zFF1 was
lost. We thus constructed an internal deletion, A(
I-box), in which
only the I-box was removed (Fig. 2A). Cotransfection in
COS-1 cells revealed that in the presence of AF-2, the synergy was
barely observed when A(
I-box) was tested (similar to B-ORF, Fig.
2B), suggesting that the I-box may mediate interaction with
ER. In contrast, in the absence of ER, deletion of either AF-2 or the
I-box also abolished the activation function of zFF1A on the sGTHII
promoter (Fig. 2C), further highlighting the critical role
of the I-box for AF-2 activity.

View larger version (18K):
[in a new window]
Fig. 2.
The I-box, especially heptad 9, is crucial
for the transcription activity of zFF1A. A, schematic
structures of wild-type and mutated zFF1A used in transfection study
and GST pull-down assay. B, the role of AF-2, I-box, and
heptad 9 in the zFF1A and ER/E2 synergistic effect on
target promoter. A sGTHII
-1260/CAT reporter was used in
cotransfection (2, 22), and the results shown are from three
independent tests in COS-1 cells (in duplicate). Basal is defined as
the reporter activity in the absence of any additional transcription
factor. C, transcriptional activities of wild-type and mutated proteins
in the absence of ER. Basal is defined as the promoter activity in the
presence of ER/E2 only.
promoter
activity further, whereas the other two mutants exhibited function
similar to that of the wild-type protein, i.e. they
cooperatively enhanced the activity of the sGTHII
gene promoter with
ER (Fig. 2B).
AF-2),
A(
I-box), L474A,L475A, L456A,L457A, and B-ORF) showed physical
contact with ER that was independent of E2 (Fig.
3), similar to that of the mSF-1/ER
interaction (Table I). These data demonstrated that neither the I-box
nor heptad 9 mediates the zFF1A and ER contact and suggested that the
major interacting surfaces of zFF1A are probably outside of the I-box
and AF-2.

View larger version (31K):
[in a new window]
Fig. 3.
All zFF1A proteins are able to physically
contact with ER-LBD in vitro. The 35S-labeled
zFF1 proteins expressed by in vitro translation were
incubated with GST-ER-LBD bound to glutathione-Sepharose-4B beads.
Specific binding proteins were eluted and analyzed by SDS-PAGE and
autoradiography. 35S-Labeled luciferase and GST alone
served as negative control. The presence or absence of E2
in the reactions essentially gave rise to the same results.

View larger version (34K):
[in a new window]
Fig. 4.
Delineation of the activation function
regions in zFF1A. A, a series of deletion constructs
are shown on the left (scheme is not to scale), and the
numbers indicate the truncation sites. All constructs were
tested through a cotransfection study in HeLa cells. The reporter
construct was the sGTHII
gene
39 basal promoter linked to CAT,
with a consensus GSE sequence 5' upstream (consGSE-TATA-CAT) (2). Basal
value represents the activity of the consGSE-TATA promoter without the
addition of any transcription factor. B, the same zFF1
constructs were tested for their synergistic action with
ER/E2 on a sGTHII
kilobase pair
0.4 promoter (22).
Cells cotransfected with ER were treated by E2 (1 µM) after transfection. Basal activity refers to that of
the promoter in the presence of ER/E2 only. All histograms
represent the mean ± S.D. of at least two independent experiments
(in duplicate or triplicate).
IR)
did not transactivate as efficiently as AORF. On the other hand, the
synergistic effect mediated by AFs of zFF1 and ER was not affected by
the removal of the IR (Fig. 5). The
overall organization of the regions related to zFF1A transcriptional
activity is shown in Fig.
6A.

View larger version (38K):
[in a new window]
Fig. 5.
The IR affects
transactivation. The left panel shows that
the IR deletion (A(
IR)) results in the decreased activity of
consGSE-TATA promoter (compared with AORF). The same deletion did not
affect its synergistic action with ER on a sGTHII
kilobase pair
0.4 promoter (right panel). All histograms
represent the mean ± S.D. of at least three independent
experiments (in triplicate). Other details are the same as in Fig.
4.

View larger version (31K):
[in a new window]
Fig. 6.
