HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 24, 18441-18446, June 16, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/24/18441    most recent M001411200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Küster, B. Articles by Karlish, S. J. D. Search for Related Content PubMed PubMed Citation Articles by Küster, B. Articles by Karlish, S. J. D. Social Bookmarking                      What's this?

A New Variant of the  Subunit of Renal Na,K-ATPase

IDENTIFICATION BY MASS SPECTROMETRY, ANTIBODY BINDING, AND EXPRESSION IN CULTURED CELLS^*

Bernhard Küster^§, Alla Shainskaya^¶, Helen X. Pu, Rivka Goldshleger^**, Rhoda Blostein, Matthias Mann, and Steven J. D. Karlish^**

From the  Protein Interaction Laboratory, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark, the  Department of Medicine, McGill University, Montreal, Quebec H3G 1A4, Canada, and the Departments of ^¶ Biological Services and ^** Biological Chemistry, Weizmann Institute of Science, Rehovoth 76100, Israel

Received for publication, February 21, 2000, and in revised form, March 14, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The  subunit is a specific regulator of Na,K-ATPase expressed mainly in kidney. On SDS-polyacryylamide gel electrophoresis,  runs as a doublet, but the origin and significance of the doublet is obscure. Mass spectrometry of the  chains of rat kidney Na,K-ATPase shows that _a (upper) has a mass of 7184.0 ± 1 Da (carbamidomethyl cysteine), corresponding closely to that for the published sequence without the initiator methionine, while _b (lower) has a mass of 7337.9 ± 1Da. Tryptic peptide mapping and sequencing by mass spectrometry reveals that the seven N-terminal residues of _a, TELSANH, are replaced by Ac-MDRWYL in _b, but otherwise the chains are identical. Antibodies raised against peptides TELSANHC and MDRWYLC recognize either _a or _b of the Na,K-ATPase, respectively. _a or _b cDNAs have been expressed in human embryonic kidney and HeLa cells. The major bands expressed correspond to _a or _b of renal Na,K-ATPase. Additional minor bands seen after transfection, namely _a' in human embryonic kidney and _b' in HeLa, are presumably cell-specific modifications. The present work clarifies earlier uncertainty regarding doublets seen in kidney and in transfected cells. In particular, the results show that renal Na,K-ATPase contains two variants of the  subunit with different sequences but otherwise are unmodified. We discuss the possible functional significance of the two variants.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The  subunit of the Na,K-ATPase is a small, single transmembrane protein (mass  7 kDa) expressed primarily in renal tissue, in approximately equimolar amounts compared with the  and  subunits (1-6). It has substantial homology to CHIF (corticosteroid-induced factor) (7), mat 8 (8), and phospholemman (9), which have similar trans-membrane organization (C terminus in, N terminus out) and appear to function as ion channel regulators. A comparison of sequences shows that  subunits of different species are approximately 75% homologous. If only mammalian sequences are compared, the homology increases to 93%.

Several findings imply a stable association of  with  and  subunits in tissues expressing all three subunits. The expression patterns of the catalytic  and  subunits are identical in renal proximal tubules and collecting ducts (5), and the  subunit is expressed at the surface of Xenopus oocytes only in the presence of  and  subunits (10). In addition, co-immunoprecipitation of the  subunit with both the  and  subunits has been demonstrated in kidney membranes (5), and the  subunit is also co-solubilized with fragments of  and  subunits in a complex obtained from extensively digested pig kidney Na,K-ATPase (11). On the other hand, Jones et al. (12) have reported expression of  also in the absence of the sodium pump on the apical surface of mouse blastocysts.

The functional role of the  subunit is being actively studied both in intact renal membranes utilizing antibodies to counteract its effects (6, 13) and after expression in mammalian cells (13, 14), insect cells (15), or Xenopus oocytes (10). A number of functional effects have been described, which may reflect one or more interactions of the  subunit with the / subunits of the Na,K-ATPase. Experiments with intact renal Na,K-ATPase and mammalian cell membranes containing the expressed  subunit show that it increases the affinity for ATP either as a primary effect or, more likely, as a consequence of a shift in conformational equilibrium in favor of E₁ form(s) (6, 13). Consistent with these effects, the apparent affinity for K⁺ is decreased under conditions of suboptimal ATP concentration (16). There is a recent report that the  subunit expressed in mammalian kidney cells decreases the apparent cytoplasmic sodium affinity (14). In addition, experiments on cRNA-injected Xenopus oocytes have shown that the  subunit has an influence on the apparent affinity of the Na,K-ATPase for extracellular K⁺ in a complex Na⁺- and voltage-dependent fashion (10). In another report, the human  subunit was shown to induce non-selective ouabain-independent ion currents in injected Xenopus oocytes, and ⁸⁶Rb and ²²Na influx in baculovirus-infected Sf-9 cells (15).

