HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 23, 17869-17877, June 9, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/23/17869    most recent M000217200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lawrence, S. M. Articles by Betenbaugh, M. J. Search for Related Content PubMed PubMed Citation Articles by Lawrence, S. M. Articles by Betenbaugh, M. J. Social Bookmarking                      What's this?

Cloning and Expression of the Human N-Acetylneuraminic Acid Phosphate Synthase Gene with 2-Keto-3-deoxy-D-glycero- D-galacto-nononic Acid Biosynthetic Ability^*

Shawn M. Lawrence, Kathleen A. Huddleston^§, Lee R. Pitts, Nam Nguyen^§, Yuan C. Lee^¶, Willie F. Vann, Timothy A. Coleman^§, and Michael J. Betenbaugh^**

From the Departments of  Chemical Engineering and ^¶ Biology, The Johns Hopkins University, Baltimore, Maryland 21218, ^§ Protein Development, Human Genome Sciences, Rockville, Maryland 20850, and  Laboratory of Bacterial Toxins and Laboratory of Bacterial Polysaccharides, Food and Drug Administration, Bethesda, Maryland 20892

Received for publication, January 11, 2000, and in revised form, March 8, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Sialic acids participate in many important biological recognition events, yet eukaryotic sialic acid biosynthetic genes are not well characterized. In this study, we have identified a novel human gene based on homology to the Escherichia coli sialic acid synthase gene (neuB). The human gene is ubiquitously expressed and encodes a 40-kDa enzyme. The gene partially restores sialic acid synthase activity in a neuB-negative mutant of E. coli and results in N-acetylneuraminic acid (Neu5Ac) and 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN) production in insect cells upon recombinant baculovirus infection. In vitro the human enzyme uses N-acetylmannosamine 6-phosphate and mannose 6-phosphate as substrates to generate phosphorylated forms of Neu5Ac and KDN, respectively, but exhibits much higher activity toward the Neu5Ac phosphate product.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The sialic acids are a family of nine carbon 2-keto-3-deoxy sugars found in viruses, bacteria, and many higher animals, including humans (1). Sialic acids are frequently the terminal sugars on secreted and cell surface glycoproteins and glycolipids, and their presence can have considerable influence on the biological properties of a cell. For example, the temporal appearance and disappearance of polysialic polymers has been intimately linked with the proper development of neural tissues during embryogenesis (2, 3). In pathogenic diseases, including meningitis and gastric inflammation, particular microbes recognize cell surface sialic acids when invading host cells (1). Sialic acid residues can also mask recognition sites (4) such as galactose residues on glycoproteins to prevent their in vivo removal by asialoglycoprotein receptors (5). In certain cancers, changes in sialic acid amounts, types, and linkages have been associated with tumorogenesis and cancer metastasis (6, 7).

The biological significance of sialic acids underscores the importance of characterizing their biosynthetic pathways. Multiple sialic acid synthetic and degradative pathways have been identified in bacteria and eukaryotes (Fig. 1). Sialic acid aldolase is found in both bacteria and mammals and reversibly forms N-acetylneuraminic acid (Neu5Ac)¹ from pyruvate and N-acetylmannosamine (ManNAc) in a reaction favoring ManNAc (8). The Escherichia coli sialic acid synthase gene (neuB), which has been cloned and characterized, encodes an enzyme that directly converts phosphoenolpyruvate (PEP) and ManNAc to Neu5Ac (9), the most common sialic acid. Corfield et al. (10) attempted to find a similar sialic acid synthase activity in mammalian cells but found only the products of the pathway involving phosphate intermediates. This three-enzyme pathway converts ManNAc to Neu5Ac through the intermediates N-acetylmannosamine 6-phosphate (ManNAc-6-P) and N-acetylneuraminate 9-phosphate (11-13). The initial phosphorylation step is carried out by a recently cloned bifunctional enzyme that converts UDP-N-acetylglucosamine to ManNAc-6-P (14). None of the subsequent genes involved in Neu5Ac synthesis in eukaryotes have previously been identified.

View larger version (22K): [in this window] [in a new window]   Fig. 1.   Bacterial and mammalian sialic acid metabolic pathways.

For sialylation to occur, Neu5Ac is then converted to the activated nucleotide sugar, cytidine monophosphate Neu5Ac (CMP-Neu5Ac) by CMP-Neu5Ac synthase. Genes for this enzyme have been identified in both prokaryotes (15) and eukaryotes (16). Sialyltransferases then use the sugar nucleotide as the substrate for sialylation of glycoconjugates.

In addition to Neu5Ac, over 40 other naturally occurring varieties of sialic acid have been identified in biological systems (17). Deaminated Neu5Ac (2-keto-3-deoxy-D-glycero-D-galacto-nononic acid; KDN), was discovered in 1986 in fish eggs and has since been observed in different species ranging from lower vertebrates to mammals (18). Less is known about KDN synthesis than Neu5Ac synthesis, although recent enzymatic studies in fish indicate that mannose (Man) and PEP are the substrates (17). KDN is produced through a multienzyme pathway involving phosphate intermediates similar to those of the mammalian Neu5Ac synthesis pathway (19).

In order to identify genes involved in sialic acid biosynthesis in eukaryotes, homology searches of a human expressed sequence tag (EST) data base were performed using the E. coli sialic acid synthase gene. A cDNA of approximately 1 kilobase pair with a predicted open reading frame (ORF) of 359 amino acids was identified. Northern blot analysis indicated that the mRNA is ubiquitously expressed, and in vitro transcription and translation along with recombinant expression in insect cells demonstrated that the gene (SAS) encoded a 40-kDa protein. SAS rescued an E. coli neuB mutant although less efficiently than neuB. Neu5Ac production in insect culture supplemented with ManNAc further supported the role of SAS in sialic acid biosynthesis. In addition to Neu5Ac, a second sialic acid, KDN, was generated, suggesting that the human enzyme has broad substrate specificity. The human enzyme (SAS), unlike its E. coli homologue, uses phosphorylated substrates to generate phosphorylated sialic acids and thus probably represents the previously described sialic acid-9-phosphate synthase of mammalian cells (12).