Multiple regions are required for the
transactivation of zFF1A. A, a schematic diagram of
regions related to the transactivation of zFF1A is presented (from the
results shown in Figs. 4 and 5), and the D/E region is further enlarged
(lower panel). Numbers represent the
sites where the subdomains of the D/E region were originally defined in
Fig. 4B. Individual AFs and their combinations were fused to
GAL4-DBD and tested by cotransfection with pG5CAT. The results are from
at least three independent experiments (in duplicate each time), and
the histograms represent mean ± S.D. The CAT activity of
reporters obtained by transfecting GAL4/155-516 is considered 1, and
the other CAT activity values are shown as percentages relative to
1.
gene proximal ERE/TATA promoter by more than 3-fold, an effect that was
described previously for an ERE-containing promoter (32). SRC-1 could
potentiate both AORF and mSF-1 function on the consGSE-TATA promoter by
2-fold, whereas no effect was evident on BORF (Fig. 7). As well, SRC-1 failed to enhance the
activity of A(
I-box) significantly but had an effect on A(
AF2)
(data not shown). Therefore, without the I-box, zFF1 might not respond
efficiently to the coactivator.

View larger version (42K):
[in a new window]
Fig. 7.
SRC-1 selectively activates zFF1A. SRC-1
could significantly potentiate the function of zFF1A, mSF-1, and
rainbow trout ER but showed limited effect on zFF1B. All results
represent three independent experiments in HeLa cells (in duplicate),
and 5 µg of SRC-1 expression vector was used in each
transfection.
promoter) by SRC-1 (Fig. 8). A
greater potentiation of SRC-1 on the activity of A(
I-box) (3.5-fold)
and A(
AF2) (4.7-fold) was observed, but no significant enhancement
was evident on BORF. The presence of the I-box in A(
AF2) apparently
led to a much higher promoter activity (with ER and ER/SRC-1) than that
induced by A(
I-box), indicating that although both the I-box and
AF-2 exerted a relatively weak interaction with SRC-1 (compared with ER), the I-box might have a higher affinity for the coactivator. HeLa
cells express endogenous SRC-1 (33). In our test, cotransfecting large
amounts of SRC-1 expression construct would result in a much higher
level of SRC-1 in cells. These data therefore suggested that
overexpression of SRC-1 in cells and its dominant recruitment by ER to
the target promoter might contribute to the more pronounced potentiation of A(
AF2) and A(
I-box) by the coactivator.

View larger version (36K):
[in a new window]
Fig. 8.
The I-box mediates the function of
SRC-1. Through cotransfection study with ER/E2 and/or
SRC-1 in HeLa cells, the role of the I-box in mediating SRC-1 function
has been evident. The -fold induction is relative to the promoter
activity in the absence of any transcription factors and coactivator.
The reporter construct is a sGTHII
kilobase pair
0.4 promoter
(22). All histograms represent the mean ± S.D. of at least three
independent experiments (in duplicate). The numbers
above the bars are the -fold potentiation of
SRC-1. SRC-1 alone showed no significant effect on the promoter.
IR) also exerted greater potentiation
(4.3-fold) and led to a promoter activity comparable with that of AORF
(69-fold versus 73-fold). However, without the exogenous
SRC-1 or lacking a strong recruitment of SRC-1 by ER to the sGTHII
promoter, A(
IR) was not as efficient as AORF in transactivation
(Fig. 5). Thus, it appears that the IR is unlikely to make direct
protein-protein contacts with SRC-1.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
.
I-box) and mutation
L474A,L475A failed to respond to the co-expression of SRC-1 (data not
shown), arguing an important role of the I-box in mediating the
activation of coactivators. From the cotransfection of SRC-1, zFF1
mutants, and ER, the role of the I box in coactivator recruitment
becomes more evident. Although the ER should play a significant role in
SRC-1 recruitment (32), the removal of the I-box in A(
I-box) and
BORF appears to disrupt the coactivator/zFF1 interaction. Consequently,
the combinatory effect of transcription factors and SRC-1 on the
sGTHII
promoter is much higher only when the I-box is present (Fig.
8). However, in the absence of exogenous SRC-1, the sGTHII
promoter
activity is also higher when zFF1s with the I-box are employed
(A(
I-box) versus A(
AF2), AORF, or A(
IR) in Fig. 8),
suggesting the involvement of the endogenous SRC-1 or other
coactivator(s). The SRC family represents a class of general
coactivators that are able to modify chromatin structure, while the
docking of specific coactivators to DNA-binding transcription factors
recruits the general coactivators (38). Whether HeLa cells express
Ftz-F1-specific coactivator(s) is currently unknown, but the endogenous
SRC-1 may substitute for such factor(s) that are likely to be missing.