On SDS-PAGE¹ of renal membranes isolated from all species examined to date, the  subunit runs as a doublet (apparent mass, 8 and 9 kDa) (5, 6), and a doublet has also been observed upon expression of  in tissue culture cells (13, 14) and in in vitro expression systems in the presence of pancreatic microsomes (5) but not in their absence (10). A post-translational modification might be suggested on the basis of the findings, while other possibilities include the presence of separate isoforms or splice variants. In view of the largely tissue-specific expression of the  subunit in kidney and the new evidence for a regulatory role, it becomes important to establish the origin of the doublet of bands in renal membranes and their possible association with the diverse functional effects on renal Na,K-ATPase that have been described recently. This paper describes the results of experiments that define the structural difference between the two bands as the result of different primary sequences.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Na,K-ATPase was purified from Milan hypertensive rat kidneys by the method of Jorgensen (17). The specific activity was in the range 16-30 µmol of P_i/mg/min.The rat renal enzyme was reduced and alkylated with iodoacetamide, and the two  subunits were separated on a 10% Tricine SDS gel (18) and stained with Coomassie Brilliant Blue. The two bands were excised from the gel and destained using multiple washings with 50% acetonitrile in 50 mM ammonium bicarbonate. The  subunits were extracted from the gel pieces by overnight incubation in a mixture of 1:2:3 (v/v/v) formic acid, isopropyl alcohol, and water at room temperature (19).

Mass Spectrometry

Intact Molecular Weight Measurements-- Extracted  subunits were further purified prior to MS analysis. Briefly, the dried extract from one lane of the gel (2-3 µg of  subunit) was redissolved in 1 µl of 80% formic acid and immediately diluted with water to yield a final concentration of 5% formic acid. This preparation was passed over a microcolumn consisting of about 300 nl of Poros R1 reversed phase material (Perseptive Biosystems, Framingham, MA) packed in an Eppendorf Gel Loader pipette tip (20), and the purified protein was eluted directly into a nano-electrospray capillary (Protana A/S, Odense, Denmark) using 1 µl of 70% acetonitrile, 5% formic acid. Protein mass spectra were acquired using a nano-electrospray ion source (Protana A/S) (21) on an API 300 triple quadrupole mass spectrometer (PE Sciex, Concord, Ontario, Canada).

In Gel Digestion, Peptide Mass Mapping, and Peptide Sequencing-- In gel tryptic digestion of the two separated  bands was performed as described (22). Briefly, protein was excised from the gel (usually one lane containing 2-3 µg of  subunit), fully destained, reduced, carbamidomethylated, and digested overnight with bovine trypsin (sequencing grade, Roche Diagnostics, Mannheim, Germany) at a concentration of 12.5 ng/µl in 50 mM ammonium bicarbonate at 37 °C. Peptide mass mapping was performed on a Bruker Reflex III matrix-assisted laser desorption/ionization (MALDI) time-of-flight mass spectrometer (Bruker, Bremen, Germany) equipped with a 337 nm nitrogen laser. Matrix surfaces were made from -cyano-4-hydroxycinnamic acid by the fast evaporation method (23, 24). About 1-2% (0.3-0.5 µl) of the supernatant of in gel trypsin digests were injected into an acidified drop previously deposited onto the matrix surface, and the sample was allowed to dry at ambient temperature before MS analysis. Prior to peptide sequencing by tandem mass spectrometry, the peptide mixture was extracted from the gel by two changes of 5% formic acid, followed by 100% acetonitrile. The combined extracts were dried in vacuo. The dried peptides were redissolved in 5% formic acid and purified using a microcolumn consisting of approximately 300 nl of Poros R2 reverse phase material (Perseptive Biosystems) (22). Peptides were eluted with 60% methonol/5% formic acid directly into a nano-electrospray capillary and sequencing was performed by nano-electrospray tandem mass spectrometry on a prototype quadrupole time-of-flight mass spectrometer (PE Sciex). For sequencing peptides from rat _b, the in gel tryptic digestion was also performed in the presence of 50% ¹⁸O-labeled water (25).