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Gene Characterization-- The E. coli neuB coding sequence was used to query the Human Genome Sciences (Rockville, MD) cDNA data base with BLAST software. One EST clone, HMKAK61, from a human (liver) cDNA library demonstrated significant homology to neuB and was chosen for further characterization. The tissue distribution profile was determined by Northern blot hybridization. Briefly, the cDNA was radiolabeled with [³²P]dCTP using a RediPrime^TMII kit (Amersham Pharmacia Biotech) following the manufacturer's directions. Multiple tissue Northern blots containing poly(A)⁺ RNA (CLONTECH, Palo Alto, CA) were prehybridized at 42 °C for 4 h and then hybridized overnight with radiolabeled probe at 1 × 10⁶ cpm/ml. The blots were sequentially washed twice for 15 min at 42 °C and once for 20 min at 65 °C in 0.1× SSC, 0.1% SDS and subsequently autoradiographed.

Baculovirus Cloning and Protein Expression-- The full-length ORF was amplified by PCR using the following primers. The forward primer, 5'-TGTAATACGACTCACTATAGGGCGGATCCGCCATCATGCCGCTGGAGCTGGAGC, contained a synthetic T7 promoter sequence (underlined), a BamHI site (italic type), a Kozak sequence (boldface type), and sequence corresponding to the first six codons of SAS. The minus strand primer, 5'-GTACGGTACCTTATTAAGACTTGATTTTTTTGCC, contained an Asp718 site (italic type), two in-frame stop codons (underlined), and sequences representing the last six codons of SAS.

After amplification, the PCR product was digested with BamHI and Asp718 (Roche Molecular Biochemicals), and the resulting fragment was cloned into the corresponding sites of the baculovirus transfer vector, pA2. Following DNA sequence confirmation, the plasmid (pA2-SAS) was transfected into Sf-9 cells to generate the recombinant baculovirus AcSAS as described previously (20). Amplified virus was used to infect cells, and the gene product was radiolabeled with [³⁵S]Met and [³⁵S]Cys. Bands corresponding to the gene product were visualized by SDS polyacrylamide gel electrophoresis and autoradiography. Alternatively, the PCR product was used as a template for in vitro transcription and translation using rabbit reticulocyte lysate (Promega, Madison, WI) in the presence of [³⁵S]Met. Translation products were resolved by SDS-polyacrylamide gel electrophoresis and visualized by autoradiography.

For protein production, Sf-9 cells were seeded in serum-free medium at a density of 1 × 10⁶ cells/ml in spinner flasks and infected at a multiplicity of infection of 1-2 with the recombinant virus. A detergent fractionation procedure was employed to separate nuclear from nonnuclear fractions (21). Protein was resolved by SDS-polyacrylamide gel electrophoresis, transferred to a ProBlott^TM membrane (ABI, Foster City, CA), and visualized by Ponceau S staining. A prominent band at the expected molecular mass of ~40 kDa was visible and excised for protein microsequencing using an ABI-494 sequencer (PE Biosystems, Foster City, CA).

Prokaryotic Cloning and Purification-- The human sialic acid synthase gene was transferred to the prokaryotic expression vector pTrcHis2-TOPO (Invitrogen, Carlsbad, CA). The gene was amplified by PCR with the forward primer 5'-ATGCCGCTGGAGCTGGAGTGTC, the reverse primer 5'-AGACTTGATTTTTTTGCCATGATTA, and the template pA2-SAS. The PCR product was ligated into pTrcHis2-TOPO directly, and the resulting plasmid (pTrcHis2-SAS) was transformed into DH5.

The strain DH5:pTrcHis2-SAS was grown in 1.5 liters of LB broth with 100 µg/ml ampicillin until A₆₀₀ = 0.6. Expression was induced by the addition of 0.5 mM isopropyl-1-thio--D-galactopyranoside for 1 h, after which the culture was harvested by centrifugation and lysed in a French pressure cell. The lysate was centrifuged at 27,000 × g for 15 min, and the supernatant was tumbled with Ni-Superflow resin (Qiagen, Valencia, CA) in 50 mM Tris, 300 mM NaCl, pH 8.0 (buffer A) at 6-8 °C overnight. The suspension was poured into a 0.4 × 4-cm column, and the packed resin was washed with buffer A and then buffer A plus 20 mM imidazole until the absorbance at 280 nm returned to base line. The enzyme was eluted as a single peak with buffer A plus 250 mM imidazole. Enzyme fractions were analyzed by SDS-polyacrylamide gel electrophoresis and detected in an immunoblot of these gels using an anti-Myc mouse monoclonal antibody (Invitrogen, Carlsbad, CA).

Neu5Ac/KDN Detection-- Sialic acid was measured by the procedure of Hara et al. (22). Ten µl of sample was treated with 200 µl of 1,2-diamino-4,5-methylene dioxybenzene dihydrochloride (DMB; Sigma) solution (7.0 mM DMB in 1.4 M acetic acid, 0.75 M -mercaptoethanol, and 18 mM sodium hydrosulfite) at 50 °C for 2.5 h, from which 10 µl was used for HPLC analysis on a Shimadzu (Columbia, MD) VP series HPLC using a Waters (Milford, MA) Spherisorb 5-µm ODS2 column. Peaks were detected using a Shimadzu RF-10AXL fluorescence detector with 448-nm emission and 373-nm excitation wavelengths. The mobile phase was an acetonitrile, methanol, and water mixture (9:7:84, v/v/v) with a flow rate of 0.7 ml/min. Response factors of Neu5Ac and KDN were established with authentic standards based on peak areas for quantifying sample sialic acid levels. Sialic acid content was normalized based on protein content measured with the Pierce BCA assay kit and a Molecular Devices (Sunnyvale, CA) microplate reader.

