HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 25, 18919-18925, June 23, 2000

This Article Abstract Full Text (PDF) An addition or correction has been published All Versions of this Article: 275/25/18919    most recent M000844200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sohlenkamp, C. Articles by Geiger, O. Search for Related Content PubMed PubMed Citation Articles by Sohlenkamp, C. Articles by Geiger, O. Social Bookmarking                      What's this?

Cloning and Characterization of the Gene for Phosphatidylcholine Synthase^*

Christian Sohlenkamp, Karel E. E. de Rudder, Viola Röhrs, Isabel M. López-Lara^§, and Otto Geiger^§¶

From the  Institute of Biotechnology, Technical University of Berlin, Seestrasse 13, D-13353 Berlin, Germany and the ^§ Centro de Investigación sobre Fijación de Nitrógeno, Universidad Nacional Autónoma de México, Apdo. Postal 565-A, Cuernavaca, Morelos, CP62210, México

Received for publication, February 2, 2000, and in revised form, April 10, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Phosphatidylcholine (PC) is the major membrane-forming phospholipid in eukaryotes and can be synthesized by either of two pathways, the CDP-choline pathway or the methylation pathway. In prokaryotes only the methylation pathway was thought to occur. Recently, however, we could demonstrate (de Rudder, K. E. E., Sohlenkamp, C., and Geiger, O. (1999) J. Biol. Chem. 274, 20011-20016) that a second pathway for phosphatidylcholine biosynthesis exists in Sinorhizobium (Rhizobium) meliloti involving a novel enzymatic activity, phosphatidylcholine synthase, that condenses choline and CDP-diacylglyceride in one step to form PC and CMP. Using a colony autoradiography method we have isolated mutants of S. meliloti deficient in phosphatidylcholine synthase and which are no longer able to incorporate radiolabeled choline into PC. Complementation of such mutants with a sinorhizobial cosmid gene bank, subcloning of the complementing fragment, and sequencing of the subclone led to the identification of a gene coding for a presumptive CDP-alcohol phosphatidyltransferase. Amplification of this gene and its expression in Escherichia coli demonstrates that it codes for phosphatidylcholine synthase. Genomes of some pathogens (Pseudomonas aeruginosa and Borrelia burgdorferi) contain genes similar to the sinorhizobial gene (pcs) for phosphatidylcholine synthase. Although pcs-deficient S. meliloti knock-out mutants show wild type-like growth and lipid composition, they are unable to perform rapid PC biosynthesis that normally is achieved via the phosphatidylcholine synthase pathway in S. meliloti wild type.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In eukaryotic organisms the membrane lipid phosphatidylcholine (PC)¹ can be synthesized by two alternative biosynthetic pathways (1). In the CDP-choline pathway, choline is activated to choline phosphate and subsequently to CDP-choline which condenses with diacylglycerol to obtain PC. In the methylation pathway, however, phosphatidylethanolamine is N-methylated three times with S-adenosylmethionine as the methyl donor in order to yield PC. Only the methylation pathway of PC biosynthesis was thought to occur in prokaryotes (2). However, in addition to the methylation pathway we could recently show a novel pathway for PC biosynthesis in the soil bacterium Sinorhizobium (Rhizobium) meliloti (3, 4). S. meliloti which is able to form a nitrogen-fixing symbiosis with legume plants (5) possesses an enzyme activity, phosphatidylcholine synthase, that condenses choline directly with CDP-diacylglyceride to form PC in one step (4). Here we describe the isolation of mutants deficient in phosphatidylcholine synthase. Complementation of such mutants, subcloning of the complementing fragment, and sequencing of the complementing DNA led to the identification of the gene for phosphatidylcholine synthase. We also demonstrate that after amplification and expression of the gene in Escherichia coli, phosphatidylcholine synthase activity can be detected in E. coli cell-free extracts.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Strains, Plasmids, Media, and Growth Conditions-- Strains and plasmids used in this study are listed in Table I (6-16). S. (Rhizobium) meliloti strains were grown at 29 °C in tryptone/yeast extract (TY) medium (17) or in MOPS minimal medium containing 40 mM MOPS, 20 mM KOH, 20 mM NH₄Cl, 100 mM NaCl, 2 mM MgSO₄, 1.2 mM CaCl₂, 0.3 mg of biotin/liter, 15 mM succinate, and 10 mM potassium phosphate buffer, pH 7. E. coli strains were grown at 37 °C in LB medium (9). Antibiotics were added when required to obtain the following final concentrations in milligrams/liter medium: 400 spectinomycin, 20 piperacillin, and 2 tetracycline for S. meliloti, and 200 spectinomycin, 100 carbenicillin, 50 kanamycin, and 20 tetracycline for E. coli. A betCBA-deficient derivative of S. meliloti 5000, IML101, was constructed in an analogous way as described (4). The betCBA-deficient phenotype of the tetracycline-sensitive double recombinant IML101 was confirmed by its ability to use glycine betaine but not choline as sole carbon source.

