|
Originally published In Press as doi:10.1074/jbc.M000844200 on April 12, 2000
J. Biol. Chem., Vol. 275, Issue 25, 18919-18925, June 23, 2000
Cloning and Characterization of the Gene for Phosphatidylcholine
Synthase*
Christian
Sohlenkamp ,
Karel E. E.
de Rudder ,
Viola
Röhrs ,
Isabel M.
López-Lara§, and
Otto
Geiger§¶
From the Institute of Biotechnology, Technical
University of Berlin, Seestrasse 13, D-13353 Berlin, Germany and the
§ Centro de Investigación sobre Fijación de
Nitrógeno, Universidad Nacional Autónoma de México,
Apdo. Postal 565-A, Cuernavaca, Morelos, CP62210, México
Received for publication, February 2, 2000, and in revised form, April 10, 2000
 |
ABSTRACT |
Phosphatidylcholine (PC) is the major
membrane-forming phospholipid in eukaryotes and can be synthesized by
either of two pathways, the CDP-choline pathway or the methylation
pathway. In prokaryotes only the methylation pathway was thought to
occur. Recently, however, we could demonstrate (de Rudder, K. E. E., Sohlenkamp, C., and Geiger, O. (1999) J. Biol.
Chem. 274, 20011-20016) that a second pathway for
phosphatidylcholine biosynthesis exists in Sinorhizobium
(Rhizobium) meliloti involving a novel enzymatic activity,
phosphatidylcholine synthase, that condenses choline and
CDP-diacylglyceride in one step to form PC and CMP. Using a colony
autoradiography method we have isolated mutants of S. meliloti deficient in phosphatidylcholine synthase and which are no longer able to incorporate radiolabeled choline into PC.
Complementation of such mutants with a sinorhizobial cosmid gene bank,
subcloning of the complementing fragment, and sequencing of the
subclone led to the identification of a gene coding for a presumptive
CDP-alcohol phosphatidyltransferase. Amplification of this gene and its
expression in Escherichia coli demonstrates that it codes
for phosphatidylcholine synthase. Genomes of some pathogens
(Pseudomonas aeruginosa and Borrelia
burgdorferi) contain genes similar to the sinorhizobial gene
(pcs) for phosphatidylcholine synthase. Although
pcs-deficient S. meliloti knock-out mutants
show wild type-like growth and lipid composition, they are unable to
perform rapid PC biosynthesis that normally is achieved via the
phosphatidylcholine synthase pathway in S. meliloti wild type.
 |
INTRODUCTION |
In eukaryotic organisms the membrane lipid phosphatidylcholine
(PC)1 can be synthesized by
two alternative biosynthetic pathways (1). In the CDP-choline pathway,
choline is activated to choline phosphate and subsequently to
CDP-choline which condenses with diacylglycerol to obtain PC. In the
methylation pathway, however, phosphatidylethanolamine is
N-methylated three times with
S-adenosylmethionine as the methyl donor in order to yield
PC. Only the methylation pathway of PC biosynthesis was thought to
occur in prokaryotes (2). However, in addition to the methylation
pathway we could recently show a novel pathway for PC biosynthesis in
the soil bacterium Sinorhizobium (Rhizobium) meliloti (3,
4). S. meliloti which is able to form a nitrogen-fixing
symbiosis with legume plants (5) possesses an enzyme activity,
phosphatidylcholine synthase, that condenses choline directly with
CDP-diacylglyceride to form PC in one step (4). Here we describe the
isolation of mutants deficient in phosphatidylcholine synthase.
Complementation of such mutants, subcloning of the complementing
fragment, and sequencing of the complementing DNA led to the
identification of the gene for phosphatidylcholine synthase. We also
demonstrate that after amplification and expression of the gene in
Escherichia coli, phosphatidylcholine synthase activity can
be detected in E. coli cell-free extracts.
 |
EXPERIMENTAL PROCEDURES |
Strains, Plasmids, Media, and Growth Conditions--
Strains and
plasmids used in this study are listed in Table
I (6-16). S. (Rhizobium)
meliloti strains were grown at 29 °C in tryptone/yeast extract
(TY) medium (17) or in MOPS minimal medium containing 40 mM
MOPS, 20 mM KOH, 20 mM NH4Cl, 100 mM NaCl, 2 mM MgSO4, 1.2 mM CaCl2, 0.3 mg of biotin/liter, 15 mM succinate, and 10 mM potassium phosphate
buffer, pH 7. E. coli strains were grown at 37 °C in LB
medium (9). Antibiotics were added when required to obtain the
following final concentrations in milligrams/liter medium: 400 spectinomycin, 20 piperacillin, and 2 tetracycline for S. meliloti, and 200 spectinomycin, 100 carbenicillin, 50 kanamycin,
and 20 tetracycline for E. coli. A
betCBA-deficient derivative of S. meliloti 5000, IML101, was constructed in an analogous way as described (4). The
betCBA-deficient phenotype of the tetracycline-sensitive
double recombinant IML101 was confirmed by its ability to use glycine
betaine but not choline as sole carbon source.
Isolation of Mutants Deficient in Phosphatidylcholine Synthase
Using a Colony Autoradiography Method--
Cells of S. meliloti IML101 were mutagenized with
N-methyl-N'-nitro-N-nitrosoguanidine
as described previously (3). The mutagenized cells were then spread on
MOPS minimal agar medium with sucrose (15 mM) instead of
succinate as carbon source and grown at 29 °C for 4 days. The
colonies were transferred to sterile filter paper discs (Whatman No.