Expression Experiments

Cloning of Rat _a and _b cDNAs-- For transfection into HEK cells, the cDNA for _a was obtained as described previously (13). The cDNA for _b was obtained by PCR using CLONTECH Marathon-ready cDNA from rat kidney as template, with primers designed according to the N-terminal _b protein sequence obtained by mass spectrometry. The forward primer was GGGGGGGAAGCTTGCCGCCACCATGGACAGATGGTATCTTGGTGGCAGT containing a HindIII restriction site, and the reverse primer was GGGGAAGATCCGTCACAGCTCATCTTCATTGACCT containing a BamHI restriction site. The resulting cDNA was then cleaved by these two endonucleases and ligated into the pREP4 expression vector (CLONTECH). Positive clones were verified by nucleotide sequencing. pREP4, pREP-_a, and pREP4-_b were purified using the Concert^TM high purity plasmid purification system (Life Technologies, Inc.). For transfection into HeLa cells, PCR was carried out as above, except the following primers containing restriction sites for BamHI (forward primers) and BstXI (reverse primer), respectively, were used. The forward primer for _a was GGGGGGGGATCCGCCGCCACCATGACAGAGCTGTCAGCTAAC, and for _b, GGGGGGGGATCCGCCGCCACCATGGACAGATGGTATCTTGGTGGCAGT. The reverse primer for both _a and _b was GGGGGGCCAGCACACTGGGTCACAGCTCATCTTCATTGACCTGCCTAT. The resulting DNAs were then cleaved, ligated into the pIRES expression vector (CLONTECH), and then verified and purified as described above.

Transfection, Tissue Culture, and Membrane Preparation-- The procedures for transfecting HEK cells were as described elsewhere (13), except that the LipofectAMINE Plus^TM reagent (Life Technologies, Inc.) was used as directed by the manufacturer. HeLa cells (50% confluent) were similarly transfected, and single clones were selected after 3 weeks' growth in Dulbecco's modified Eagle's medium containing 10% newborn calf serum and 400 µg/ml hygromycin B.

Western Blot Analysis

Western blot analysis on HEK or HeLa cell membranes was carried out as described previously (6). Briefly, 5 µg of cell membranes were analyzed on 10% SDS-PAGE, after which the proteins were transferred to a polyvinylidene difluoride membrane (Millipore) and probed with anti-1 (6H antibodies from Dr. Michael Caplan) and anti- antiserum (C33 polyclonal antiserum raised against the 10-residue C terminus of _a), both at 1:2000 dilution. Western blots of rat kidney Na,K-ATPase utilized either the C33 polyclonal antiserum or specific anti-_a and anti-_b antisera (1:100 dilution). _a-specific or _b-specific antibodies were raised in rabbits utilizing synthetic peptides TELSANHC (_a) or MDRWYLC (_b), coupled to maleimide-activated keyhole limpet hemocyanin as immunogens (Biological Services, Weizmann Institute, Rehovoth, Israel).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Intact Protein Mass Determination-- As a first step toward establishing the molecular basis for the observed difference in the migration behavior of _a and _b on SDS-PAGE, the separated, intact proteins were extracted from the gel and subjected to molecular weight determination by mass spectrometry. The results of the mass measurements for the intact proteins are illustrated in Fig. 1. The measured mass for the _a subunit (7184.0 ± 1 Da) is in excellent agreement with the mass deduced from the published amino acid sequence of rat kidney _a without the initiator methionine (7183.1 Da, calculated for carbamidomethyl cysteine) (see GenBank^TM accession no. AF129400). This result implies that the protein is not modified. Satellite peaks indicative of oxidation of the protein during extraction (+16 Da) were also observed. For the _b subunit, a number of species were detected at 7337.9 ± 1, 7353.8 ± 1, 7369.9 ± 1, and 7385.9 ± 1 Da, respectively. From the mass increments of 16 Da between the measured signals, multiple oxidation of the protein during extraction is apparent. The measured mass differences between _b and the published sequence of _a (154, 170, 186, and 202 Da respectively) indicate either the presence of post-translational modifications or sequence variations. In this regard, it is interesting to note that, despite its higher molecular weight, the _b subunit actually migrates faster during SDS-PAGE compared with _a.