Isolation of Mutants Deficient in Phosphatidylcholine Synthase Using a Colony Autoradiography Method-- Cells of S. meliloti IML101 were mutagenized with N-methyl-N'-nitro-N-nitrosoguanidine as described previously (3). The mutagenized cells were then spread on MOPS minimal agar medium with sucrose (15 mM) instead of succinate as carbon source and grown at 29 °C for 4 days. The colonies were transferred to sterile filter paper discs (Whatman No. 42; 8 cm diameter) and used directly in a modified autoradiography method. The mother plates, which had retained the original colony pattern, were incubated overnight at 29 °C in order to regrow the colonies and they were subsequently stored for up to 2 weeks at 4 °C. In order to search for colonies unable to incorporate labeled choline into lipid material the filters were incubated in Petri dishes floating in a 29 °C water bath. The Petri dishes each contained 1.2 ml of MOPS minimal medium with 15 mM sucrose and 540 nCi of [methyl-¹⁴C]choline (55 mCi/mmol). After 1 h of incubation, the reaction was stopped by transfer of the filters to a Büchner funnel and addition of 20 ml of an ice-cold 20% (w/v) trichloroacetic acid solution. After 5 min, non-incorporated radioactivity was washed away under gentle suction on the funnel. The filters were washed once more with 50 ml of ice-cold 5% (w/v) trichloroacetic acid, respectively. The washed replica print filters were dried in an oven at 120 °C for 20 min. The dried filters were subjected to autoradiography by a 3 days exposure to Kodak Biomax MR-1 film. Subsequently they were stained with Coomassie Blue G-250 in order to visualize the colony patterns.

DNA Manipulations-- Recombinant DNA techniques were performed according to standard protocols (9). A genomic DNA bank of S. meliloti 1021 was constructed in the cosmid vector pLAFR3 as described previously (10). Total genomic DNA of S. meliloti was isolated as described (6) and the DNA was partially digested with Sau3AI and size fractionated on a 5-20% sucrose gradient. Fragments were ligated to linearized pLAFR3 vector DNA and the ligated DNA was packaged in vitro with the DNA packaging kit of Roche Molecular Biochemicals and transduced in E. coli HB101. About 50% of the cosmid derivatives obtained comprised DNA inserts ranging in size between 22 and 40 kb. DNA was sequenced by the chain termination method (18) using a SQ3 sequencer (Hoefer) and pUC19 derivatives. The DNA region sequenced and the deduced proteins were analyzed using the Omiga program (Oxford Molecular Ltd., Oxford, United Kingdom) or the NCBI (National Center for Biotechnology Information) BLAST network server (19). Preliminary sequence data was obtained from The Institute for Genomic Research website and from the Rhodobacter capsulatus sequencing project. Homologies of sequences were quantified by percentage of identical residues. Searches for motifs in deduced amino acid sequences were performed using the server of Kyoto Center (Japan). In order to analyze DNA restriction fragments for functional complementation they were cloned into the broad host range plasmid pRK404 (Table I). Cosmid, pRK404, or pMP92 derivatives were mobilized into S. meliloti strains by triparental mating using the mobilizing plasmid pRK2013 as described previously (20).

Functional Complementation of Pcs-deficient Mutant S. meliloti CS07-- Cosmids of the sinorhizobial gene bank or pRK404 derivatives were mobilized into mutant CS07 as described above and transconjugants were selected on TY medium containing piperacillin and tetracycline. Complementation of CS07 by phosphatidylcholine synthase was investigated by the colony autoradiography method described above and from colonies able to incorporate labeled choline into lipid, cosmids were isolated, transformed in E. coli DH5, and the respective DNA inserts were analyzed.