42; 8 cm diameter) and used directly in a modified autoradiography
method. The mother plates, which had retained the original colony
pattern, were incubated overnight at 29 °C in order to regrow the
colonies and they were subsequently stored for up to 2 weeks at
4 °C. In order to search for colonies unable to incorporate labeled
choline into lipid material the filters were incubated in Petri dishes
floating in a 29 °C water bath. The Petri dishes each contained 1.2 ml of MOPS minimal medium with 15 mM sucrose and 540 nCi of
[methyl-14C]choline (55 mCi/mmol). After
1 h of incubation, the reaction was stopped by transfer of the
filters to a Büchner funnel and addition of 20 ml of an ice-cold
20% (w/v) trichloroacetic acid solution. After 5 min, non-incorporated
radioactivity was washed away under gentle suction on the funnel. The
filters were washed once more with 50 ml of ice-cold 5% (w/v)
trichloroacetic acid, respectively. The washed replica print filters
were dried in an oven at 120 °C for 20 min. The dried filters were
subjected to autoradiography by a 3 days exposure to Kodak Biomax MR-1
film. Subsequently they were stained with Coomassie Blue G-250 in order to visualize the colony patterns.
DNA Manipulations--
Recombinant DNA techniques were performed
according to standard protocols (9). A genomic DNA bank of S. meliloti 1021 was constructed in the cosmid vector pLAFR3 as
described previously (10). Total genomic DNA of S. meliloti
was isolated as described (6) and the DNA was partially digested with
Sau3AI and size fractionated on a 5-20% sucrose gradient.
Fragments were ligated to linearized pLAFR3 vector DNA and the ligated
DNA was packaged in vitro with the DNA packaging kit of
Roche Molecular Biochemicals and transduced in E. coli
HB101. About 50% of the cosmid derivatives obtained comprised DNA
inserts ranging in size between 22 and 40 kb. DNA was sequenced by the
chain termination method (18) using a SQ3 sequencer (Hoefer) and pUC19
derivatives. The DNA region sequenced and the deduced proteins were
analyzed using the Omiga program (Oxford Molecular Ltd., Oxford, United
Kingdom) or the NCBI (National Center for Biotechnology Information)
BLAST network server (19). Preliminary sequence data was obtained from
The Institute for Genomic Research website and from the
Rhodobacter capsulatus sequencing project. Homologies of
sequences were quantified by percentage of identical residues. Searches
for motifs in deduced amino acid sequences were performed using the
server of Kyoto Center (Japan). In order to analyze DNA restriction
fragments for functional complementation they were cloned into the
broad host range plasmid pRK404 (Table I). Cosmid, pRK404, or pMP92 derivatives were mobilized into S. meliloti strains by
triparental mating using the mobilizing plasmid pRK2013 as described
previously (20).
Functional Complementation of Pcs-deficient Mutant S. meliloti
CS07--
Cosmids of the sinorhizobial gene bank or pRK404 derivatives
were mobilized into mutant CS07 as described above and transconjugants were selected on TY medium containing piperacillin and tetracycline. Complementation of CS07 by phosphatidylcholine synthase was
investigated by the colony autoradiography method described above and
from colonies able to incorporate labeled choline into lipid, cosmids were isolated, transformed in E. coli DH5 , and the
respective DNA inserts were analyzed.
Cloning and Expression of the Putative Phosphatidylcholine
Synthase (pcs) Gene of S. meliloti in E. coli--
Using PCR and
specific oligonucleotides
(GAATAAAGCTTTCGCATATGAAGTTCTTCAATTACAGACGC and
AAAGGATCCTCAGGCACGCCCGAGTTTCGGG) the gene suspected
to code for phosphatidylcholine synthase (pcs) of S. meliloti was amplified from the cosmid pCOS1 with Pfu
polymerase. Suitable restriction sites (underlined) for cloning the
suspected pcs gene were introduced by PCR with the
oligonucleotides. After restriction with NdeI and
BamHI the PCR-amplified DNA fragment was cloned into a pET9a
vector (16) to obtain the expression plasmid pTB2559 in which the
potential pcs gene can be overexpressed under control of the
T7 promoter. The correct in-frame cloning and the correct sequence was
demonstrated by DNA sequencing (data not shown). E. coli
strain BL21(DE3) (16) which expresses the T7 polymerase under the
control of the lac promoter was transformed with pTB2559. At
a cell density of 5 × 108 cells/ml,
isopropyl- -D-thiogalactoside was added to a final concentration of 0.1 mM. After 4 h of induction cells
were harvested and stored in a freezer at 20 °C.
Inactivation of the Sinorhizobial pcs Gene by a
Cassette--
The spectinomycin resistance conferring 2.0-kb
SmaI-SmaI fragment of pHY109 was cloned into the
unique MluI site of the sinorhizobial pcs gene on
plasmid pTB2536 to yield pTB2160. The plasmid pTB2160 was mobilized
into a wild type S. meliloti 1021. The spectinomycin cassette-inactivated pcs was recombined into the wild type
genome by the plasmid-incompatibility technique as described (15). Potential double recombinants were further analyzed by Southern hybridization (data not shown) and the pcs-deficient
phenotype of tetracycline-sensitive double recombinants was confirmed
by the absence of phosphatidylcholine synthase activity in cell-free extracts.