View larger version (20K): [in this window] [in a new window]   Fig. 1.   Intact molecular mass determination of rat a and b. Top panel, raw nano-electrospray mass spectra of rat a and b showing a series of multiply charged species of the two proteins. Bottom panel, deconvoluted mass spectra showing the neutral mass of the proteins together with oxidized species as calculated from the respective spectra in the upper panel.

Peptide Mapping of _a and _b Subunits-- In order to determine the region of the protein in which the observed mass discrepancy between _a and _b resides, the proteins were subjected to in gel proteolytic cleavage and the resulting peptide mixture was mapped using MALDI MS. The mass difference of 154 Da between the _a and _b subunits determined from the intact mass measurements for both subunits, together with the corresponding oxidized species, was also detected at the peptide level (Fig. 2). The prominent signal for the N-terminal peptide of _a (observed at a mass to charge ratio of m/z 1171.61 in Fig. 2A), was not present in the MALDI peptide mass map of _b (Fig. 2B). Instead, a prominent signal at m/z 1325.62 was observed together with multiple oxidized species (+16, +32, and +48 Da) of the same peptide. Hence, it can be concluded that the modification or sequence variation maps to this peptide. The signals at m/z 1719 and 1847 in the MALDI MS spectra of both gamma subunits correspond to the tryptic peptides GTENPFEYDYETVR and GTENPFEYDYETVRK (residues 14-27/28) of the published rat  sequence. No significant difference other than the one described was observed between the peptide maps of the two subunits.

View larger version (20K): [in this window] [in a new window]   Fig. 2.   Peptide mass mapping of a and b. The MALDI MS spectra of a (A) and b (B) after in gel trypsin digestion reflect the mass difference of 154 Da observed for the intact proteins. The prominent peptide at m/z 1171.61 of a in A is replaced by a peptide ion signal at m/z 1325.62 in b (B) together with a series of oxidized species of the same peptide (+16, +32, and +48 Da, respectively).

Peptide Sequencing by Tandem Mass Spectrometry-- The peptides responsible for the mass difference between _a and _b were subjected to sequencing by nano-electrospray tandem mass spectrometry (Fig. 3). For the peptide at m/z 1171.61 in the MALDI peptide mass map of _a, the sequence TELSANHGGSAK was determined from the C-terminal Y" ion fragment ion series (26) (Fig. 3A). This sequence corresponds exactly to the N-terminal tryptic fragment of the sequence reported in the literature (6, 15) without the initiator methionine. This result confirmed the conclusion that _a is not modified as deduced also from the mass of the intact _a. The corresponding N-terminal tryptic peptide of _b (m/z 1325.62 in Fig. 2B) was also sequenced by tandem mass spectrometry. The interpretation of the spectrum shown in Fig. 3B resulted in the determination of the sequence Ac-MDRWY(I/L)GGSAK (note that I/L cannot be distinguished by mass spectrometric sequencing as the two residues are isobaric). The sequence determination was confirmed by performing a second experiment in which the tryptic digest was carried out in the presence of 50% ¹⁸O-labeled water. Partial ¹⁸O labeling of peptides during trypsin digestion allows the determination of the direction in which the sequence is read from the tandem mass spectrum as only those peptide fragments that carry the C terminus of the peptide are observed as a doublet with 2-Da spacing (see Fig. 3B, inset) (25). Comparison of the deduced sequence for _b with that of _a shows that the 7 N-terminal amino acids of _a TELSANH are replaced by Ac-MDRWY(I/L) in _b. These two partial sequences also differ by 154 Da. The calculated intact mass of the revised sequence of _b (7337.4 Da, N-acetylated, carbamidomethyl cysteine) is in excellent agreement with the measured value of 7337.9 ± 1 Da. Further sequencing experiments also revealed peptides corresponding to the oxidized species Ac-MoxDRWY(I/L)GGSAK, Ac-M_oxDRW_oxY(I/L)GGSAK, and Ac-M_oxDRW_oxoxY(I/L)GGSAK, thus explaining the corresponding signals observed in the MALDI MS peptide mass map and the spectrum of the intact protein. An EST data base search reported in Ref. 27 has revealed sequences MDRWYL.., indicating that L and not I is the correct assignment in position 6. 

