HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 25, 18676-18681, June 23, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/25/18676    most recent M001110200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Körner, K. Articles by Müller, R. Search for Related Content PubMed PubMed Citation Articles by Körner, K. Articles by Müller, R. Social Bookmarking                      What's this?

In Vivo Structure of the Cell Cycle-regulated Human cdc25C Promoter^*

Kathrin Körner and Rolf Müller

From the Institute of Molecular Biology and Tumor Research, Philipps-University Marburg, Emil-Mannkopff-Strasse 2, D-35033 Marburg, Germany

Received for publication, February 9, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The cdc25C promoter is regulated during the cell cycle by the transcriptional repressor CDF-1 that inhibits the activation function of upstream transcriptional activators, most notably the nuclear factor Y/CAAT box binding factor (NF-Y/CBF). In this report a detailed analysis of the in vivo structure of the cdc25C promoter was made. Micrococcus nuclease and methidiumpropyl-EDTA footprinting strongly suggest that the proximal promoter encompassing the cell cycle-dependent element/cell cycle genes homology region and the upstream NF-Y sites is organized in a positioned nucleosome throughout the cell cycle. Furthermore, structural perturbations were detected by DNase I, phenanthroline copper, and KMnO₄ footprinting at the NF-Y binding sites in vivo, which is in agreement with the reported property of NF-Y to bend DNA in vitro. Similar results were obtained with the structurally and functionally related cyclin A promoter. The structural perturbations seen in DNase I and phenanthroline copper footprints were less pronounced in G₀ cells when compared with cycling cells. This presumably reflects a weakened in vivo interaction of NF-Y with its cognate DNA element in G₀. It is likely that these structural perturbations, together with the reported ability of NF-Y to recruit histone acetyl transferase activity, contribute to an opened chromatin structure as a prerequisite for optimal regulation through activation and repression.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

NF-Y/CBF¹ is a ubiquitously expressed transcriptional activator that interacts with CCAAT boxes found in the promoters of a wide variety of genes, including hormone-inducible, developmentally controlled, and cell cycle-regulated genes (1-4). A particularly well studied example of the latter group of genes is the G₂-specific cdc25C promoter (5-10), which contains three functionally important NF-Y binding sites. Genomic DMS footprinting and functional promoter analyses demonstrate that NF-Y binding to the core and flanking regions of NF-Y sites is necessary for both maximal promoter activity and cell cycle regulation (6). The cdc25C promoter is regulated in G₀/G₁ phase by the transcriptional repressor CDF-1, which binds the CDE-CHR bipartite DNA element (9), thereby blocking the function of the NF-Y and Sp1-Sp3 complexes bound immediately upstream of the CDE-CHR element (6). Upon entry into S/G₂ the interaction of CDF-1 to its cognate binding site is abrogated, thus allowing for NF-Y- and Sp1-Sp3-mediated transcriptional activation of the cdc25C gene (5, 6, 9). A similar situation exists with the cyclin A promoter, which is also repressed by CDF-1 and activated by NF-Y (7).

The mechanism through which NF-Y activates transcription is not fully understood. However, NF-Y has been reported to interact with the histone acetylases Gcn5 and P/CAF (11), and these interactions seem to be relevant in the context of the multiple drug resistance-1 gene promoter (12). Furthermore, it has been shown that NF-Y is capable of associating with nucleosomal templates in vitro (13), although the in vivo relevance of this observation remains to be investigated. These observations imply a role for NF-Y in chromatin remodeling and may provide an explanation for the ability of DNA-bound NF-Y to recruit other transcription factors to promoter DNA (14, 15). NF-Y binds to both the major and minor groove of the DNA and has been reported to induce DNA bending in vitro (16). This is believed to be important for the functional organization of activated promoters in vivo, as in the case of the -globin promoter (17). However, there is no evidence that NF-Y binding to promoter DNA is indeed associated with structural distortions in vivo.

In the present study, we have used a combination of different genomic footprinting techniques to analyze in detail the in vivo structure of the cdc25C promoter, in particular with respect to its nucleosomal organization and transcription factor-associated structural distortions.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cell Culture and Synchronization-- WI-38 cells were cultured in a 1:1 mixture of Dulbecco's modified Eagle's medium and MCDB 135 medium with 10% fetal calf serum. For synchronization in G₀, cells were maintained in serum-free medium for 3 days.