Preparation of Cell-free Extracts and Determination of Specific
Phosphatidylcholine Synthase Activity--
Frozen cells were
resuspended in 10 volumes of 50 mM Tris/HCl, pH 8.0, and
cell-free extracts were prepared as described previously (3). The
optimized standard assay to determine phosphatidylcholine synthase
activity (4) contained, in a total volume of 50 µl in Eppendorf
tubes, (50 µg of protein, 50 mM Tris/HCl, pH 8.0, 10 mM MnCl2, 20 µM
CDP-diacylglycerol, 0.2% (w/v) Triton X-100, and 50 µM
[methyl-14C]choline (55 mCi/mmol). The
mixtures were incubated for 15 min in a 30 °C water bath and stopped
by mixing with 188 µl of methanol/chloroform (2:1; v/v). Addition of
63 µl of chloroform and 63 µl of water led to phase separation and
after washing the chloroform phase once with another 100 µl of water
it was dried and quantified in a scintillation counter. Under such
conditions the only radioactive compound detectable in the chloroform
phase was PC.
Determination of Membrane Lipid Composition and
Synthesis--
In S. meliloti, under some conditions of
growth (phosphate limitation), membrane phospholipids are largely
replaced by lipids that do not contain any phosphorus (21).
Specifically, it is thought that
diacylglyceryl-N,N,N-trimethylhomoserine can functionally replace PC in membranes (22). In order to be able to detect the
potential formation of phosphorus-free membrane lipids in pcs-deficient mutants as well, the membrane lipid
composition or synthesis of different S. meliloti strains
was determined after labeling with [1-14C]acetate.
Cultures (1 ml) in TY medium were inoculated from precultures grown in
the same medium. After the addition of 2 µCi of
[1-14C]acetate (60 mCi/mmol) at initial cell densities of
9 × 107 cells/ml to each culture, the cultures were
incubated for 24 h in experiments when lipid composition was to be
determined. In order to determine lipid synthesis rates, cultures were
labeled with 2 µCi of [1-14C]acetate (60 mCi/mmol) or
with 0.56 µCi of [methyl-14C]choline (55 mCi/mmol) at initial cell densities of 4.5 × 108
cells/ml for 30 min. During this 30-min pulse, incorporation of labeled
acetate or labeled choline into chloroform-soluble total lipid material
occurred at linear rates, respectively. After the labeling periods,
cells were harvested by centrifugation and lipids were extracted,
separated by two-dimensional thin-layer chromatography, and quantified
as described previously (3).
 |
RESULTS |
Isolation of Mutants Deficient in Phosphatidylcholine
Synthase--
A mutant strain of S. meliloti (IML101),
unable to metabolize choline as sole carbon and nitrogen source but
able to incorporate choline directly into PC, was used for the search
of phosphatidylcholine synthase (Pcs)-deficient mutants. Cells of
S. meliloti IML101 were heavily mutagenized with
N-methyl-N'-nitro-N-nitrosoguanidine resulting in 1% survival. Mutagenized colonies were screened for the
inability to incorporate labeled choline into lipid material. In the
selection procedure for a potential mutant, Coomassie Blue-stained replica print filters were compared with the corresponding
autoradiograms (data not shown), in an analogous way as described
earlier (3). Of 26,000 colonies screened, 15 candidates showed reduced
incorporation of radiolabeled choline when the autoradiogram was
compared with the respective Coomassie Blue-stained filter. The 15 candidates were further analyzed by directly determining the in
vivo incorporation of [14C]choline into PC as
described (4) using TLC analysis. Of the candidates, 7 were unable to
incorporate radiolabeled choline into PC (data not shown) and cell-free
extracts of these 7 S. meliloti mutants (CS01, CS02, CS03,
CS06, CS07, CS09, and CS10) showed much reduced or no
phosphatidylcholine synthase activity (Table
II).
View this table:
[in this window]
[in a new window]
|
Table II
In vitro phosphatidylcholine synthase activity in cell-free extracts of
S. meliloti strains and of E. coli BL21(DE3) strains expressing the
potential gene for phosphatidylcholine synthase (pcs)
|
|
Isolation of a Sinorhizobial DNA Fragment Able to Complement
Phosphatidylcholine Synthase-deficient Mutant S. meliloti
CS07--
The Pcs-deficient mutant CS07 of S. meliloti was
conjugated with E. coli strains carrying a genomic library
of S. meliloti that had been constructed in the cosmid
vector pLAFR3 as described under "Experimental Procedures."
Screening for complemented mutants with intact Pcs activity was
performed using the colony autoradiography method described above based
on their regained ability to incorporate radiolabel from
[14C]choline into lipid material. Of about 5500 colonies
screened, 13 showed strongly increased radiolabel incorporation when
autoradiograms were compared with the corresponding Coomassie
Blue-stained replica print filters (data not shown). From complemented
mutants forming choline-derived lipid material, the cosmids were
isolated and transformed in E. coli DH5 for further
analysis. Four types of overlapping cosmids were able to complement the
Pcs-deficient phenotype of mutant CS07. Representatives of those types
are cosmids pCOS1, pCOS14, pCOS20, and pCOS35, all containing between
30 and 37 kb of sinorhizobial DNA, two of which are indicated in Fig. 1. Subcloning of restriction fragments,
comprising regions of the overlapping DNA, in the broad host-range
vector pRK404 and subsequent analysis for complementation of the
Pcs-deficient mutant CS07 shows that a plasmid (pTB2532), containing a
4.6-kb HindIII-HindIII DNA fragment derived from
pCOS1 (Fig. 1), is able to restore formation of choline-derived PC
(Table II). Plasmid pTB2532 was able to restore Pcs activity in the
other Pcs-deficient sinorhizobial mutants (CS01, CS02, CS03, CS06,
CS09, and CS10) as well (data not shown), demonstrating that all 7 Pcs-deficient chemical mutants isolated belong to the same
complementation group.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1.
Physical and restriction map of
the genomic sinorhizobial DNA region complementing phosphatidylcholine
synthase-deficient mutants. A, sinorhizobial DNA region
complementing phosphatidylcholine synthase deficiency.