Cloning and Expression of the Putative Phosphatidylcholine Synthase (pcs) Gene of S. meliloti in E. coli-- Using PCR and specific oligonucleotides (GAATAAAGCTTTCGCATATGAAGTTCTTCAATTACAGACGC and AAAGGATCCTCAGGCACGCCCGAGTTTCGGG) the gene suspected to code for phosphatidylcholine synthase (pcs) of S. meliloti was amplified from the cosmid pCOS1 with Pfu polymerase. Suitable restriction sites (underlined) for cloning the suspected pcs gene were introduced by PCR with the oligonucleotides. After restriction with NdeI and BamHI the PCR-amplified DNA fragment was cloned into a pET9a vector (16) to obtain the expression plasmid pTB2559 in which the potential pcs gene can be overexpressed under control of the T7 promoter. The correct in-frame cloning and the correct sequence was demonstrated by DNA sequencing (data not shown). E. coli strain BL21(DE3) (16) which expresses the T7 polymerase under the control of the lac promoter was transformed with pTB2559. At a cell density of 5 × 10⁸ cells/ml, isopropyl--D-thiogalactoside was added to a final concentration of 0.1 mM. After 4 h of induction cells were harvested and stored in a freezer at 20 °C.

Inactivation of the Sinorhizobial pcs Gene by a Cassette-- The spectinomycin resistance conferring 2.0-kb SmaI-SmaI fragment of pHY109 was cloned into the unique MluI site of the sinorhizobial pcs gene on plasmid pTB2536 to yield pTB2160. The plasmid pTB2160 was mobilized into a wild type S. meliloti 1021. The spectinomycin cassette-inactivated pcs was recombined into the wild type genome by the plasmid-incompatibility technique as described (15). Potential double recombinants were further analyzed by Southern hybridization (data not shown) and the pcs-deficient phenotype of tetracycline-sensitive double recombinants was confirmed by the absence of phosphatidylcholine synthase activity in cell-free extracts.

Preparation of Cell-free Extracts and Determination of Specific Phosphatidylcholine Synthase Activity-- Frozen cells were resuspended in 10 volumes of 50 mM Tris/HCl, pH 8.0, and cell-free extracts were prepared as described previously (3). The optimized standard assay to determine phosphatidylcholine synthase activity (4) contained, in a total volume of 50 µl in Eppendorf tubes, (50 µg of protein, 50 mM Tris/HCl, pH 8.0, 10 mM MnCl₂, 20 µM CDP-diacylglycerol, 0.2% (w/v) Triton X-100, and 50 µM [methyl-¹⁴C]choline (55 mCi/mmol). The mixtures were incubated for 15 min in a 30 °C water bath and stopped by mixing with 188 µl of methanol/chloroform (2:1; v/v). Addition of 63 µl of chloroform and 63 µl of water led to phase separation and after washing the chloroform phase once with another 100 µl of water it was dried and quantified in a scintillation counter. Under such conditions the only radioactive compound detectable in the chloroform phase was PC.