Genomic Footprinting-- For DMS footprinting, WI-38 cells were grown to 70% confluency. After treatment with 0.2% DMS for 2 min, the cells were washed 3 times with cold phosphate-buffered saline and the DNA was isolated with DNAzol (Life Technologies, Inc.). For potassium permanganate (KMnO₄) treatment, the cells were incubated with 20 mM KMnO₄ for 2 min and were washed twice with phosphate-buffered saline containing 2% -mercaptoethanol and once with phosphate-buffered saline. For DNase I, Micrococcus nuclease, MPE, and OP-Cu footprinting, the cells were scraped into phosphate-buffered saline and resuspended in DNase I digestion buffer (60 mM KCl, 15 mM NaCl, 5 mM MgCl₂, 0.1 mM EGTA, 15 mM Tris-HCl, pH 7.4, 0.5 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride, and 1 M sucrose) containing 0.2% Nonidet P-40 (for permeabilization of cells). For Micrococcus nuclease and MPE cleavage, the scraped cells were homogenized on ice with 10 strokes in a Dounce homogenizer. Micrococcus nuclease treatment was performed with 0.05-1 unit of enzyme for 3 min. For DNase I cleavage, 200-400 units of enzyme (Roche Molecular Biochemicals) were added, and the reactions were stopped after 5 min by addition of 0.2 volume of 62.5 mM EDTA and 2.5% SDS. MPE treatment was performed as described previously (18). For OP-Cu treatment, a complex formed from 40 µM 1,10-phenanthroline and 10 µM CuSO₄ (final concentrations) was added to the cell suspension, and the reaction was started by the addition of 3-mercaptopropionic acid to a concentration of 6.9 mM. After 2-4 min, the reaction was stopped by addition of 2,9-dimethyl-1,10-phenanthroline to a final concentration of 2.8 mM. For comparison, WI-38 genomic DNA was methylated in vitro with 0.2% DMS for 10-30 s, treated with 2 mM KMnO₄ for 30 s, and cleaved with 0.05-0.1 unit of Micrococcus nuclease or 2-4 units of DNase I for 30 s or treated with OP-Cu for 60-75 s. In each case, 3 µg of piperidine-cleaved genomic DNA were used for LM-PCR with the Stoffel fragment of Taq polymerase (Perkin-Elmer) as described previously (5). For OP-Cu and Micrococcus nuclease treatment, the DNA was phosphorylated with T4-polynucleotide kinase (New England Biolabs Inc.) prior to LM-PCR. Samples were phenol-extracted and ethanol-precipitated after primer extension with ³²P-labeled primers. The following oligonucleotides were used as primers: cdc25C promoter, primer set TS1: primer 1, 5'-d(AGGGAAAGGAGGTAGTT)-3'; primer 2, 5'-d(TAGATTGCAGCTATGCCTTCCGAC)-3'; primer 3, 5'-d(CCTTCCGACTGGGTAGGCCAACGTCG)-3'; cdc25C promoter, primer set TS2: primer 1, 5'-d(CTGCGTCAGCCAATCTCC)-3'; primer 2, 5'-d(TGGCCTATCGTTGGGCTCGCAG)-3'; primer 3, 5'-d(GGGCTCGCAGATCAC CTGGGGGCG)-3'; cdc25C promoter, primer set BS: primer 1, 5'-d(CACTAGTAAGGCGCGGT)-3'; primer 2, 5'-d(GTTTAAATCTCCCGGGGTTCGTGG)-3'; primer 3, 5'-d(GGGGTTCG TGGGGCTGAGGGAACTAG)-3'; cyclin A promoter: primer 1, 5'-d(AGCCAGGCCAGCCTA)-3'; primer 2, 5'-d(CAGCCCGCCCGCTCGCTCACC)-3'; primer 3, 5'-d(GCT CACCCAGCTCGAGCCACGCAG)-3'.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Micrococcus Nuclease and Methidiumpropyl-EDTA Footprinting: Evidence for a Positioned Nucleosome-- Our first goal was to analyze the nucleosomal structure of the human cdc25C promoter between positions 290 and +121 bp that had previously been found to be necessary and sufficient for maximal activity and cell cycle regulation of the promoter (5). Toward this end, WI-38 fibroblasts were permeabilized and digested with increasing concentrations of Micrococcus nuclease, and the digested DNA was analyzed by LM-PCR using different cdc25C-specific primer sets. As shown in Fig. 1, A and B, clusters of Micrococcus nuclease hyperreactivity, which are indicative of nucleosomal linker regions, were seen between positions 140 and approximately 200 bp and between +8 and approximately +50 bp. In addition, less defined hyperreactive regions were identified upstream of position 280 bp (Fig. 1). The distance between the two proximal hyperreactive regions (148 bp) correlates very closely with the reported size of a nucleosomal core in vitro (145 bp) (19, 20). In agreement with this observation, MPE footprinting of the region between 200 and +50 bp revealed short hypersensitive stretches coincident with the proximal Micrococcus nuclease hyperreactive regions (Fig. 2, A and B). These data strongly suggest that the proximal promoter region (140 to +8 bp), including the transcription factor binding sites necessary for activation and cell cycle specific repression, are organized around a positioned nucleosome (Fig. 3).