B, representatives of phosphatidylcholine
synthase-complementing cosmids (pCOS20, pCOS1) and pCOS1-derived
phosphatidylcholine synthase-complementing 4.6-kb subclone
pTB2532. The DNA sequence determined allowed the identification
of 4 potential genes encoding for proteins with the following proposed
functions: 1) ccsA gene encoding a chaperon involved in
cytochrome c maturation; 2) mdcF gene encoding a
transporter; 3) ubiH gene encoding
2-octaprenyl-6-methoxyphenol hydroxylase; 4) pcs gene
encoding phosphatidylcholine synthase. The insertion point of a 2.0-kb
DNA fragment containing the spectinomycin resistance-conferring
cassette (aadA, gene for aminoglycoside adenylyltransferase)
in mutant KDR568 is indicated. Restriction sites (H,
HindIII; E, EcoRI; B,
BamHI; S, Sau3AI; M,
MluI) used are shown.
|
|
Analysis of Phosphatidylcholine Synthase-complementing
DNA--
The DNA sequence of the internal 4.6-kb
HindIII-HindIII fragment of the Pcs-complementing
plasmid pTB2532 was determined and the sinorhizobial DNA ranging from a
HindIII site to a BamHI/Sau3AI site
was submitted (accession number AF155772). Analysis of the
sinorhizobial sequence (4599 base pairs) revealed four complete open
reading frames (ORFs) (Fig. 1). Genebank searches with the NCBI BLAST
program showed that the first ORF (positions 199 to 1095) encoded a
protein of 299 amino acids that showed homology to the cytochrome
c-type biogenesis proteins of Aquifex aeolicus (accession number AE000657) (43% amino acid identity),
Mycobacterium tuberculosis (ccsA gene, accession
number Z95558) (40% amino acid identity), and Bacillus
subtilis (ccdA gene, accession number Z99113) (35%
amino acid identity). It is interesting to note that in addition to the
well known Ccm system of cytochrome c maturation (23),
Rhizobia seem to possess an additional CcdA-like and
therefore quite different system for the maturation of cytochrome c. The second complete ORF (positions 1238 to 2197) encoded
a protein of 320 amino acids that showed homology to an ORF (31% amino
acid identity) from the unfinished Bordetella pertussis genome project and to the putative malonate transporter MdcF (accession number U95087) of Klebsiella pneumoniae (23% amino acid
identity). The third complete ORF (positions 3445 to 2171) is oriented
in the opposite direction and its end overlaps with the end of ORF2. The potential gene product of 425 amino acids showed homology to an ORF
(34% amino acid identity) from the unfinished Caulobacter crescentus genome project and to the ubiH (accession
number AE000374) gene product 2-octaprenyl-6-methoxyphenol hydroxylase
of E. coli (31% amino acid identity). The fourth complete
ORF (positions 3723 to 4445) is oriented divergently from ORF3 and
encoded a very hydrophobic protein of 241 amino acids that showed
homology to CDP-alcohol phosphatidyltransferases (Fig.
2) (24-27). The typical motif
(DG(X)2AR(X)8G(X)3D(X)3D)
described to be specific for CDP-alcohol phosphatidyltransferases (24)
is found to some extent, however, 12 amino acid residues instead of 8 are located between the conserved Arg and the second conserved Gly
residue in the case of ORF4. Secondary structure predictions propose 6, 7, or 8 transmembrane helices for the encoded protein, depending on the
program used (data not shown). Therefore this fourth ORF could be the
gene (pcs) that codes for the sinorhizobial
phosphatidylcholine synthase.

View larger version (87K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of pcs-derived
amino acid sequence with sequences derived from other CDP-alcohol
phosphatidyltransferase-like ORFs. The S. meliloti
phosphatidylcholine synthase sequence (SmPcs) was aligned
with the sequences of an ORF (ORF M3.o16316) from R. capsulatus (RcORF), an ORF (on contig 52 in the version
from 3/15/99) from P. aeruginosa (PaORF), an ORF
(25) from B. burgdorferi (BbORF), and
phosphatidylserine synthase (26) from H. pylori
(HpPss) using the program CLUSTAL W (27). The residues
identical with SmPcs are underlayed in black and the
residues similar to SmPcs are shaded in gray. Residues
thought to be characteristic for the CDP-alcohol phosphotransferase
motif (24) are indicated by asterisks at the
top.
|
|
Expression of the Putative Sinorhizobial pcs Gene in E. coli--
In order to perform a functional analysis of the putative
pcs gene of S. meliloti, the fourth ORF was
amplified by PCR, cloned in a pET9a expression vector to obtain plasmid
pTB2559, and expressed in E. coli BL21(DE3) by induction
with isopropyl- -D-thiogalactoside as described under
"Experimental Procedures." Cell-free extracts were analyzed for Pcs
activity (Table II). No Pcs activity can be demonstrated in extracts of
E. coli BL21(DE3) containing the empty pET9a vector. In
E. coli BL21(DE3) containing plasmid pTB2559 Pcs activity
was detected without induction, and high Pcs activity was found after
induction with isopropyl- -D-thiogalactoside. These
results demonstrate that the fourth ORF, suspected to be the
pcs gene, indeed codes for a functional phosphatidylcholine synthase (Pcs).