Cell Culture and Sialic Acid Quantification-- Sf-9 (ATCC, Manassas, VA) cells were grown in Ex-Cell^TM 405 medium (JRH BioScience, Lenexa, KS) with and without 10% fetal bovine serum (FBS) at 27 °C. CHO-K1 cells (ATCC) were cultured at 37 °C in a humidified atmosphere with 5% CO₂ in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 10% FBS, 100 units/ml penicillin, 100 µg/ml streptomycin, 100 µM minimal essential medium essential amino acids, and 4 mM L-glutamine (Life Technologies). Cells were grown to confluency in T-75 flasks, washed twice with phosphate-buffered saline, and lysed in 0.05 M bicine, pH 8.5, with 1 mM dithiothreitol (9) using a Tekmar Sonic Disrupter (Cincinnati, OH). For determination of sialic acid content, 10 µl of lysates with and without 10,000 molecular weight cut-off microfiltration (Millipore, Bedford, MA) were analyzed by DMB derivatization as described above.

Sugar substrate feeding was studied by plating approximately 10⁶ Sf-9 cells on each well of a six-well plate. Medium was replaced with 2 ml of fresh medium supplemented with 10 mM sterile-filtered Man, mannosamine (ManN), or ManNAc. Cells were left uninfected or infected with 20 µl of the appropriate (A35 or AcSAS) amplified baculovirus stock. Cells were harvested at 80 h postinfection by separating the pellet from the medium by centrifugation and washing twice with phosphate-buffered saline. Cells were lysed and analyzed for sialic acid content as described above.

In Vitro Activity-- In vitro activity assays were based on the procedure of Angata et al. (19). Lysates were prepared from A35 and AcSAS infected and uninfected Sf-9 cells cultured in T-75 flasks. After washing twice with phosphate-buffered saline, cells were lysed on ice with 25 strokes of a tightly fitting Dounce homogenizer (Wheaton, Millville, NJ) in 2.5 ml of lysis buffer (50 mM HEPES, pH 7.0, with 1 mM dithiothreitol, leupeptin (1 µg/ml), antipain (0.5 µg/ml), benzamidine-HCl (15.6 µg/ml), aprotinin (0.5 µg/ml), chymostatin (0.5 µg/ml), and 1 mM phenylmethylsulfonyl fluoride). 5 µl of substrate solution was incubated with either 20 µl of insect cell lysate (30 min) or purified E. coli protein (60 min) at 37 °C. The substrate solution contained 10 mM MnCl₂, 20 mM PEP, and either 5 mM ManNAc-6-P or 25 mM mannose 6-phosphate (Man-6-P; Sigma). ManNAc-6-P was prepared by acid hydrolysis of meningococcal group A polysaccharide. The polysaccharide (15.5 mg) in 5.8 ml of water was mixed with 770 mg of Dowex 50 H+ and heated for 1 h at 100 °C. The filtered hydrolysate was dried in vacuo, and the residue was dissolved to give a solution of 50 mM ManNAc-6-P and stored frozen. Substrate solutions containing 25 mM Man and ManNAc were also used. Assays performed with boiled lysates or without sugar substrates were used as negative controls. Following incubation, all samples were boiled for 3 min, centrifuged for 10 min at 12,000 × g, and split into two 10-µl aliquots. One aliquot was treated with 9 units of calf intestine alkaline phosphatase (Roche Molecular Biochemicals) along with 3 µl of accompanying buffer, while the other aliquot was diluted with water and buffer. Alkaline phosphatase (AP)-treated aliquots were incubated for 4 h at 37 °C, and 10 µl of both AP-treated and -untreated samples were reacted with DMB as described above. 2 µl of the samples incubated with insect lysates were injected onto the HPLC for sialic acid analysis as described above.

Similarly, sialic acid synthase activity in Ni-Superflow-purified fractions was assayed by the addition of aliquots to a solution containing the substrate mixture (buffer A plus 250 mM imidazole, pH 8.0) for 1 h at 37 °C. The reaction mixture was treated with AP, and 10 µl of the resulting sample was analyzed as described above.

For substrate competition experiments, Man-6-P and ManNAc-6-P concentrations in the substrate solution were varied from 1 to 20 mM. In vitro assays were run with Sf-9 lysates as described above. Samples were treated with 7 µl of buffer and 18 units of AP, incubated for 4 h at 37 °C, and analyzed for sialic acid content. Samples containing more than 1 mM ManNAc-6-P in the substrate solution produced high levels of sialic acid and were diluted 1:5 before injection to avoid fluorescence detector signal saturation.

Phage Sensitivity Assay for Sialic Acid Synthesis-- Sialic acid synthesis potential for plasmids was assayed by their ability to restore sensitivity to a polysialic acid specific phage (K1F) of a sialic acid synthase-negative K1 strain, EV24 (23). Cells harboring the test plasmid were cross-streaked onto agar plates containing Davis minimal medium supplemented with casamino acids, 0.2% glucose, 0.1% yeast extract dialysate, 0.5 mM isopropyl-1-thio--D-galactopyranoside, and 100 µg/ml ampicillin. Diminished cell growth was observed in the region of the culture containing bacteriophage in positive cultures.