View larger version (64K): [in this window] [in a new window]   Fig. 1.   Micrococcus nuclease footprinting of the cdc25C promoter. Normally growing WI-38 cells were permeabilized and treated with increasing amounts of Micrococcus nuclease. For comparison, genomic DNA was treated with Micrococcus nuclease or DMS in vitro. The products were analyzed by LM-PCR using different specific primer sets. Analysis of the top strand (A) suggests the presence of a positioned nucleosome in the immediate 5' region of the cdc25C promoter. More loosely positioned nucleosomes may be present further upstream. Analysis of the bottom strand (B) is in agreement with these results.

View larger version (35K): [in this window] [in a new window]   Fig. 2.   MPE footprinting of the cdc25C promoter. Normally growing WI-38 cells were permeabilized, homogenized, and treated with increasing amounts of MPE. For comparison, genomic DNA was treated with MPE or DMS in vitro. The products were analyzed by LM-PCR using primer set TS1. Analysis of the top strand shows short stretches of hyperreactive nucleotides around positions between 150 and 130 bp (A) and between positions +23 and +43 bp (B), respectively, suggesting the presence of a positioned nucleosome in the immediate 5' region of the cdc25C promoter.

View larger version (11K): [in this window] [in a new window]   Fig. 3.   Overview of the nucleosomal structure of the cdc25C promoter. The scheme summarizes the in vivo Micrococcus nuclease and MPE footprinting data for the cdc25C promoter region between positions 370 and +50 bp. The rectangular boxes represent the protein binding sites identified by genomic DMS footprinting (5). The arrows above the promoter indicate the Micrococcus nuclease and MPE hyperreactivities identified by high resolution footprinting (Figs. 1 and 2). The positioning of a nucleosome deduced from these data is shown by an oval at the bottom.

Because this region of the promoter is bound constitutively by the transcriptional activator NF-Y (6) and by the cell cycle-regulated transcriptional repressor CDF-1 (5, 9) the question was raised whether the nucleosomal structure might change during the cell cycle. We therefore performed Micrococcus nuclease footprinting of synchronized cell populations, i.e. serum-deprived cells versus restimulated cells. However, these experiments did not show any cell cycle-related differences with respect to the presence of hyperreactive nucleotides (data not shown). We therefore concluded that the proximal cdc25C promoter region is organized as a positioned nucleosome and is simultaneously occupied by transcription factors throughout the cell cycle.

DNase I Footprinting of the cdc25C Promoter-- The chromatin structure is not only determined by histone acetylation but can also be influenced by transcription factor-induced remodeling of nucleosomes, similar to the murine mammary tumor virus promoter (21). In this case, the binding of progesterone receptors leads to conformational changes within the regulatory nucleosome, which in turn enables the interaction with other transcription factors and promoter activation (21).

To investigate the cdc25C promoter with respect to structural perturbations such as bending or single-stranded stretches in vivo, we performed genomic footprinting of the cdc25C promoter using different enzymatic or chemical conformation-sensitive probes. As shown in Fig. 4A, DNase I footprinting of permeabilized cells did not result in a characteristic 10-bp pattern, which would be expected for rotationally positioned nucleosomal structures (22). Instead, protected areas were detected that coincided with the NF-Y and Sp1 binding sites previously identified with in vivo DMS footprinting (5). In agreement with these findings are the slight DNase I hyperreactivities 5' and 3' to the Sp1 sites, which have been reported to occur adjacent to certain transcription factor binding sites in vitro. In addition, the close spacing of the NF-Y and Sp1 binding sites could contribute to the lack of a 10-bp pattern of DNase I hypersensitivity. Particularly strong hyperreactivities were seen between the NF-Y binding sites (Fig. 4A, arrows) suggesting that in these positions the minor groove of the double helix is exposed in a way that allows for a markedly preferred DNase I cleavage.