Characterization of a Phosphatidylcholine Synthase-deficient Null
Mutant of S. meliloti--
In order to precisely define the phenotype
of a pcs-deficient S. meliloti, a mutant (KDR568)
was constructed by insertion of a spectinomycin resistance-conferring
interposon into the pcs gene (see "Experimental
Procedures" and Fig. 1). No Pcs activity was detected in cell-free
extracts of KDR568 whereas a KDR568-derived strain, harboring the
pcs gene on a multicopy plasmid (pTB2532), was overproducing
the Pcs activity (Table II). The growth properties of various
sinorhizobial strains were studied on complex TY medium and therefore
under conditions where a functional Pcs is able to form PC from choline
present in this medium (4). Growth rates and final optical densities of
S. meliloti 1021 and IML101 wild types, the Pcs-deficient
chemical (CS07) and knock-out mutant (KDR568) as well as of the
Pcs-overproducing strain (KDR568 × pTB2532) were determined and
in no case any significant difference in growth rate or final cell
yield was observed if the strains were compared with the wild type
(Fig. 3). Also, when the lipid compositions of the Pcs-deficient chemical (CS07), of the knock-out mutant (KDR568), and of the Pcs-overproducing strain (KDR568 × pTB2532) were compared with S. meliloti 1021 wild type after
a 24-h labeling with [14C]acetate, essentially no
difference was observed (data not shown) and they all showed the lipid
composition reported earlier for the wild type (21). Obviously, the
methylation pathway of PC biosynthesis which is still functioning in
Pcs-deficient mutants can compensate for the lack of Pcs to some
extent. Also, the steady-state phospholipid composition is a reflection
of both synthesis and turnover. This type of analysis was not sensitive
enough to exhibit an effect of the pcs mutation under
standard laboratory growth conditions.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 3.
Growth on complex TY medium of S. meliloti wild type, phosphatidylcholine synthase-deficient
mutants, and complemented mutant. S. meliloti 1021 ( ), phosphatidylcholine synthase-deficient mutant KDR568 ( ),
KDR568 × pRK404 ( ), complemented mutant KDR568 × pTB2532
( ). Similar growth as in the curves indicated was observed for
IML101 and the pcs-deficient chemical mutant CS07. For each
growth curve, three independent cultures were analyzed and averaged.
Standard error bars are smaller than symbol sizes.
|
|
When we measured lipid synthesis rates based on the incorporation of
radiolabeled acetate over 30 min into the individual lipid fractions
(Table III) we observed that in the wild
types, PC comprised 20% in the case of Sm1021 and 23% in the case of IML101 of all lipid material synthesized. However, the Pcs-deficient chemical (CS07) and knock-out mutant (KDR568) as well as the knock-out mutant containing an empty broad host range plasmid (KDR568 × pRK404) showed much reduced rates of PC synthesis (about 2% of all
lipid material synthesized). In Pcs-deficient mutants no formation of
the phosphorus-free membrane lipids sulfoquinovosyl diacylglycerol, ornithine lipid, or diacylglyceryl-N,N,N-trimethylhomoserine
was observed when they were grown on TY medium, similarly as earlier found for the wild type (21). In the Pcs-overproducing strain (KDR568 × pTB2532) high PC synthesis rates, comprising about 25% of all lipid material synthesized, were restored. These results demonstrate that Pcs is responsible for rapid PC biosynthesis in
S. meliloti on complex media.
View this table:
[in this window]
[in a new window]
|
Table III
[1-14C]Acetate-derived membrane lipid synthesis of S. meliloti wild type, phosphatidylcholine synthase-deficient derivatives,
and S. meliloti overexpressing phosphatidylcholine synthase
Pulse-labeling was performed for 30 min. The values shown are mean ± S.D. derived from three independent experiments.
|
|
The results obtained when studying the incorporation of radiolabeled
choline over 30 min into the individual lipid fractions (Table
IV) demonstrated that in the case of the
Sm1021 wild type, 66% of the choline-derived label in lipids was
detected in PC. However, the other major membrane lipids (PG, CL, PE + MMPE) also became considerably labeled. In the Pcs-deficient knock-out
mutant (KDR568) as well as in the knock-out mutant containing an empty broad host range plasmid (KDR568 × pRK404), incorporation of
radiolabled choline into PC was much reduced and comprised only about
2-3% of the Sm1021 wild type level. In the Pcs-overproducing strain (KDR568 × pTB2532) high rates of incorporation of radiolabled choline into PC were restored and 80% of the choline-derived label in
lipids was detected in PC. In all strains with an intact pathway for
choline oxidation (Sm1021, KDR568, KDR568 × pRK404, and
KDR568 × pTB2532), choline was rapidly degraded and considerable
amounts of the choline-derived labeled methyl groups are incorporated into cyclopropane-containing fatty acyl residues of all membrane lipids
(3). In betCBA-deficient strains (IML101 and CS07)
incorporation of radiolabled choline into lipid material was much
reduced. In IML101, the inability to degrade choline essentially
eliminated the incorporation of radiolabeled choline into lipids other
than PC, and the only labeled lipid that can be detected in IML101 is
PC. The Pcs-deficient derivative CS07 hardly incorporated any choline-derived label into lipids.