Determination of Membrane Lipid Composition and Synthesis-- In S. meliloti, under some conditions of growth (phosphate limitation), membrane phospholipids are largely replaced by lipids that do not contain any phosphorus (21). Specifically, it is thought that diacylglyceryl-N,N,N-trimethylhomoserine can functionally replace PC in membranes (22). In order to be able to detect the potential formation of phosphorus-free membrane lipids in pcs-deficient mutants as well, the membrane lipid composition or synthesis of different S. meliloti strains was determined after labeling with [1-¹⁴C]acetate. Cultures (1 ml) in TY medium were inoculated from precultures grown in the same medium. After the addition of 2 µCi of [1-¹⁴C]acetate (60 mCi/mmol) at initial cell densities of 9 × 10⁷ cells/ml to each culture, the cultures were incubated for 24 h in experiments when lipid composition was to be determined. In order to determine lipid synthesis rates, cultures were labeled with 2 µCi of [1-¹⁴C]acetate (60 mCi/mmol) or with 0.56 µCi of [methyl-¹⁴C]choline (55 mCi/mmol) at initial cell densities of 4.5 × 10⁸ cells/ml for 30 min. During this 30-min pulse, incorporation of labeled acetate or labeled choline into chloroform-soluble total lipid material occurred at linear rates, respectively. After the labeling periods, cells were harvested by centrifugation and lipids were extracted, separated by two-dimensional thin-layer chromatography, and quantified as described previously (3).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isolation of Mutants Deficient in Phosphatidylcholine Synthase-- A mutant strain of S. meliloti (IML101), unable to metabolize choline as sole carbon and nitrogen source but able to incorporate choline directly into PC, was used for the search of phosphatidylcholine synthase (Pcs)-deficient mutants. Cells of S. meliloti IML101 were heavily mutagenized with N-methyl-N'-nitro-N-nitrosoguanidine resulting in 1% survival. Mutagenized colonies were screened for the inability to incorporate labeled choline into lipid material. In the selection procedure for a potential mutant, Coomassie Blue-stained replica print filters were compared with the corresponding autoradiograms (data not shown), in an analogous way as described earlier (3). Of 26,000 colonies screened, 15 candidates showed reduced incorporation of radiolabeled choline when the autoradiogram was compared with the respective Coomassie Blue-stained filter. The 15 candidates were further analyzed by directly determining the in vivo incorporation of [¹⁴C]choline into PC as described (4) using TLC analysis. Of the candidates, 7 were unable to incorporate radiolabeled choline into PC (data not shown) and cell-free extracts of these 7 S. meliloti mutants (CS01, CS02, CS03, CS06, CS07, CS09, and CS10) showed much reduced or no phosphatidylcholine synthase activity (Table II).

Isolation of a Sinorhizobial DNA Fragment Able to Complement Phosphatidylcholine Synthase-deficient Mutant S. meliloti CS07-- The Pcs-deficient mutant CS07 of S. meliloti was conjugated with E. coli strains carrying a genomic library of S. meliloti that had been constructed in the cosmid vector pLAFR3 as described under "Experimental Procedures." Screening for complemented mutants with intact Pcs activity was performed using the colony autoradiography method described above based on their regained ability to incorporate radiolabel from [¹⁴C]choline into lipid material. Of about 5500 colonies screened, 13 showed strongly increased radiolabel incorporation when autoradiograms were compared with the corresponding Coomassie Blue-stained replica print filters (data not shown). From complemented mutants forming choline-derived lipid material, the cosmids were isolated and transformed in E. coli DH5 for further analysis. Four types of overlapping cosmids were able to complement the Pcs-deficient phenotype of mutant CS07. Representatives of those types are cosmids pCOS1, pCOS14, pCOS20, and pCOS35, all containing between 30 and 37 kb of sinorhizobial DNA, two of which are indicated in Fig. 1. Subcloning of restriction fragments, comprising regions of the overlapping DNA, in the broad host-range vector pRK404 and subsequent analysis for complementation of the Pcs-deficient mutant CS07 shows that a plasmid (pTB2532), containing a 4.6-kb HindIII-HindIII DNA fragment derived from pCOS1 (Fig. 1), is able to restore formation of choline-derived PC (Table II). Plasmid pTB2532 was able to restore Pcs activity in the other Pcs-deficient sinorhizobial mutants (CS01, CS02, CS03, CS06, CS09, and CS10) as well (data not shown), demonstrating that all 7 Pcs-deficient chemical mutants isolated belong to the same complementation group.

View larger version (14K): [in this window] [in a new window]   Fig. 1.   Physical and restriction map of the genomic sinorhizobial DNA region complementing phosphatidylcholine synthase-deficient mutants. A, sinorhizobial DNA region complementing phosphatidylcholine synthase deficiency. B, representatives of phosphatidylcholine synthase-complementing cosmids (pCOS20, pCOS1) and pCOS1-derived phosphatidylcholine synthase-complementing 4.6-kb subclone pTB2532. The DNA sequence determined allowed the identification of 4 potential genes encoding for proteins with the following proposed functions: 1) ccsA gene encoding a chaperon involved in cytochrome c maturation; 2) mdcF gene encoding a transporter; 3) ubiH gene encoding 2-octaprenyl-6-methoxyphenol hydroxylase; 4) pcs gene encoding phosphatidylcholine synthase. The insertion point of a 2.0-kb DNA fragment containing the spectinomycin resistance-conferring cassette (aadA, gene for aminoglycoside adenylyltransferase) in mutant KDR568 is indicated. Restriction sites (H, HindIII; E, EcoRI; B, BamHI; S, Sau3AI; M, MluI) used are shown.