View larger version (67K): [in this window] [in a new window]   Fig. 4.   High resolution mapping of DNase I protections and hypersensitivities in the proximal human cdc25C (A) and cyclin A promoters (B). Normally growing WI-38 cells (A and B) and cells in G0 (A) were permeabilized and analyzed by genomic DNase I footprinting followed by LM-PCR using the primer sets cdc25C TS1 or cyclin A. For comparison, genomic DNA was digested with DNase I or cleaved after DMS treatment in vitro. The hyperreactivities are marked by arrows.

Cell Cycle Dependence of DNase I Protections and Hyperreactivities in the cdc25C Promoter-- Surprisingly, the DNase I protections at the NF-Y sites were strongly reduced in resting cells (G₀) when compared with cycling cells (Fig. 4A, growing). This is in apparent contrast to previously published in vivo DMS-footprinting data showing that the NF-Y binding sites are occupied in vivo throughout the cell cycle including G₀ cells (5). We attribute this to the fact that DNase I footprinting involves the permeabilization of the cells by a detergent, whereas DMS treatment is carried out with intact cells. It is possible that the interaction of NF-Y with its cognate site is weakened in G₀ cells, e.g. because of a decreased amount of NF-Y-A (23, 24), so that under the influence of a detergent this difference becomes detectable.

Another finding that deserves particular attention is the fact that decreased protection at the NF-Y sites was associated with a reduction of the surrounding hyperreactivities (Figs. 4A and 5A). This suggests that a loss of NF-Y binding is correlated with a loss of hyperreactivity in vivo and strongly supports the idea that NF-Y leads to drastic changes in the DNA structure upon binding to its cognate recognition site in vivo. This explanation is supported by similar observations made by OP-Cu footprinting of the cyclin A promoter as described below (see Fig. 5B).

View larger version (57K): [in this window] [in a new window]   Fig. 5.   Genomic OP-Cu footprint of the proximal human cdc25C (A) and cyclin A promoters (B). Normally growing WI-38 cells (A and B) and cells in G0 (B) were permeabilized and treated for different periods of time with the OP-Cu complex followed by LM-PCR using the primer sets cdc25C TS1 or cyclin A. For comparison, genomic DNA was treated with OP-Cu or DMS in vitro. The hyperreactivities are marked by arrows.

DNase I Footprinting of the cyclin A Promoter-- To address the question of whether such structural changes could also be observed in a structurally and functionally related but different promoter, we performed DNase I footprints of the cyclin A gene that contains a single NF-Y site between a CDE-CHR module and an ATF site (Fig. 4B). Weak hyperreactivities could be detected surrounding the Sp1 site. The lack of hyperreactivities surrounding the NF-Y site may be because of the close proximity of other transcription factor binding sites. In contrast, the occurrence of one strong hyperreactivity within the NF-Y binding site is striking. Thus, in the context of two different promoters, NF-Y binding was associated with strong hyperreactivities (Fig. 4, A and B), suggesting a strong influence on DNA structure.

Structural Distortions in the cdc25C Promoter Detected by Phenanthroline Copper Footprinting-- Because NF-Y has been reported to bend DNA in vitro (16), we decided to analyze the proximal promoter region for local distortions by phenanthroline copper footprinting. OP-Cu is used to detect minor groove binding of transcription factors that sterically inhibit access to the C1-H or alter the DNA structure to a non-B-DNA conformation (25, 26). Both events result in OP-Cu hyporeactive or protected regions. OP-Cu can also be used to detect protein-induced conformational changes in the DNA that would lead to hyperreactive DNA stretches (27).

Even though OP-Cu has previously not been used for genomic footprinting, we were able to establish an appropriate procedure using permeabilized cells (see "Experimental Procedures" for details). Thus, minor groove protections at the NF-Y binding sites and the CHR region were clearly detectable, whereas the sites of major groove binding (CDE, Sp1 binding sites) did not show any protections (Fig. 5A). These expected results demonstrate the suitability of OP-Cu for genomic footprinting. Of particular interest, however, are the strong hyperreactivities between the NF-Y binding sites (Fig. 5A, arrows). These indicate the presence of local distortions, which may be caused by the unstacking of base pairs that would create more space for the intercalating phenanthroline moiety (28). Furthermore, the protections in the area of NF-Y binding are notably stronger when compared with those in the CHR region, which is also occupied in the minor groove. This can be taken as further evidence for a non-B-DNA structure at the NF-Y binding sites (25, 26, 28).