View this table:
[in this window]
[in a new window]
|
Table IV
[methyl-14C]Choline-derived membrane lipid synthesis of
S. meliloti wild type, phosphatidylcholine synthase-deficient
derivatives, and S. meliloti overexpressing phosphatidylcholine
synthase
Pulse-labeling was performed for 30 min. The values shown are mean ± S.D. derived from three independent experiments.
|
|
 |
DISCUSSION |
Recently we have discovered a novel pathway for
phosphatidylcholine biosynthesis in the symbiotic soil bacterium
S. meliloti (4). In this pathway, a so far unknown enzymatic
activity, phosphatidylcholine synthase (systematic name:
CDP-diacylglycerol:choline 3-phosphatidyltransferase), condenses
choline with CDP-diacylglyceride to form PC and CMP in one step. The
choline used for this reaction can be provided by the host plant (4)
and thereby the methylation pathway of PC biosynthesis requiring 3 S-adenosylmethionines for each molecule of PC formed can be
circumvented. Here we describe the isolation and characterization
of the sinorhizobial gene for pcs. Similarity searches using
the BLAST algorithm (19) revealed significant similarities to
other CDP-alcohol phosphatidyltransferases. Limited similarity is
found, i.e. to some phosphatidylserine synthases (Pss) (27%
amino acid identity with Pss from Helicobacter pylori), enzymes catalyzing the condensation of serine with CDP-diacylglyceride to yield phosphatidylserine and CMP. However, during alignments of
S. meliloti Pcs with Pss, major gaps have to be introduced (Fig. 2). More similar potential CDP-alcohol phosphatidyltransferases, where less or no gaps have to be introduced during alignments (Fig. 2),
can be detected in some bacterial genomes. The highest similarity of
Pcs from S. meliloti is found to an ORF (43% amino acid
identity) from the unfinished R. capsulatus genome project. High similarity is also observed to an ORF (39% amino acid identity) from the unfinished Pseudomonas aeruginosa genome project
and to an ORF (29% amino acid identity) from the Borrelia
burgdorferi genome. An alignment of those ORFs with the Pcs
protein from S. meliloti and the representative Pss from
H. pylori is shown in Fig. 2. We have noted that the amino
acid sequence derived from the sinorhizobial pcs gene shows
a variation of the motif described as being characteristic for
CDP-alcohol phosphatidyltransferases (DG(X)2AR(X)8G(X)3D(X)3D).
In the sinorhizobial Pcs, 12 amino acid residues instead of 8 are
located between the conserved Arg and the second conserved Gly residue
of the motif, an area which is thought to be part of the active site of
CDP-alcohol phosphatidyltransferases (24). Interestingly, the ORFs from
R. sphaeroides, P. aeruginosa, and B. burgdorferi which are most similar to Pcs of S. meliloti show 12 amino acid residues between the conserved Arg and
the second conserved Gly. Furthermore, there is a conserved Lys
(position 5) and a conserved Pro (position 9) in the 12-amino acid
stretch the active site region in all 3 ORFs and the sinorhizobial Pcs which are absent in other CDP-alcohol phosphatidyltransferases. A
dendrogram based on CDP-alcohol phosphatidyltransferase amino acid
sequences constructed by the UPGMA method of Sneath and Sokal (28)
demonstrates that the ORFs from R. sphaeroides, P. aeruginosa, B. burgdorferi, and the Pcs from S. meliloti are related to each other and form a subgroup within the
CDP-alcohol phosphatidyltransferases (Fig.
4) (28-37). Presently we are
investigating whether the 3 ORFs from R. sphaeroides,
P. aeruginosa, and B. burgdorferi code for
functional Pcs.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 4.
Dendrogram of CDP-alcohol
phosphatidyltransferases. The dendrogram was constructed by
the UPGMA method of Sneath and Sokal (28) based on the following
CDP-alcohol phosphatidyltransferase amino acid sequences: Pss from
yeast (29), Pss from B. subtilis (30), phosphatidylserine
synthase (Pss) from H. pylori (26), phosphatidylglycerol
phosphate synthase (PgsA) from R. sphaeroides (31),
phosphatidylglycerol phosphate synthase (PgsA) from E. coli
(32), phosphatidylinositol synthase (Pis) from rat (33),
phosphatidylinositol synthase (Pis) from yeast (34),
sn-1,2-diacylglycerol cholinephosphotransferase
(CPT1) from yeast (35), sn-1,2-diacylglycerol
ethanolaminephosphotransferase (EPT1) from yeast (36), amino
alcohol phosphotransferase (AAPT1) from soybean (37),
phosphatidylcholine synthase (Pcs) from S. meliloti, ORF from R. capsulatus, ORF from P. aeruginosa, ORF from B. burgdorferi.
|
|
We have demonstrated earlier that in the case of S. meliloti
the choline required for synthesizing PC via the phosphatidylcholine synthase pathway may be supplied by its legume host plants (4). Animal
or human hosts also contain considerable amounts of choline in their
body fluids (38). It is interesting to note also that the facultative
pathogen P. aeruginosa and the obligate pathogen and
causative agent of Lyme disease, the spirochaete B. burgdorferi, may possess genes coding for a phosphatidylcholine
synthase activity which might enable them to obtain choline for
phosphatidylcholine biosynthesis directly from their animal or human
hosts. So far we have not detected Pcs-like profiles
(DG(X)2AR(X)4K(X)3P(X)3G(X)3D(X)3D) in eukaryotic genomes or expressed sequence tags (data not shown). Pcs
activity and the biosynthetic pathway associated with it might therefore be limited to some symbiotic and pathogenic bacteria. If Pcs
is required for a successful interaction with the eukaryotic host,
drugs directed against Pcs might selectively inhibit Pcs-utilizing bacteria and might show an antibiotic effect.
As the relative amounts of PC in S. meliloti vary
considerably depending on the conditions of growth (21), rapid PC
synthesis or degradation might be required in this organism in order to quickly adjust to new environmental conditions. In our search for a
phenotype associated with a Pcs deficiency we found that in S. meliloti Pcs is required for rapid PC synthesis. This ability might allow the bacterium to rapidly increase the relative amount of PC
in its membrane and therefore adjust membrane
lipid-dependent properties more rapidly if such an organism
is growing in a choline-containing environment as it is normally
provided by a eukaryotic host.
 |
ACKNOWLEDGEMENTS |
We thank C. Raetz and M. Schobert for
valuable discussions.
 |
FOOTNOTES |
*
This work was supported by the Deutsche
Forschungsgemeinschaft (Ge556/2-3).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
This article is dedicated to Eugene P. Kennedy on the occasion of his
80th birthday.