Analysis with Aldolase Using High Performance Anion Exchange Chromatography (HPAEC)-- Sf-9 cells were grown in T-75 flasks and then infected with A35 or AcSAS or left uninfected in the presence or absence of 10 mM ManNAc. After 80 h, cells were washed twice in phosphate-buffered saline and sonicated. Aliquots (200 µl) were filtered through 10,000 molecular weight cut-off membranes, and 50-µl samples were treated with 12.5 µl of aldolase solution (0.0055 units of aldolase (ICN, Costa Mesa, CA), 1.4 mM NADH (Sigma), 0.5 M HEPES, pH 7.5, 0.7 units of lactate dehydrogenase (Roche Molecular Biochemicals)) or left untreated and incubated at 37 °C for 1 h (24). Samples were analyzed by HPAEC with a Dionex (Sunnyvale, CA) BioLC system using a pulsed amperometric detector (PAD-II) on a Carbopac PA-1 column. The initial elution composition was 50% A (200 mM NaOH), 45% B (water), and 5% C (1 M NaOAc, 200 mM NaOH) with a linear gradient to 50% A, 25% B, and 25% C at 20 min. A 6-min 50% A and 50% C washing followed. Samples were normalized based on protein content by dilution with water, and 20 µl of each sample was analyzed. Ten µl of each sample was also derivatized with DMB and analyzed by HPLC as described above to confirm the elimination of sialic acids by aldolase treatment.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Identification of a Human Sialic Acid Synthase Gene-- The E. coli sialic acid synthase gene (25) was used to search the human EST data base of Human Genome Sciences, Inc. (Rockville, MD). One EST with significant homology to the neuB gene was found in a human liver cDNA library and used to identify a full-length cDNA with an ORF homologous to the bacterial synthase over most of its length. The putative synthase consisted of 359 amino acids, while the neuB gene product contained 346 amino acids. Alignment of the human against the bacterial enzyme demonstrated that significant differences were found primarily in the N terminus (Fig. 2). Overall, the two synthases were found to be 36.1% identical and 56.1% similar at the amino acid level.

View larger version (48K): [in this window] [in a new window]   Fig. 2.   SAS homology alignment. Amino acid homology is shown of SAS (top) and bacterial sialic acid synthase (bottom).

The product of a cDNA amplification with a T7 promoter was expressed by in vitro transcription and translation using rabbit reticulocyte lysates. The generation of an ~40-kDa protein, consistent with a predicted molecular mass of 40.3 kDa, confirmed the existence of an ORF (Fig. 3A, lane 2). The negative control, namely the vector without an insert, did not produce a protein product (Fig. 3A, lane 1). Northern blot analysis was performed on poly(A)⁺ RNA blots representing a selection of human tissues (Fig. 3B). The full-length cDNA was radiolabeled and used as probe. A band of the expected size, ~1.3 kilobase pairs, was observed in all tissues tested, suggesting that the putative synthase is ubiquitously expressed.

View larger version (61K): [in this window] [in a new window]   Fig. 3.   SAS gene products. A, autoradiogram of SAS gene products after gel electrophoresis. Lanes labeled In Vitro represent transcription and translation of PCR product. PCR was performed with primers as described under "Experimental Procedures" with a T7 promoter using pA2 plasmid as PCR template (lane 1, negative control) and pA2-SAS as PCR template (lane 2). Lanes labeled Pulse Label indicate 35S pulse labeling of A35-infected (lane 4, negative control) and AcSAS-infected (lane 5) Sf-9 whole cell lysates. An arrow indicates SAS products. B, Northern blot probing for SAS mRNA from the indicated human tissues. PBL, peripheral blood lymphocyte. Scale is given in kilobases. C, Western blot with anti-Myc mouse monoclonal antibody of DH5:pTrcHis2-SAS whole cell lysates (lane 1) and SAS chimeric protein purified by hexahistidine affinity (lane 2).

SAS Is Expressed in Insect Cells and Bacteria-- SAS was inserted into baculovirus under the polh promoter using lacZ as a positive selection marker. After transfection and viral titering, the resulting virus (AcSAS) was used to infect Spodoptera frugiperda (Sf-9) cells followed by pulse labeling. An ~40-kDa band was observed in the Sf-9 lysates from cells infected by AcSAS (Fig. 3A, lane 5) and not in the mock-infected control (Fig. 3A, lane 4). Furthermore, this band co-migrated with the protein produced in vitro. To verify SAS expression, the band was visualized in the nonnuclear fraction (21) after electrophoretic transfer to a ProBlott^TM membrane and Ponceau S staining (data not shown) and excised for amino acid sequencing. The five N-terminal amino acids were identical to the second through sixth amino acids of the predicted protein (data not shown). Interestingly, the initiator methionine was also removed from the purified recombinant E. coli sialic acid synthase (9).

SAS was cloned into the prokaryotic expression vector pTrcHis2 to facilitate purification and to confirm function in vivo and in vitro. The expressed protein contained a carboxyl-terminal hexahistidine tag and a Myc peptide epitope. The chimeric protein was purified using the hexahistidine tag and was identified by Western blotting (Fig. 3C). N-terminal amino acid sequencing of the protein band produced in E. coli was as predicted and also lacked the amino-terminal methionine (data not shown).

SAS Expression Causes in Vivo KDN and Neu5Ac Production in Insect Cells-- Covalent labeling of sialic acids with the fluorescent reagent DMB allows very specific and sensitive sialic acid detection (22, 26). The DMB reaction products are identified after separation by reverse phase HPLC. Using this technique, sialic acid standards were measured in quantities as low as 50 fmol (data not shown). Sialic acid levels of an insect cell line (Sf-9) and a mammalian cell line (Chinese hamster ovary (CHO)) were compared (Table I). The sialic acid content in cell lysates before and after filtration through a 10,000 molecular weight cut-off membrane was determined by DMB labeling and HPLC separation. The native sialic acid levels in Sf-9 cells grown without FBS supplementation are substantially lower than the levels found in CHO cells (Table I; Fig. 4A). To ensure that the low sialic acid content was not due to the absence of serum, the sialic acid content of insect cells cultured in 10% FBS was determined. Even with FBS addition, the Neu5Ac content of Sf-9 cells is nearly an order of magnitude lower than the content of CHO cells (Table I). The origin of the sialic acid detected in insect cells, whether natively produced or the result of contamination from the medium, is not clear, since even serum-free insect cell medium contains significant levels of sialic acid (data not shown).