Phenanthroline Copper Footprinting of the cyclin A Promoter-- For comparison, we footprinted the cyclin A promoter with OP-Cu (Fig. 5B). Protections were seen in the region of the NF-Y site and to a lesser extent at the CHR, similar to that observed with the cdc25C promoter and at the ATF site. Hyperreactivities were detected specifically between the NF-Y site and the CDE/CHR element. No such hyperreactivity was found between the NF-Y and ATF sites (or other sites) indicating that the structural distortions detected by OP-Cu are indeed transcription factor-specific.

Cell Cycle Dependence of OP-Cu Protections and Hyperreactivities in the cyclin A Promoter-- We also analyzed potential cell cycle effects on the OP-Cu hyperreactivities in the cyclin A promoter. A comparison of the patterns obtained after footprinting of normally growing and G₀ cells showed a diminished protection of the NF-Y site and hyperreactivities 5' to the NF-Y site in the G₀ cells (Fig. 5B). These cell cycle effects are likely to reflect a weakened interaction of NF-Y with its cognate recognition site in G₀ cells and support the hypothesis that the OP-Cu hyperreactivities are caused by NF-Y binding in vivo. These observations are also consistent with the finding made with DNase I footprinting of the cdc25C promoter described above (Fig. 4A).

In contrast to the cdc25C promoter, the CDE was also protected, and hyperreactivities were detected in its vicinity. This presumably reflects the binding of additional factors of the E2F family with the CDE in the cyclin A promoter (7, 29, 30).

Structural Distortions in the cdc25C Promoter Detected by KMnO₄ Footprinting-- Finally, we analyzed the proximal promoter region for kinked DNA structures or single-stranded stretches by KMnO₄ footprinting in vivo. This study showed a strong correlation between KMnO₄ hyperreactivity and NF-Y binding (Fig. 6). Neither the Sp1 sites nor the CDE-CHR displayed such hyperreactivities. This KMnO₄ hyperreactivity, which coincides with the area of OP-Cu hypersensitivity, probably reflects local kinks or strong bends with a defect in base stacking rather than a melted region, as has been reported for  factor-induced DNA distortions in vitro (27). A strong DNA bend or unwinding with a local unstacking of base pairs would enhance the intercalation of OP-Cu between the base pairs while giving KMnO₄ access to the 5,6-double bond of the T-ring (31).

View larger version (42K): [in this window] [in a new window]   Fig. 6.   High resolution mapping of KMnO4-reactive nucleotides in the proximal human cdc25C promoter. Normally growing WI-38 cells were treated with increasing concentrations of KMnO4. For comparison, genomic DNA was treated with KMnO4 and DMS in vitro. Structurally perturbed regions in the promoter (indicating kinked or melted DNA) are marked by arrows.

Downstream of position +1 bp, multiple sites of KMnO₄ hyperreactivity were also detectable, but these can be presumably attributed to pausing polymerases in the basal promoter region (10).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The high resolution analysis of Micrococcus nuclease and MPE hypersensitivities reported in the present study strongly suggests that the cdc25C promoter is organized in a positioned nucleosome, and this structural organization is maintained throughout the cell cycle. The fact that the positioned nucleosome spans the same size region encompassing the three NF-Y sites in the presence of bound NF-Y (5) strongly suggests that NF-Y interacts with a nucleosomal template in vivo. This is supported by the observation that NF-Y is capable of interacting with reconstituted nucleosomes in vitro (13).

The footprinting data clearly demonstrate strong structural perturbations in and around the NF-Y binding sites in the context of two different promoters in vivo, i.e. cdc25C and cyclin A, that are structurally and functionally related (7). Of particular interest are the observed cell cycle effects, which indicate that NF-Y binding is decreased in resting cells concomitantly with diminished hypersensitivities adjacent to the NF-Y sites. These correlations also suggest that the observed structural perturbations in and around the NF-Y binding sites are indeed caused by NF-Y, which is consistent with the ability of NF-Y to induce DNA bending in vitro (16).