¶
To whom correspondence should be addressed: Centro de
Investigación sobre Fijación de Nitrógeno,
Universidad Nacional Autónoma de México, Apdo. Postal
565-A, Cuernavaca, Morelos, CP 62210, México. Tel.: 52-73-131697;
Fax: 52-73-175581; E-mail: otto@cifn.unam.mx.
Published, JBC Papers in Press, April 12, 2000, DOI 10.1074/jbc.M000844200
 |
ABBREVIATIONS |
The abbreviations used are:
PC, phosphatidylcholine;
Pcs, phosphatidylcholine synthase;
Pss, phosphatidylserine synthase;
MOPS, 4-morpholinepropanesulfonic acid;
kb, kilobase(s);
ORF, open reading frame;
PCR, polymerase chain
reaction;
PE, phosphatidylethanolamine;
MMPE, monomethylphosphatidylethanolamine;
PG, phosphatidylglycerol;
CL, cardiolipin.
 |
REFERENCES |
| 1.
|
Kennedy, E. P.
(1989)
in
Phosphatidylcholine Metabolism
(Vance, D. E., ed)
, pp. 1-8, CRC Press, Boca Raton, FL
|
| 2.
|
Rock, C. O.,
Jackowski, S.,
and Cronan, J. E., Jr.
(1996)
in
Biochemistry of Lipids, Lipoproteins and Membranes
(Vance, D. E.
, and Vance, J. E., eds)
, pp. 35-74, Elsevier, Amsterdam, The Netherlands
|
| 3.
|
de Rudder, K. E. E.,
Thomas-Oates, J. E.,
and Geiger, O.
(1997)
J. Bacteriol.
179,
6921-6928
|
| 4.
|
de Rudder, K. E. E.,
Sohlenkamp, C.,
and Geiger, O.
(1999)
J. Biol. Chem.
274,
20011-20016
|
| 5.
|
Spaink, H. P.,
Kondorosi, A.,
and Hooykaas, P. J. J.
(1998)
The Rhizobiaceae: Molecular Biology of Model Plant-associated Bacteria
, Kluwer, Dordrecht, The Netherlands
|
| 6.
|
Meade, H. M.,
Long, S. R.,
Ruvkun, G. B.,
Brown, S. E.,
and Ausubel, F. M.
(1982)
J. Bacteriol.
149,
114-122
|
| 7.
|
Finan, T. M.,
Hartwieg, E.,
LeMieux, K.,
Bergman, K.,
Walker, G. C.,
and Signer, E. R.
(1984)
J. Bacteriol.
159,
120-124
|
| 8.
|
Hanahan, D.
(1983)
J. Mol. Biol.
166,
557-580
|
| 9.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 10.
|
Staskawicz, B.,
Dahlbeck, D.,
Keen, N.,
and Napoli, C.
(1987)
J. Bacteriol.
169,
5789-5794
|
| 11.
|
Yanish-Perron, C.,
Vieira, J.,
and Messing, J.
(1985)
Gene (Amst.)
33,
103-119
|
| 12.
|
Figurski, D. H.,
and Helinski, D. R.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
1648-1652
|
| 13.
|
Ditta, G.,
Schmidhauser, T.,
Yakobson, E.,
Lu, P.,
Liang, X.-W.,
Finlay, D. R.,
Guiney, D.,
and Helinski, D. R.
(1985)
Plasmid
13,
149-153
|
| 14.
|
Spaink, H. P.,
Wijffelman, C. A.,
Pees, E.,
Okker, R. J. H.,
and Lugtenberg, B. J. J.
(1987)
Nature
328,
337-340
|
| 15.
|
Østerås, M.,
Boncompagni, E.,
Vincent, N.,
Poggi, M. C.,
and Le Rudulier, D.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
11394-11399
|
| 16.
|
Studier, F. W.,
Rosenberg, A. H.,
Dunn, J. J.,
and Dubendorff, J. W.
(1990)
Methods Enzymol.
185,
60-89
|
| 17.
|
Beringer, J. E.
(1974)
J. Gen. Microbiol.
84,
188-198
|
| 18.
|
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
|
| 19.
|
Altschul, S. F.,
Madden, T. L.,
Schäffer, A. A.,
Zhang, J.,
Zhang, Z.,
Miller, W.,
and Lipman, D. J.
(1997)
Nucleic Acids Res.
25,
3389-3402
|
| 20.
|
Ruvkun, G. B.,
and Ausubel, F. M.
(1981)
Nature
289,
85-88
|
| 21.
|
Geiger, O.,
Röhrs, V.,
Weissenmayer, B.,
Finan, T. M.,
and Thomas-Oates, J. E.
(1999)
Mol. Microbiol.
32,
63-73
|
| 22.
|
Hofmann, M.,
and Eichenberger, W.
(1996)
J. Bacteriol.
178,
6140-6144
|
| 23.
|
Thöny-Meyer, L.,
Fabianek, R. A.,
Schulz, H.,
Enggist, E.,
and Hennecke, H.
(1999)
Biospektrum
5,
185-191
|
| 24.
|
Williams, J. G.,
and McMaster, C. R.