The overproduction of SRC-1 in cells would exert a broad effect shown
for many NRs, on zFF1s via ER, since ER and zFF1 are bound to each
other (our GST pull-down result).
and the
2 region
of GR in the LBDs (4, 45, 46). The proximal activation domains of
xFF1rA and mSF-1 are capable of transactivation when fused to a
heterologous DBD. The AF-2 of mSF-1, on the other hand, lacks any
independent activity. It was concluded that AF-2 is necessary, but
insufficient, for the transcriptional activity of the vertebrate Ftz-F1
homologues (42, 43).
I-box)), or with an altered
heptad 9 (L474A,L475A), the AF-2 activity of zFF1A is barely
detectable. The weaker activity of each AF and the greater
transcriptional activity of the D/E region have led to a speculation
that the full transcriptional activity of zFF1A requires all three
segments (Figs. 5 and 6). By testing the synergistic interaction of
zFF1A and ER using the C- and N-terminal deletions of zFF1A, both AF-2
and AF-3 of zFF1A were found to make significant contributions to
transactivation. In fact, it appears that the D region not only harbors
an activation domain but is also necessary for the interaction of both
nuclear receptors (zFF1A and ER).
| |
ACKNOWLEDGEMENTS |
|---|
We especially thank Dr. Bon-chu Chung (Institute of Molecular Biology, Academia Sinica, Taiwan) for sharing unpublished data. We are grateful to Drs. H. P. Elsholtz, C-C. Hui, M-J. Tsai, and B. Schimmer for helpful suggestions and technical advice. We also thank Drs. P. Melamed and M. Westerfield for critical reading of the manuscript. We appreciate the technical assistance of L. Liao and J. Ando and thank L. Mark for helping in the preparation of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by Medical Research Council of Canada Grant MT-12900 (to C. L. H.) and by a grant from the National Creative Research Initiative program of the Korean Ministry of Science and Technology (to J. W. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
c Recipient of the Restracom Trainee Fellowship. Present address: Institute of Neuroscience, University of Oregon, Eugene, OR 97403-1254.
d Recipient of a fellowship from the Fondation J. Armand Bombardier.
f Visiting scientist, partially supported by the Hospital for Sick Children. Present address: Biologie Cellulaire & Reproduction, University of Rennes, Rennes Cedex, 35042 France.
g Present address: Graduate School of Science, Hokkaido University, Sapporo, Hokkaido 060-08100, Japan.
j To whom correspondence should be addressed: Dept. of Laboratory Medicine and Pathobiology, University of Toronto 100 College St., Rm.
Published, JBC Papers in Press, March 20, 2000, DOI 10.1074/jbc.M000121200
2 M. Chandy and C. L. Hew, unpublished data.
351, Toronto, Ontario M5G 1L5, Canada. Tel.: 416-978-6505; Fax: 416-978-8802; E-mail: choy.hew@utoronto.ca.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: NR, nuclear receptor; AF, activation function; DBD, DNA binding domain; LBD, ligand binding domain; SF-1, steroidogenic factor 1; mSF-1, mouse SF-1; ER, estrogen receptor; ORF, open reading frame; GST, glutathione S-transferase; CAT, chloramphenical acetyltransferase; E2, estradiol; IR, inhibitory region.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995) Cell 83, 835-839 |
| 2. | Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H., and Moras, D. (1995) Nature 375, 377-382 |
| 3. | Renaud, J-P., Rocchel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H., and Moras, D. (1995) Nature 378, 681-689 |