View larger version (27K): [in this window] [in a new window]   Fig. 3.   Peptide sequencing by nano-electrospray tandem MS. A, sequencing of the doubly protonated a peptide (M + 2H)2+ corresponding to the peptide detected at m/z 1171.61 in the MALDI peptide mass map (Fig. 2A) revealed the sequence TELSANHGGSAK, which is identical to the N terminus of the published  sequence without the initiator methionine residue. B, de novo sequencing of the N-terminal peptide of b ((M + 2H)2+ corresponding to the peptide detected at m/z 1325.62 in the MALDI peptide mass map; Fig. 2B) resulted in the sequence Ac-MDRWYLGGSAK. Sequences were derived from the C-terminal (Y"n) and N-terminal (an and bn) fragment ion series (nomenclature as in Ref. 26). The inset shows partial 18O labeling of C-terminal (Y") fragment ions (doublet with 2-Da spacing) as the result of performing the in gel trypsin digestion in the presence of 50% 18O-labeled water. N-terminal fragment ions (labeled an and bn in the spectrum) do not contain the 18O label, as indicated by their unaltered isotopic distribution.

Sequencing by Edman Degradation-- The absence of an initiator methionine in _a suggested that it would be amenable to direct Edman degradation. Sequencing indeed confirmed the N-terminal sequence TELSANHGGSA (data not shown). No sequence for _b was obtained by Edman degradation, consistent with its blocked N terminus.

Recognition of Anti-_a- and Anti-_b-specific Antibodies-- The peptides TELSANHC and MDRWYLC, unique to the _a and _b sequences, respectively, were synthesized and coupled to maleimide-activated keyhole limpet hemocyanin, which was used to immunize rabbits. The blots of rat kidney Na,K-ATPase in Fig. 4 show that anti-_a and anti-_b sera recognize the upper or lower bands of the  subunit, respectively, but no other bands in their vicinity. This result is consistent with that of the MS analysis, which detected only the two variants and no other modified species of the  subunit in intact rat kidney enzyme.

View larger version (51K): [in this window] [in a new window]   Fig. 4.   Binding of a- or b-specific antibodies to rat kidney Na,K-ATPase. The blot was probed with the anti-, anti-a, or anti-b antibodies as indicated and described under "Materials and Methods." 10 µg (lane probed with anti-) or 20 µg (lanes probed with anti-a and anti-b) of delipidated rat kidney Na,K-ATPase was applied to the gel.

Expression of _a and _b in Cultured Mammalian Cells-- We showed previously that the full-length rat _a cDNA encodes a protein that appears as a doublet on Western blots of membranes isolated from transfected HEK cells, using antibodies that recognize the C terminus of the protein (13). The mobility of the denser upper band corresponded to that of the upper band of the rat kidney  doublet; that of the lower band, designated _a'_, appeared to be similar to that of kidney _b. That latter possibility is difficult to reconcile with the present MS analysis. Accordingly, we analyzed the protein product of cDNA encoding the lower _b band of kidney. The cDNA for _b was obtained by PCR as described under "Materials and Methods," with primers designed according to the protein sequence obtained by mass spectrometry (Fig. 5). The results of Western blot analysis of rat kidney, control pREP4, and both pREP-_a- and pREP4-_b-transfected HEK cell membranes confirm our previous findings for _a and indicate clearly that the cDNA for _b encodes a protein of the same mobility as the lower band seen in renal tissue. This result provides unequivocal evidence that the lower _b band detected in renal tissue is distinct from the lower band _a' band seen with _a-transfected cells. Bands corresponding to _a and _b of kidney were also evident following cDNA transfection of HeLa cells, which in contrast to transiently stable HEK (see Ref. 13) are a classical stable transfected cell line. By comparing the results with the two different cell lines (Fig. 5), it is evident that there are additional minor bands. Their appearance is clearly cell-specific. Thus, _a' described above is apparent in HEK but not HeLa; a band of lower mobility than that of _b, designated _b', is apparent in HeLa but not HEK.