View larger version (35K): [in this window] [in a new window]   Fig. 4.   In vivo sialic acid content. A, sialic acid content of indicated lysed cells after filtration through a 10,000 molecular weight cut-off membrane as measured by DMB derivatization with reverse phase HPLC separation. The original chromatogram values have been divided by protein concentration to normalize chromatograms. The Neu5Ac standard represents 1000 fmol, N-glycolylneuraminic acid (Neu5Gc) 200 fmol, and KDN 50 fmol. B, sialic acid content of lysates of Sf-9 cells infected as labeled and grown in unsupplemented medium as measured by DMB derivatization with reverse phase HPLC separation. Original chromatogram values have been divided by protein concentration to normalize chromatograms. Neu5Ac and KDN standards represent 1000 fmol. C, sialic acid content of lysates of Sf-9 cells infected as labeled and grown in medium supplemented with 10 mM ManNAc as measured by DMB derivatization with reverse phase HPLC separation. Original chromatogram values have been divided by protein concentrations to normalize chromatograms. Neu5Ac and KDN standards represent 1000 fmol. D, HPAEC analysis of lysates of Sf-9 cells supplemented with 10 mM ManNAc and infected with A35 or AcSAS with and without aldolase treatment as indicated. Samples were diluted prior to column loading to normalize sialic acid quantities based on original sample protein concentration. The Neu5Ac standard represents 250 pmol, and the KDN standard represents 100 pmol.

The lack of large sialic acid pools in Sf-9 cells grown in serum-free medium facilitated the detection of sialic acids produced by recombinant enzymes. In order to examine the production of sialic acids from cells infected with recombinant virus, Sf-9 cells were infected with AcSAS and a negative control virus, A35. The A35 virus was generated by recombining a transfer vector without a gene inserted downstream of the polh promoter. Very low levels of Neu5Ac were observed in lysates from insect cells infected by either virus (Fig. 4B), indicating that additional Neu5Ac was not produced following the expression of SAS. However, a significant new peak was seen in AcSAS lysates at 12.5 min that was not observed in A35 negative control lysates (Fig. 4B). Published chromatograms suggested that the unknown early eluting peak could be N-glycolylneuraminic acid or KDN (17). The elution time of the unknown peak was the same as DMB-derivatized KDN standard (Fig. 4B) and co-chromatographed with authentic DMB-KDN (data not shown), confirming KDN generation in AcSAS-infected Sf-9 cells. KDN was not detected in uninfected Sf-9 cells either with or without FBS supplementation (Table I).

In a further attempt to demonstrate Neu5Ac synthetic functionality, the culture medium was supplemented with ManNAc, the metabolic precursor of Neu5Ac. In addition to a DMB-KDN peak, a prominent peak eluting at 17.5 min corresponding with that of the Neu5Ac standard was observed from the lysates of ManNAc-supplemented Sf-9 cells infected with AcSAS (Fig. 4C). Neu5Ac quantities were more than 100 times lower in the uninfected lysates and even less in A35-infected lysates (Table II).

Sialic acid levels were quantified in lysates of uninfected, A35-infected, and AcSAS-infected Sf-9 cells grown in medium with and without Man, ManN, or ManNAc supplementation (Table II). In uninfected cells, Man feeding resulted in detection of KDN slightly above background, and ManNAc feeding marginally increased Neu5Ac levels in uninfected and A35-infected cells (Table II). ManN supplementation had no effect on KDN levels but increased Neu5Ac levels (Table II). The most significant changes in sialic acid levels occurred with AcSAS infection. AcSAS infection of Sf-9 cells led to large increases in KDN levels with slight enhancements upon Man or ManNAc supplementation. Both AcSAS infection and ManNAc feeding were required to obtain substantial Neu5Ac levels.

The presence of KDN and Neu5Ac in AcSAS lysates has been confirmed by HPAEC with a pulsed amperometric detector (Fig. 4D). When the culture medium was supplemented with ManNAc, peaks with elution times corresponding to authentic KDN and Neu5Ac standards were seen in AcSAS-infected lysates that were absent in A35-infected lysates. Neu5Ac aldolase has been demonstrated previously to break Neu5Ac into ManNAc and pyruvic acid (8) and KDN into Man and pyruvic acid (27). KDN and Neu5Ac disappeared from the AcSAS lysates after aldolase treatment (Fig. 4D). A similar disappearance of the sialic acid peaks following aldolase treatment was observed using DMB labeling and HPLC analysis (data not shown).

Complementation of Sialic Acid Synthase Negative E. coli K1 with SAS-- E. coli K1 produces an extracellular polysialic acid, and this extracellular polysialic acid is detectable by either specific antibody or infectivity with a polysialic acid-specific bacteriophage (23). Sialic acid synthase encoded by the neuB gene is required for the production of polysialic acid. This prokaryotic indicator system and a mutant with an inactive neuB gene were used to test SAS function. The pTrcHis2-SAS plasmid containing SAS was transformed into the E. coli neuB mutant EV24 (28). Transformants of EV24 E. coli were streaked onto minimal medium plates and cross-streaked on a perpendicular axis with the polysialic acid-specific bacteriophage. Growth of EV24 without transformation was not affected by the bacteriophage streak (Fig. 5, Streaks 1), but the positive control bacteria, EV36, containing neuB (28) has significantly reduced growth (Fig. 5, Streaks 2). The infectivity of the EV24 mutant was restored by the presence of SAS (Fig. 5, Streaks 3) as evident from the lack of growth in the region streaked with bacteriophage. However, the plasmid containing SAS did not appear to complement EV24 as well as a plasmid containing the prokaryotic neuB gene (Fig. 5, Streaks 4). Similar complementation results were obtained when restoration of polysialic acid-specific infectivity was measured by lysis in liquid culture (data not shown). Thus, these experiments indicate that SAS complements the deleted neuB gene but less efficiently than the native E. coli sialic acid synthase gene.