| 4. | Wurtz, J-M., Bourguet, W., Renaud, J-P., Vivat, V., Chambon, P., Moras, D., and Gronemeyer, H. (1996) Nat. Struct. Biol. 3, 87-94 |
| 5. | Torchia, J., Glass, C., and Rosenfeld, M. G. (1998) Curr. Opin. Cell Biol. 10, 373-383 |
| 6. | Liu, D., Le Dréan, Y., Ekker, M., Xiong, F., and Hew, C. L. (1997) Mol. Endocrinol. 11, 877-890 |
| 7. | Perlmann, T., Umesono, K., Rangarajan, P. N., Forman, B. M., and Evans, R. M. (1996) Mol. Endocrinol. 10, 958-966 |
| 8. | Forman, B. M., and Samuels, H. H. (1990) Mol. Endocrinol. 4, 1293-1301 |
| 9. | Collingwood, T. N., Butler, A., Tone, Y., Clifton-Bligh, R. J., Parker, M. G., and Chatterjee, V. K. K. (1997) J. Biol. Chem. 272, 13060-13065 |
| 10. | Lee, S-K., Na, S-Y., Kim, H-J., Soh, J., Choi, H-S., and Lee, J. W. (1998) Mol. Endocrinol. 12, 325-332 |
| 11. | Parker, K. L., and Schimmer, B. P. (1997) Endocr. Rev. 18, 361-377 |
| 12. | Lala, D. S., Syke, P. M., Lazarchik, S. B., Mangelsdorf, D. J., Parker, K. L., and Heyman, R. A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4895-4900 |
| 13. | Mellon, S. H., and Bair, S. R. (1998) Endocrinology 139, 3026-3029 |
| 14. | Ueda, H., Sonoda, S., Brown, J. L., Scott, M. P., and Wu, C. (1990) Genes Dev. 4, 624-635 |
| 15. | Lavorgna, G., Ueda, H., Clos, J., and Wu, C. (1991) Science 252, 848-851 |
| 16. | Luo, X., Ikeda, Y., and Parker, K. L. (1994) Cell 77, 481-490 |
| 17. | Shen, W-H., Moore, C. C. D., Ikeda, Y., Parker, K. L., and Ingraham, H. A. (1994) Cell. 77, 651-661 |
| 18. | Ingraham, H. A., Lala, D. S., Ikeda, Y., Luo, X., Shen, W-H., Nachtigal, M. W., Abbud, R., Nilson, J. H., and Parker, K. L. (1994) Genes Dev. 8, 2302-2312 |
| 19. | Shinoda, K., Lei, H., Yoshi, H., Nomura, M., Nagano, M., Shiba, H., Sasaki, H., Osawa, Y., Ninomiya, Y., Niwa, O., Morohashi, K-I., and Li, E. (1995) Dev. Dyn. 204, 22-29 |
| 20. | Sadovsky, Y., Crawford, P. A., Woodson, K. G., Polish, J. A., Clements, M. A., Tourtellotte, L. M., Simburger, K., and Milbrandt, J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 10939-10943 |
| 21. | Le Dréan, Y., Liu, D., Wong, A. O. L., Xiong, F., and Hew, C. L. (1996) Mol. Endocrinol. 10, 217-229 |
| 22. | Crawford, P. A., Dorn, C., Sadovsky, Y., and Milbrandt, J. (1998) Mol. Cell. Biol. 18, 2949-2956 |
| 23. | Ueda, H., Sun, G-C., Murata, T., and Hirose, S. (1992) Mol. Cell. Biol. 12, 5667-5672 |
| 24. | Wilson, T. E., Fahrner, T. J., and Milbrandt, J. (1993) Mol. Cell. Biol. 13, 5794-5804 |
| 25. | Nuclear Receptor Nomenclature Committee. (1999) Cell 97, 161-163 |
| 26. | Li, S., and Wilkinson, M. F. (1997) BioTechniques 23, 588-589 |
| 27. | Lee, S-K., Choi, H-S., Song, M-R., Lee, M-O., and Lee, J. W. (1998) Mol. Endocrinol. 12, 1184-1192 |
| 28. | Lala, D. S., Rice, D. A., and Parker, K. L. (1992) Mol. Endocrinol. 6, 1249-1258 |
| 29. | Ausubel, E. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1995) Current Protocols in Molecular Biology , Greene Associates, New York |
| 30. | Xiong, F., Liu, D., Elsholtz, H. P., and Hew, C. L. (1994) Mol. Endocrinol. 8, 782-793 |
| 31. | Liu, D., Xiong, F., and Hew, C. L. (1995) Endocrinology 136, 3486-3493 |
| 32. | Oñate, S. A., Tsai, S. Y., Tsai, M-J., and O'Malley, B. W. (1995) Science 270, 1354-1357 |
| 33. | Takeshita, A., Cardona, G. R., Koibuchi, N., Suen, C-S., and Chin, W. W. (1997) J. Biol. Chem. 272, 27629-27634 |
| 34. | Nagaya, T., and Jameson, J. L. (1993) J. Biol. Chem. 268, 15766-15771 |