View larger version (44K): [in this window] [in a new window]   Fig. 5.   Western blot analysis of membranes derived from a- and b-transfected HEK and HeLa cell membranes. Antibodies used were monoclonal antibodies 6H for 1 and polyclonal antiserum gC33 for . A, immunoblot showing 5 µg of membranes isolated from HEK cells transfected with a (a-TF), b(b-TF), the control pREP4 vector (Con-TF), and 1 µg of rat kidney membranes (kidney). B, immunoblot of membranes derived from transfected HeLa cells. Amounts analyzed are the same as in A. The lower "extra" band seen in HEK-a-TF and the upper "extra" band seen in HeLa-b-TF are named a' and b', respectively.

The basis for the cell-specific appearance of _a' and _b' remain unclear. In other experiments (data not shown), we observed that the faster mobility _a' species seen in _a-transfected HEK cells is not due to (rare) usage of the alternative translation initiation codon CTG (16), nor does the appearance of a doublet reflect post-translational phosphorylation of cytoplasmic serines since _a' appears regardless of whether (i) the CTG codon is mutated (CTG  CTC), or (ii) either or both cytoplasmic serines (conserved Ser⁴⁷; non-conserved Ser⁵⁵) are mutated (Ser  Ala).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The presence of the two bands of the  subunit has long been an intriguing finding with no obvious explanation. In view of the recent evidence for a tissue (mainly kidney)-specific role of the  subunit as a modulator of the Na,K-ATPase, it has become important to gain insight into the structural basis for the two  bands. Furthermore, it now becomes necessary to establish whether one or other band is associated with particular functional effects already described (6, 10, 13-15) or yet to be found.

The MS results (Figs. 1-3) show unequivocally that _a and _b of the intact rat kidney Na,K-ATPase differ in their N-terminal sequences, TELSANH compared with Ac-MDRWY(I/L), but are otherwise identical. No post-translational modifications on either chain have been detected by MS except for the N-terminal acetylation of _b. Different sequences might indicate the existence of separate isoforms, but, from an EST data base search, it has been inferred recently that there are two splice variants, with the same sequences as determined directly by MS (MDRWYL for _b) (27). Given the extensive similarity between the two forms, the present MS analysis is consistent with the notion that _a and _b are splice variants. Of course, the strength of MS, in addition to the direct determination of sequence, is that it demonstrates directly that both variants are expressed as protein in the intact renal membranes, as well as indicating the absence of post-translational modifications. A search of the EST data base indicates the presence of mRNAs in the tissues of interest but not necessarily that protein is expressed in those tissues or the level of expression. This paper represents the first demonstration of application of MS to analysis of this class of single trans-membrane segment ion transport regulators. Thus, the methods might be applicable for study of related members of this family of membrane protein.

The MS sequencing results are confirmed by the immunoblot of the rat kidney enzyme using antibodies raised against the peptides TELSANHC or MDRWYLC (Fig. 4). In particular, _a-specific and _b-specific antibodies recognize either the upper or lower band, respectively, but no bands other than _a or _b, consistent with absence of post-translationally modified subunits. It was reported recently that, after overnight incubation of rat kidney Na,K-ATPase with 1 M hydroxylamine at pH 11 and 37 °C, the upper  band disappeared, leading to a suggestion that it contains a hydroxyester link, possibly fatty acid acylation at Ser or Thr residues (14). In our hands, alkali treatment itself reduces the intensity of both bands, _a more than _b, and hydroxylamine further reduces both bands.² Alkaline hydroxylamine cleaves proteins, preferentially at Asn-Gly bonds, but specificity is not absolute (28). Indeed, we have observed that the  subunits of rat or pig kidney Na,K-ATPase, which contain three Asn-Gly bonds, are cleaved by the alkaline hydroxylamine at many positions. Although rat  subunits do not contain Asn-Gly bonds, nonspecific hydroxylaminolysis is a likely possibility. Thus, the inference of a post-translational modification of the  subunit in kidney Na,K-ATPase, based on the hydroxylamine treatment alone, appears to be questionable.