View larger version (62K): [in this window] [in a new window]   Fig. 5.   NeuB mutant recovery. E. coli streaks were grown on minimum agar plates containing polysialic acid recognizing bacteriophage K1F in the plate region perpendicular to the streaks labeled Infected Region. Streaks were done from left to right as indicated. Streaks 1 represent the EV24 mutant harboring a defective copy of neuB, whereas Streaks 2 are the wild type (phage K1F-sensitive control strain, EV36). Streaks 3 are EV24 transformed with pTrcHis2-SAS that expresses chimeric SAS, and Streaks 4 are EV24 transformed with pNEUB (9) that expresses neuB.

SAS Activity Uses Phosphate Intermediates in Vitro-- The mammalian pathway for Neu5Ac synthesis uses a phosphate intermediate (11-13), while the E. coli pathway directly converts ManNAc and PEP to Neu5Ac (9). In order to determine which substrates are used by the human enzyme, in vitro assays were performed using lysates of infected Sf-9 cells and protein purified from the prokaryotic expression system. Lysates or purified protein plus PEP and MnCl₂ (19) were incubated with Man, Man-6-P, ManNAc, or ManNAc-6-P followed by DMB labeling and HPLC analysis.

AcSAS-infected cell lysates incubated with ManNAc-6-P and PEP produced a peak eluting at 5.5 min (Fig. 6A), consistent with phosphorylated sugars. In previous studies, phosphorylated KDN was detected as DMB-KDN after AP treatment and DMB derivatization (19). Similarly, the peak eluting at 5.5 min was exchanged for one that eluted at the same time as authentic Neu5Ac following AP treatment (Fig. 6A). Likewise, an early eluting peak from the incubation mixture containing Man-6-P yielded a KDN peak after AP treatment (Fig. 6B). No sialic acid products were detected when A35-infected cell lysates were used in the equivalent assays (data not shown). In vitro assays were also performed on the recombinant human synthase purified from E. coli with similar results. KDN and Neu5Ac peaks were detected when Man-6-P and ManNAc-6-P were used as substrates, respectively, followed by AP treatment (Fig. 6C). Assays performed using ManNAc and Man as substrates were compared with those using ManNAc-6-P and Man-6-P after AP treatment. Upon AP treatment, Neu5Ac production with 5 mM ManNAc-6-P as the substrate was 70 times the Neu5Ac production obtained using 25 mM ManNAc as a substrate (Fig. 7A). When Man was used as a substrate, KDN levels did not increase above the background levels of KDN obtained from an AcSAS infection (Fig. 7B). Sialic acid peaks were also not observed when Man or ManNAc was used as a substrate in assays with the human synthase purified from E. coli (data not shown).

View larger version (24K): [in this window] [in a new window]   Fig. 6.   In vitro assays. Lysates of Sf-9 cells infected with AcSAS or recombinant protein purified from E. coli were incubated with Man-6-P or ManNAc-6-P as described under "Experimental Procedures." A, in vitro Neu5Ac phosphate synthase assay of Sf-9 lysates before and after AP treatment with standards (5000 fmol of KDN and Neu5Ac). B, in vitro KDN phosphate synthase assay of Sf-9 lysates before and after AP treatment with standards (5000 fmol of KDN and Neu5Ac). C, in vitro assays with ManNAc-6-P or Man-6-P substrates as indicated using protein samples purified from E. coli. Samples were treated with AP, and standards represent 1000 fmol of Neu5Ac and 250 fmol of KDN. The asterisk indicates a peak caused by a contaminant from the ManNAc-6-P preparation.

View larger version (15K): [in this window] [in a new window]   Fig. 7.   In vitro sugar specificity assays. Lysates of Sf-9 cells infected with AcSAS were incubated with Man, ManNAc, Man-6-P, or ManNAc-6-P as described under "Experimental Procedures." Samples were then analyzed by HPLC after AP treatment along with standards (2000 fmol of KDN and Neu5Ac). A, assay with ManNAc-6-P and ManNAc used as sugar substrates. B, assay with Man-6-P and Man used as sugar substrates. Background KDN level from AcSAS infection is illustrated by the chromatogram labeled No Substrate.

Assays were performed by incubating lysates with different substrate solution concentrations of Man-6-P and ManNAc-6-P in order to evaluate substrate preference. After incubation for a fixed time period, the samples were treated with AP, and DMB derivatives of Neu5Ac and KDN were quantified and compared (Table III). When equimolar amounts of substrates are used, Neu5Ac production is significantly favored over KDN especially at higher equimolar concentrations (10 and 20 mM) of the two substrates. Only when the substrate concentration of ManNAc-6-P is substantially lower than the Man-6-P levels are production levels of the two sialic acids comparable. When the ManNAc-6-P concentration is 1 mM and the Man-6-P level is 20 mM, the Neu5Ac/KDN production ratio approaches unity. Therefore, the enzyme prefers ManNAc-6-P over Man-6-P in the production of phosphorylated forms of Neu5Ac and KDN, respectively.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We have identified the sequence of a human sialic acid phosphate synthase gene, SAS, whose protein product condenses ManNAc-6-P or Man-6-P with PEP to form Neu5Ac and KDN phosphates, respectively. To our knowledge, this is the first report of the cloning of a eukaryotic sialic acid phosphate synthase gene. Despite the importance of sialic acids in many biological recognition phenomena, sialic acid phosphate synthase genes have not been cloned because the enzymes they encode are unstable and difficult to purify (12, 19). Even the E. coli sialic acid synthase enzyme, whose sequence is known, has low specific activity and is unstable (9).