The observed structural changes are not typical of rotationally positioned nucleosomes but instead suggest a positioned although partially opened nucleosomal structure, similar to the mouse mammary tumor virus promoter after hormone induction (21). It is conceivable therefore that the structural disturbances at the NF-Y binding sites (coinciding with NF-Y occupation of these sites) together with the reported ability of NF-Y to recruit the histone acetylases, Gcn5 and P/CAF (11, 12), play a role in opening the chromatin structure of the proximal promoter. The OP-Cu and KMnO₄ footprints that show that NF-Y in vivo induces a local unstacking of the base pairs, which is indicative of kinked or strongly bent DNA, support this hypothesis because the ability of transcription factors to bend DNA facilitates binding to nucleosomal structures in vitro (32). This is strongly supported by the data obtained with the cyclin A promoter, where a functionally crucial NF-Y site (7), albeit in a different context, is also associated with clearly structural perturbations in vivo.

The above observations lead to the following model. NF-Y acts as a transcriptional activator that may involve its property to recruit Gcn5 and P/CAF and its ability to bind to nucleosomal templates in vivo. The structural perturbations at the NF-Y sites that reflect changes in the nucleosomal structure caused by NF-Y may affect the interaction of the promoter with other factors and may thus contribute to transcriptional activation and/or repression of the gene. The binding of the repressor CDF-1 in G₀/G₁ may weaken the binding of NF-Y through an unknown mechanism, which in turn results in an altered promoter topology that does not favor transcriptional activation. The data obtained in the present study provide the basis for future work addressing the validity of these ideas.

	ACKNOWLEDGEMENTS

We are grateful to M. Beato, M. Funk, T. Schmidt, M. Truss, and A. Scholz for many useful discussions and suggestions. We thank D. Eick for help with the KMnO₄ footprinting and M. Krause for synthesis of oligonucleotides.

	FOOTNOTES

^* This work was supported by the Deutsche Forschungsgemeinschaft (SFB397/C1).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed.: Tel.: 6421-286-6236; Fax: 6421-286-8923; E-mail: mueller@imt.uni-marburg.de.

Published, JBC Papers in Press, March 9, 2000, DOI 10.1074/jbc.M001110200

	ABBREVIATIONS

The abbreviations used are: NF-Y, nuclear factor Y; CBF, CCAAT box binding factor; CDE, cell cycle-dependent element; CDF-1, CDE-CHR binding factor-1; CHR, cell cycle genes homology region; DMS, dimethyl sulfate; LM-PCR, ligation-mediated polymerase chain reaction; MPE, methidiumpropyl-EDTA; OP-Cu, phenanthroline copper; bp, base pair(s); ATF, activating transcription factor.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				H.-D. Huang, J.-T. Horng, Y.-M. Sun, A.-P. Tsou, and S.-L. Huang Identifying transcriptional regulatory sites in the human genome using an integrated system Nucleic Acids Res., March 29, 2004; 32(6): 1948 - 1956. [Abstract] [Full Text] [PDF]

				G. A. Michelotti, M. J. Bauman, M. P. Smith, and D. A. Schwinn Cloning and Characterization of the Rat alpha 1a-Adrenergic Receptor Gene Promoter. DEMONSTRATION OF CELL SPECIFICITY AND REGULATION BY HYPOXIA J. Biol. Chem., February 28, 2003; 278(10): 8693 - 8705. [Abstract] [Full Text] [PDF]

				V. Salsi, G. Caretti, M. Wasner, W. Reinhard, U. Haugwitz, K. Engeland, and R. Mantovani Interactions between p300 and Multiple NF-Y Trimers Govern Cyclin B2 Promoter Function J. Biol. Chem., February 21, 2003; 278(9): 6642 - 6650. [Abstract] [Full Text] [PDF]

				J. L. Attema, R. Reeves, V. Murray, I. Levichkin, M. D. Temple, D. J. Tremethick, and M. F. Shannon The Human IL-2 Gene Promoter Can Assemble a Positioned Nucleosome That Becomes Remodeled Upon T Cell Activation J. Immunol., September 1, 2002; 169(5): 2466 - 2476. [Abstract] [Full Text] [PDF]

				C. A. Pise-Masison, M. Radonovich, R. Mahieux, P. Chatterjee, C. Whiteford, J. Duvall, C. Guillerm, A. Gessain, and J. N. Brady Transcription Profile of Cells Infected with Human T-cell Leukemia Virus Type I Compared with Activated Lymphocytes Cancer Res., June 1, 2002; 62(12): 3562 - 3571. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/25/18676    most recent M001110200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Körner, K. Articles by Müller, R. Search for Related Content PubMed PubMed Citation Articles by Körner, K. Articles by Müller, R. Social Bookmarking                      What's this?