(1998)
J. Biol. Chem.
273,
13482-13487
|
| 25.
|
Fraser, C. M.,
Casjens, S.,
Huang, W. M.,
Sutton, G. G.,
Clayton, R.,
Lathigra, R.,
White, O.,
Ketchum, K. A.,
Dodson, R.,
Hickey, E. K.,
Gwinn, M.,
Dougherty, B.,
Tomb, J.-F.,
Fleischmann, R. D.,
Richardson, D.,
Peterson, J.,
Kerlavage, A. R.,
Quackenbush, J.,
Salzberg, S.,
Hanson, M.,
van Vugt, R.,
Palmer, N.,
Adams, M. D.,
Gocayne, J. D.,
Weidman, J.,
Utterback, T.,
Watthey, L.,
McDonald, L.,
Artiach, P.,
Bowman, C.,
Garland, S.,
Fujii, C.,
Cotton, M. D.,
Horst, K.,
Roberts, K.,
Hatch, B.,
Smith, H. O.,
and Venter, J. C.
(1997)
Nature
390,
580-586
|
| 26.
|
Ge, Z.,
and Taylor, D.
(1997)
J. Bacteriol.
179,
4970-4976
|
| 27.
|
Thompson, J. D.,
Higgins, D. G.,
and Gibson, T. J.
(1994)
Nucleic Acids Res.
22,
4673-4680
|
| 28.
|
Sneath, P. H. A.,
and Sokal, R. R.
(1973)
Numerical Taxonomy,
, Freeman, San Franscisco
|
| 29.
|
Nikawa, J.,
Tsukagoshi, Y.,
Kodaki, T.,
and Yamashita, S.
(1987)
Eur. J. Biochem.
167,
7-12
|
| 30.
|
Okada, M.,
Matsuzaki, H.,
Shibuya, I.,
and Matsumoto, K.
(1994)
J. Bacteriol.
176,
7456-7461
|
| 31.
|
Dryden, S. C.,
and Dowhan, W.
(1996)
J. Bacteriol.
178,
1030-1038
|
| 32.
|
Gopalakrishnan, A. S.,
Chen, Y. C.,
Temkin, M.,
and Dowhan, W.
(1986)
J. Biol. Chem.
261,
1329-1338
|
| 33.
|
Tanaka, S.,
Nikawa, J.,
Imai, H.,
Yamashita, S.,
and Hosaka, K.
(1996)
FEBS Lett.
393,
89-92
|
| 34.
|
Nikawa, J.,
Kodaki, T.,
and Yamashita, S.
(1987)
J. Biol. Chem.
262,
4876-4881
|
| 35.
|
Hjelmstad, R. H.,
and Bell, R. M.
(1990)
J. Biol. Chem.
265,
1755-1764
|
| 36.
|
Hjelmstad, R. H.,
and Bell, R. M.
(1991)
J. Biol. Chem.
266,
5094-5103
|
| 37.
|
Dewey, R. E.,
Wilson, R. F.,
Novitzky, W. P.,
and Goode, J. H.
(1994)
Plant Cell
6,
1495-1507
|
| 38.
|
Sheard, N. F.,
Tayek, J. A.,
Bistrian, B. R.,
Blackburn, G. L.,
and Zeisel, S. H.
(1986)
Am. J. Clin. Nutr.
43,
219-224
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Sandoval-Calderon, O. Geiger, Z. Guan, F. Barona-Gomez, and C. Sohlenkamp
A Eukaryote-like Cardiolipin Synthase Is Present in Streptomyces coelicolor and in Most Actinobacteria
J. Biol. Chem.,
June 26, 2009;
284(26):
17383 - 17390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Vences-Guzman, O. Geiger, and C. Sohlenkamp
Sinorhizobium meliloti Mutants Deficient in Phosphatidylserine Decarboxylase Accumulate Phosphatidylserine and Are Strongly Affected during Symbiosis with Alfalfa
J. Bacteriol.,
October 15, 2008;
190(20):
6846 - 6856.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Hacker, C. Sohlenkamp, M. Aktas, O. Geiger, and F. Narberhaus
Multiple Phospholipid N-Methyltransferases with Distinct Substrate Specificities Are Encoded in Bradyrhizobium japonicum
J. Bacteriol.,
January 15, 2008;
190(2):
571 - 580.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. Riekhof, J. Wu, M. A. Gijon, S. Zarini, R. C. Murphy, and D. R. Voelker
Lysophosphatidylcholine Metabolism in Saccharomyces cerevisiae: THE ROLE OF P-TYPE ATPases IN TRANSPORT AND A BROAD SPECIFICITY ACYLTRANSFERASE IN ACYLATION
J. Biol. Chem.,
December 21, 2007;
282(51):
36853 - 36861.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Sohlenkamp, K. E. E. de Rudder, and O. Geiger
Phosphatidylethanolamine Is Not Essential for Growth of Sinorhizobium meliloti on Complex Culture Media
J. Bacteriol.,
March 15, 2004;
186(6):
1667 - 1677.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-G. Wang, J. P. Scagliotti, and L. T. Hu
Phospholipid synthesis in Borrelia burgdorferi: BB0249 and BB0721 encode functional phosphatidylcholine synthase and phosphatidylglycerolphosphate synthase proteins
Microbiology,
February 1, 2004;
150(2):
391 - 397.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Martinez-Morales, M. Schobert, I. M. Lopez-Lara, and O. Geiger
Pathways for phosphatidylcholine biosynthesis in bacteria
Microbiology,
December 1, 2003;
149(12):
3461 - 3471.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Karnezis, H. C. Fisher, G. M. Neumann, B. A. Stone, and V. A. Stanisich
Cloning and Characterization of the Phosphatidylserine Synthase Gene of Agrobacterium sp. Strain ATCC 31749 and Effect of Its Inactivation on Production of High-Molecular-Mass (1->3)-{beta}-D-Glucan (Curdlan)
J. Bacteriol.,
August 1, 2002;
184(15):
4114 - 4123.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|