Consequently, a bioinformatics approach based on the E. coli synthase sequence was used to identify a putative human gene 36% identical and 56% similar to neuB. In vitro transcription and translation verified an open reading frame that encoded a 359-amino acid protein. In addition, Northern blots revealed ubiquitous transcription of the human synthase gene in a selection of human tissues. The wide distribution of SAS mRNA is consistent with the detection of sialic acids in many different mammalian tissues (18).

Using the baculovirus expression system, the 40-kDa sialic acid phosphate synthase enzyme, SAS, was expressed in cells. The use of Sf-9 cells that have little if any native sialic acid greatly facilitated the detection of sialic acids and the characterization of SAS. However, Neu5Ac was observed only when insect cells were infected with AcSAS and the cell culture medium was supplemented with ManNAc, a sialic acid precursor. This ManNAc feeding requirement indicates that Sf-9 cells may lack sizable ManNAc pools and synthetic pathways.

SAS was identified based on homology with neuB, whose enzyme product directly forms Neu5Ac from ManNAc and PEP (9). The E. coli sialic acid synthase has previously shown no sialic acid synthetic activity with ManNAc-6-P or Man as substrate (9). However, mammalian cells are known only to produce Neu5Ac from ManNAc through a three-step pathway with phosphorylated intermediates. Therefore, in vitro assays were performed to determine the substrate specificity of SAS. Assays with AcSAS-infected Sf-9 lysates using ManNAc-6-P showed 70 times the sialic acid levels of those using ManNAc even when ManNAc was supplied at 5 times the ManNAc-6-P concentration. The synthesis of small amounts of Neu5Ac using ManNAc as a substrate may result either from low level conversion of the ManNAc substrate or from insect cell hexokinase activity in the cell lysates. Hexokinases could convert ManNAc supplied in the assay and ATP, which exists in substantial quantities in AcSAS-infected insect cells (data not shown), to ManNAc-6-P.

The product of the ManNAc-6-P reaction was further characterized. A rapidly eluting DMB-derivatized product, typical of a phosphorylated sialic acid, was observed when ManNAc-6-P was used as the substrate. Furthermore, this peak disappeared with the appearance of an unsubstituted DMB-Neu5Ac peak following AP treatment. SAS therefore condenses PEP and ManNAc-6-P to form a Neu5Ac phosphate product. Although the exact position of the phosphorylated carbon on the product has not yet been specified, SAS is probably the sialic acid phosphate synthase enzyme of the previously described three-step mammalian pathway (11-13). Despite the presence of few if any native pools of sialic acids, Sf-9 cells possess the ability to complete the three-step mammalian pathway when only the sialic acid phosphate synthase gene is provided. Sf-9 cells have been shown to have significant ManNAc kinase ability (29), and phosphatase activity has also been detected in insect cells (30).

The capacity to produce sialic acids in Sf-9 cells following AcSAS infection and ManNAc supplementation at levels even higher than those seen in a mammalian cell line such as CHO may help overcome a major limitation of the baculovirus expression system. N-Glycans of recombinant glycoproteins produced in insect cells lack significant levels of terminal sialic acid residues (31, 32). The lack of sialylation on human thyrotropin produced by the baculovirus expression system resulted in rapid in vivo thyrotropin clearance as compared with thyrotropin produced by a mammalian system (5). Generation of significant sialic acid pools along with expression of other genes such as sialyltransferases may lead to production of significant levels of sialylated glycoproteins in insect cells.

Differences in substrate specificity between the human and E. coli synthase enzymes may explain the limited effectiveness of neuB recovery with SAS in E. coli. Partial complementation of the E. coli EV24 neuB mutant with SAS suggests that either ManNAc may be a low level substrate or sialic acid is formed through the action of an intracellular phosphatase. In the latter case, ManNAc-6-P would be converted to phosphorylated sialic acid by SAS with subsequent conversion to sialic acid. Since the amount of complementation observed is low, high levels of endogenous phosphatase activity or ManNAc-6-P are not required. ManNAc-6-P can be generated in bacteria by N-acyl-D-glucosamine 6-phosphate 2-epimerase, which converts N-acetylglucosamine 6-phosphate to ManNAc-6-P (33). Differences in protein folding between the E. coli and human enzymes may also contribute to the inability of SAS to completely recover neuB function in bacteria. SAS expressed in E. coli also included a C-terminal histidine tag and Myc epitope, whose effects on SAS activity are unknown.

Another interesting observation was the occurrence of a second DMB-reactive peak in AcSAS-infected Sf-9 lysates. This peak has been identified as KDN, a deaminated Neu5Ac. We subsequently demonstrated that the SAS enzyme generates KDN phosphate from Man-6-P and PEP in vitro, and no KDN synthetic ability is detected using Man as a substrate. While Neu5Ac production in insect cells requires both AcSAS infection and ManNAc supplementation, only AcSAS infection is necessary for KDN synthesis. Therefore, significant substrate pools for the generation of KDN already exist in insect cells or are present in the medium. In addition, mannose feeding increased KDN production even further. Interestingly, Man feeding of the uninfected insect cells increased KDN levels above background, and ManNAc feeding also led to higher Neu5Ac levels in uninfected cells. Therefore, insect cells may possess limited native sialic acid synthetic ability. Similar substrate supplementation results have been reported in mammalian cells, since cultivation in Man-rich or ManNAc-rich medium enhanced the synthesis of native intracellular KDN and Neu5Ac, respectively (34).