Taken together with direct sequence analysis of the two bands from kidney enzyme and the antibody binding, the expression studies clarify earlier uncertainties regarding doublets seen in kidney and in transfected cells. The expression experiment in Fig. 5 clearly demonstrates that the major _a and _b protein products of transcription/translation in both HeLa and HEK cells have the same mobilities as the upper (_a) and lower bands (_b), respectively, of the kidney medulla. This is consistent with the results of the MS and antibody binding. The additional minor bands, _a' in _a-transfected HEK and the upper _b' band in _b-transfected HeLa, represent cell-specific modifications of _a and _b. In cells transfected with cDNA having a single initiator methionine, a doublet of chains cannot be due to a splice variant and must have another explanation, for example post-translational modification or alternate translation initiation sites. It was reported earlier that in vitro translation of a single rat mRNA species, in the presence of dog pancreatic microsomes, gives rise to two  subunit bands (6). Geering and co-workers (10) have shown that, in Xenopus, the presence of two bands of  is secondary to alternate usage of two distinct start codons in the  subunit message. As mentioned under "Results," the nature of _a' seen in HEK cells and _b' seen in _b-transfected HeLa is obscure. Additionally, the relevance, if any, of _a' and _b' to the function of the  subunit in kidney is unknown. In the case of _b', its mobility corresponds to that of a very weak but distinct band just above _a in some, albeit not all Western blots of renal medulla.²

The question arises as to the stoichiometry of _a and _b relative to the / subunits in renal Na,K-ATPase. In older studies, the overall stoichiometry of  to / subunits in kidney enzyme was estimated to be approximately 1:1 (3, 4). In agreement with a 1:1:1 stoichiometry of :: subunits, we have repeatedly found stoichiometries of 1:1 for a fragment of the  subunit (N terminus GDVDPFYY; see Ref. 30) and other fragments of the  subunit isolated from extensively digested pig kidney Na,K-ATPase.² By scanning Coomassie-stained gels, we have also estimated that the ratio _a: _b in rat or pig kidney Na,K-ATPase, as 0.8 ± 0.06 (n = 3) and 1.6 ± 0.06 (n = 5), respectively, i.e. not exactly 1:1.² Thus, a likely combination of subunits is ::_a and ::_b, in proportion to the ratio of _a and _b. A combination such as ::_a:_b, together with : without associated , is less probable since it implies an exact 1:1 ratio of _a and _b.

What is the functional significance of the two variants? One possibility is that the _a and _b differentially affect functions already ascribed to the  subunit. For example, one effect of the  subunit is to alter the steady-state E₁  E₂ equilibrium in favor of E₁ with an associated decrease in K'_ATP (6, 13). _a and _b could affect this function in different ways or to a different degree. Second, there may be effects of the  subunit on cytoplasmic K'_K/K'_Na antagonism. Sweadner and co-workers (14) have recently ascribed a 2-fold lower apparent affinity for Na⁺ of rat kidney Na,K-ATPase compared with that in rat NRK tissue-culture cells to the presence of  in the kidney. These authors transfected NRK cells with _a cDNA and isolated clones expressing either two bands, presumed to be either unmodified (lower) or post-translationally modified (upper), or only a single _a band, presumably post-translationally modified (upper). They observed a lower K'_Na in NRK clones expressing both bands but not in clones expressing a single _a subunit. However, in view of the rather low level of _a expression in those experiments, and the present finding that _a in intact kidney tissue is unmodified, the relevance of those results to the role of  in kidney is unclear. Nevertheless, striking tissue-specific difference in apparent affinity of the 1 pump for Na⁺ have been described and ascribed to differences in cytoplasmic K'_K/K'_Na antagonism (31, 32). The difference is particularly notable for the 1 enzyme of kidney compared with most other tissues tested, and significant in view of the predominant expression of  in the intact kidney membranes (6). Another possibility is that there are variant-specific functions related to their distinct extracellularly located N termini. For example, in Xenopus oocytes expression of the  subunit affects activation by extracellular potassium ions (10), which could be modulated by the different N termini. The  subunit was shown many years ago to bind a photoaffinity label, nitroazidobenzoyl-ouabain (3). Thus, it is also conceivable that the different N termini of the _a and _b variants differentially modulate binding of cardiac glycosides such as the endogenous ouabain-like compounds thought to be involved in generation of essential hypertension (33, 34). It is of interest that the N-terminal sequence of _b, Ac-MDRWYL, is found in man, rat, mouse, and as recent MS experiments show also in pig,³ while the N-terminal sequence of _a is less well conserved (see Ref. 27). An implication could be that MDRWYL is involved in a specific interaction with a ligand or other pump subunit related to its specific function. It is also possible that the different N termini of _a and _b interact specifically with other extracellular proteins and subserve as yet unknown functions.