| 35. | Au-Fliegner, M., Helmer, E., Casanova, J., Raaka, B. M., and Sameuls, H. H. (1993) Mol. Cell. Biol. 13, 5725-5737 |
| 36. | Leng, X., Blanco, J., Tsai, S. Y., Ozato, K., O'Malley, B. W., and Tsai, M-J. (1995) Mol. Cell. Biol. 15, 255-263 |
| 37. | Shao, D., Rangwala, S. M., Bailey, S. T., Krakow, S. L., Reginato, M. J., and Lazar, M. A. (1998) Nature 396, 377-380 |
| 38. | Puigserver, P., Adelmant, G., Wu, Z., Fan, M., Xu, J., O'Malley, B., and Spiegelman, B. M. (1999) Science 286, 1368-1371 |
| 39. | Torchia, J., Rose, D. W., Inostroza, J., Kamei, Y., Westin, S., Glass, C. K., and Rosenfeld, M. G. (1997) Nature 387, 677-684 |
| 40. | Heery, D. M., Kalkhoven, E., Hoare, S., and Parker, M. G. (1997) Nature 387, 733-736 |
| 41. | Zwijsen, R. M., Buckle, R. S., Hijmans, E. M., Loomans, C. J., and Bernards, R. (1998) Genes Dev. 12, 3488-3498 |
| 42. | Ellinger-Ziegelbauer, H., Glaser, B., and Dreyer, C. (1995) Mol. Endocrinol. 9, 872-886 |
| 43. | Crawford, P. A., Polish, J. A., Ganpule, G., and Sadovsky, Y. (1997) Mol. Endocrinol. 11, 1626-1635 |
| 44. | Li, L. A., Chiang, E. F., Chen, J. C., Hsu, N. C., Chen, Y. J., and Chung, B. C. (1999) Mol. Endocrinol. 13, 1588-1598 |
| 45. | Hollenberg, S. M., and Evans, R. M. (1988) Cell 55, 899-906 |
| 46. | Pierrat, B., Heery, D. M., Chambon, P., and Losson, R. (1994) Gene (Amst.) 143, 193-200 |
| 47. | Hammer, G. D., Krylova, I., Zhang, Y., Darimont, B. D., Simpson, K., Weigel, N. L., and Ingraham, H. A. (1999) Mol. Cell 3, 521-516 |
| 48. | Tremblay, A., Tremblay, G. B., Labrie, F., and Giguere, V. (1999) Mol. Cell 3, 513-519 |
| 49. | Jenster, G. (1998) Mol. Cell. Endocrinol. 143, 1-7 |
This article has been cited by other articles:
![]() |
J. Qin, D.-m. Gao, Q.-F. Jiang, Q. Zhou, Y.-Y. Kong, Y. Wang, and Y.-H. Xie Prospero-Related Homeobox (Prox1) Is a Corepressor of Human Liver Receptor Homolog-1 and Suppresses the Transcription of the Cholesterol 7-{alpha}-Hydroxylase Gene Mol. Endocrinol., October 1, 2004; 18(10): 2424 - 2439. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-L. Xu, Y.-Q. Liu, S.-F. Shan, Y.-Y. Kong, Q. Zhou, M. Li, J.-P. Ding, Y.-H. Xie, and Y. Wang Molecular Mechanism for the Potentiation of the Transcriptional Activity of Human Liver Receptor Homolog 1 by Steroid Receptor Coactivator-1 Mol. Endocrinol., August 1, 2004; 18(8): 1887 - 1905. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Liu, W. Gao, H.-L. Teh, J.-H. Tan, and W.-K. Chan Prox1 Is a Novel Coregulator of Ff1b and Is Involved in the Embryonic Development of the Zebra Fish Interrenal Primordium Mol. Cell. Biol., October 15, 2003; 23(20): 7243 - 7255. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoshiura, B. Senthilkumaran, M. Watanabe, Y. Oba, T. Kobayashi, and Y. Nagahama Synergistic Expression of Ad4BP/SF-1 and Cytochrome P-450 Aromatase (Ovarian Type) in the Ovary of Nile Tilapia, Oreochromis niloticus, During Vitellogenesis Suggests Transcriptional Interaction Biol Reprod, May 1, 2003; 68(5): 1545 - 1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Melamed, M. Koh, P. Preklathan, L. Bei, and C. Hew Multiple Mechanisms for Pitx-1 Transactivation of a Luteinizing Hormone beta Subunit Gene J. Biol. Chem., July 12, 2002; 277(29): 26200 - 26207. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Brendel, L. Gelman, and J. Auwerx Multiprotein Bridging Factor-1 (MBF-1) Is a Cofactor for Nuclear Receptors that Regulate Lipid Metabolism Mol. Endocrinol., June 1, 2002; 16(6): 1367 - 1377. [Abstract] [Full Text] [PDF] |
||||
|
|