This study is the first report of a eukaryotic gene encoding any enzyme with KDN synthetic ability. Recently, KDN enzymatic activity has been characterized in trout testis, a tissue high in KDN content. KDN is synthesized from Man in trout through a three-step pathway involving a synthase with a Man-6-P substrate (19). However, the fish synthase enzyme, partially purified from trout testis, was approximately 80 kDa as compared with the human enzyme of 40 kDa. Furthermore, KDN and Neu5Ac phosphate synthesis in trout were probably catalyzed by two separate synthase activities (19), while the current study indicates that both products were generated from a single human enzyme with broad substrate specificity.

Neu5Ac, usually bound to glycoconjugates, is the predominant sialic acid found in mammalian tissue, but KDN, primarily found free in the ethanol-soluble fractions, has also been detected in all human tissues examined so far (18). The ratio of Neu5Ac to KDN is on the order of 100:1 in blood cells and ovaries (17), although this ratio may change during development and cancer. The levels of free KDN in newborn fetal cord red blood cells are higher than those of maternal red blood cells (17). Furthermore, a 4.2-fold increase in the ratio of free KDN to free Neu5Ac was observed in ovarian tumor cells as compared with normal cells, and the ratio appears to increase with the extent of invasion or malignancy for ovarian adenocarcinomas (17).

Because the KDN/Neu5Ac ratio has biological significance, we performed competitive in vitro assays with insect cell lysates using both ManNAc-6-P and Man-6-P as substrates. SAS demonstrated a preference for phosphorylated Neu5Ac over phosphorylated KDN synthesis in vitro, although the concentrations of the particular substrates relative to the enzyme level altered this production ratio. Thus, changes in the ratios of free KDN to Neu5Ac observed in different developmental states and cancer tissue may reflect variability either in the levels of specific substrates or the amount of active enzyme present in vivo. The identification of the SAS genetic sequence and characterization of the enzyme it encodes should help further our understanding of sialic acid biosynthesis as well as the roles sialic acids play in development and disease states.

	ACKNOWLEDGEMENTS

We gratefully thank Eric Vimr for the EV24 E. coli strain and review of the manuscript, Saul Roseman for review of the manuscript, and Joelle Porter for work on the Northern blots.

	FOOTNOTES

^* This work was supported by National Science Foundation Grant BES9814100 from the Metabolic Engineering Program and National Science Foundation Grant DGE9843635 from the Graduate Research Fellowship Program (to S. M. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF257466.

^** To whom correspondence should be addressed: Dept. of Chemical Engineering, The Johns Hopkins University, Baltimore, MD 21218. Tel.: 410-516-5461; Fax: 410-516-5510; E-mail: beten@jhu.edu.

Published, JBC Papers in Press, April 3, 2000, DOI 10.1074/jbc.M000217200

	ABBREVIATIONS

The abbreviations used are: Neu5Ac, N-acetylneuraminic acid; KDN, 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid; PEP, phosphoenolpyruvate; ManNAc, N-acetylmannosamine; ManNAc-6-P, N-acetylmannosamine 6-phosphate; CMP-Neu5Ac, cytidine monophosphate Neu5Ac; Man, mannose; EST, expressed sequence tag; ORF, open reading frame; DMB, 1,2-diamino-4,5-methylene dioxybenzene dihydrochloride; CHO, Chinese hamster ovary; FBS, fetal bovine serum; ManN, mannosamine; HPAEC, high performance anion exchange chromatography; Man-6-P, mannose-6-phosphate; AP, alkaline phosphatase; PCR, polymerase chain reaction; HPLC, high performance liquid chromatography.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. Castilho, M. Pabst, R. Leonard, C. Veit, F. Altmann, L. Mach, J. Glossl, R. Strasser, and H. Steinkellner Construction of a Functional CMP-Sialic Acid Biosynthesis Pathway in Arabidopsis Plant Physiology, May 1, 2008; 147(1): 331 - 339. [Abstract] [Full Text] [PDF]

				K. Viswanathan, N. Tomiya, J. Park, S. Singh, Y. C. Lee, K. Palter, and M. J. Betenbaugh Expression of a Functional Drosophila melanogaster CMP-sialic Acid Synthetase: DIFFERENTIAL LOCALIZATION OF THE DROSOPHILA AND HUMAN ENZYMES J. Biol. Chem., June 9, 2006; 281(23): 15929 - 15940. [Abstract] [Full Text] [PDF]

				T. Hamada, Y. Ito, T. Abe, F. Hayashi, P. Guntert, M. Inoue, T. Kigawa, T. Terada, M. Shirouzu, M. Yoshida, et al. Solution structure of the antifreeze-like domain of human sialic acid synthase Protein Sci., May 1, 2006; 15(5): 1010 - 1016. [Abstract] [Full Text] [PDF]

				P. Maliekal, D. Vertommen, G. Delpierre, and E. Van Schaftingen Identification of the sequence encoding N-acetylneuraminate-9-phosphate phosphatase Glycobiology, February 1, 2006; 16(2): 165 - 172. [Abstract] [Full Text] [PDF]

				E. J. Kim, S.-G. Sampathkumar, M. B. Jones, J. K. Rhee, G. Baskaran, S. Goon, and K. J. Yarema Characterization of the Metabolic Flux and Apoptotic Effects of O-Hydroxyl- and N-Acyl-modified N-Acetylmannosamine Analogs in Jurkat Cells J. Biol. Chem., April 30, 2004; 279(18): 18342 - 18352. [Abstract] [Full Text] [PDF]

				Y. Hong and P. Stanley Lec3 Chinese Hamster Ovary Mutants Lack UDP-N-acetylglucosamine 2-Epimerase Activity Because of Mutations in the Epimerase Domain of the Gne Gene J. Biol. Chem., December 26, 2003; 278(52): 53045 - 53054. [Abstract] [Full Text] [PDF]