Evidently the functional role(s) of the  subunit, and the two variants, are open questions. Successful expression of _a and _b, and availability of _a-specific and _b-specific antibodies, now provide tools for study of their individual roles. The variant-specific antibodies will also help define differences in expression in specific cell types or locations in the renal tubule.

	ACKNOWLEDGEMENTS

We thank Mara Ferrandi (Prassis, Milano, Italy) for a gift of purified rat renal Na,K-ATPase and Michael Caplan (Yale University School of Medicine, New Haven, CT) for the 6H antibody. We are grateful to Hanno Steen (University of Southern Denmark) for valuable discussions about the mass spectrometric analysis.

	FOOTNOTES

^* This work was supported in part by a long term postdoctoral fellowship of the European Molecular Biology Organization (to B. K.), by a short term FEBS fellowship (to A. S.), by a grant from the Danish Foundation for Fundamental Research (to M. M.'s laboratory at the Center for Experimental BioInformatics), by a grant from the Weizmann Institute Renal Research Fund (to S. J. D. K.), and by a grant from the Medical Research Council of Canada (to R. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF129400.

^§ Current address: MDS Protana A/S, 5230 Odense M, Denmark.

To whom correspondence should be addressed. Tel.: 972-8-934-2278; Fax: 972-8-934-4118; E-mail: steven.karlish@weizmann.ac.il.

Published, JBC Papers in Press, March 30, 2000, DOI 10.1074/jbc.M001411200

² H. X. Pu, R. Goldshleger, R. Blostein, and S. J. D. Karlish, unpublished results.

³ B. Küster, A. Shainskaya, and S. J. D. Karlish, unpublished data.

	ABBREVIATIONS

The abbreviations used are: PAGE, polyacrylamide gel electrophoresis; MS, mass spectrometry; MALDI, matrix-assisted laser desorption/ionization; HEK, human embryonic kidney; PCR, polymerase chain reaction; EST, expressed sequence tag; Tricine, N-tris (hydroxymethyl)methylglycine.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				I. Lubarski, S. J. D. Karlish, and H. Garty Structural and functional interactions between FXYD5 and the Na+-K+-ATPase Am J Physiol Renal Physiol, December 1, 2007; 293(6): F1818 - F1826. [Abstract] [Full Text] [PDF]

				S. Bibert, S. Roy, D. Schaer, E. Felley-Bosco, and K. Geering Structural and Functional Properties of Two Human FXYD3 (Mat-8) Isoforms J. Biol. Chem., December 22, 2006; 281(51): 39142 - 39151. [Abstract] [Full Text] [PDF]

				K. Pihakaski-Maunsbach, H. Vorum, B. Honore, S. Tokonabe, J. Frokiaer, H. Garty, S. J. D. Karlish, and A. B. Maunsbach Locations, abundances, and possible functions of FXYD ion transport regulators in rat renal medulla Am J Physiol Renal Physiol, November 1, 2006; 291(5): F1033 - F1044. [Abstract] [Full Text] [PDF]

				A. Zouzoulas and R. Blostein Regions of the Catalytic {alpha} Subunit of Na,K-ATPase Important for Functional Interactions with FXYD 2 J. Biol. Chem., March 31, 2006; 281(13): 8539 - 8544. [Abstract] [Full Text] [PDF]

				M. Lindzen, K.-E. Gottschalk, M. Fuzesi, H. Garty, and S. J. D. Karlish Structural Interactions between FXYD Proteins and Na+,K+-ATPase: {alpha}/beta/FXYD SUBUNIT STOICHIOMETRY AND CROSS-LINKING J. Biol. Chem., March 3, 2006; 281(9): 5947 - 5955. [Abstract] [Full Text] [PDF]

				K. Geering FXYD proteins: new regulators of Na-K-ATPase Am J Physiol Renal Physiol, February 1, 2006; 290(2): F241 - F250. [Abstract] [Full Text] [PDF]

Y. A. Mahmmoud, H. Vorum, and F. Cornelius Interaction of FXYD10 (PLMS) with Na,K-ATPase from Shark Rectal Glands: CLOSE PROXIMITY OF Cys74 OF FXYD10 TO Cys254 IN THE A DOMAIN OF THE {alpha}-SUBUNIT REVEALED BY INTERMOLECULAR THIOL CROSS-LINKING J. Biol. Chem., July 29, 2005; 280(