Analysis of Phosphatidylcholine Synthase-complementing DNA-- The DNA sequence of the internal 4.6-kb HindIII-HindIII fragment of the Pcs-complementing plasmid pTB2532 was determined and the sinorhizobial DNA ranging from a HindIII site to a BamHI/Sau3AI site was submitted (accession number AF155772). Analysis of the sinorhizobial sequence (4599 base pairs) revealed four complete open reading frames (ORFs) (Fig. 1). Genebank searches with the NCBI BLAST program showed that the first ORF (positions 199 to 1095) encoded a protein of 299 amino acids that showed homology to the cytochrome c-type biogenesis proteins of Aquifex aeolicus (accession number AE000657) (43% amino acid identity), Mycobacterium tuberculosis (ccsA gene, accession number Z95558) (40% amino acid identity), and Bacillus subtilis (ccdA gene, accession number Z99113) (35% amino acid identity). It is interesting to note that in addition to the well known Ccm system of cytochrome c maturation (23), Rhizobia seem to possess an additional CcdA-like and therefore quite different system for the maturation of cytochrome c. The second complete ORF (positions 1238 to 2197) encoded a protein of 320 amino acids that showed homology to an ORF (31% amino acid identity) from the unfinished Bordetella pertussis genome project and to the putative malonate transporter MdcF (accession number U95087) of Klebsiella pneumoniae (23% amino acid identity). The third complete ORF (positions 3445 to 2171) is oriented in the opposite direction and its end overlaps with the end of ORF2. The potential gene product of 425 amino acids showed homology to an ORF (34% amino acid identity) from the unfinished Caulobacter crescentus genome project and to the ubiH (accession number AE000374) gene product 2-octaprenyl-6-methoxyphenol hydroxylase of E. coli (31% amino acid identity). The fourth complete ORF (positions 3723 to 4445) is oriented divergently from ORF3 and encoded a very hydrophobic protein of 241 amino acids that showed homology to CDP-alcohol phosphatidyltransferases (Fig. 2) (24-27). The typical motif (DG(X)2AR(X)8G(X)3D(X)3D) described to be specific for CDP-alcohol phosphatidyltransferases (24) is found to some extent, however, 12 amino acid residues instead of 8 are located between the conserved Arg and the second conserved Gly residue in the case of ORF4. Secondary structure predictions propose 6, 7, or 8 transmembrane helices for the encoded protein, depending on the program used (data not shown). Therefore this fourth ORF could be the gene (pcs) that codes for the sinorhizobial phosphatidylcholine synthase.

View larger version (87K): [in this window] [in a new window]   Fig. 2.   Comparison of pcs-derived amino acid sequence with sequences derived from other CDP-alcohol phosphatidyltransferase-like ORFs. The S. meliloti phosphatidylcholine synthase sequence (SmPcs) was aligned with the sequences of an ORF (ORF M3.o16316) from R. capsulatus (RcORF), an ORF (on contig 52 in the version from 3/15/99) from P. aeruginosa (PaORF), an ORF (25) from B. burgdorferi (BbORF), and phosphatidylserine synthase (26) from H. pylori (HpPss) using the program CLUSTAL W (27). The residues identical with SmPcs are underlayed in black and the residues similar to SmPcs are shaded in gray. Residues thought to be characteristic for the CDP-alcohol phosphotransferase motif (24) are indicated by asterisks at the top.

Expression of the Putative Sinorhizobial pcs Gene in E. coli-- In order to perform a functional analysis of the putative pcs gene of S. meliloti, the fourth ORF was amplified by PCR, cloned in a pET9a expression vector to obtain plasmid pTB2559, and expressed in E. coli BL21(DE3) by induction with isopropyl--D-thiogalactoside as described under "Experimental Procedures." Cell-free extracts were analyzed for Pcs activity (Table II). No Pcs activity can be demonstrated in extracts of E. coli BL21(DE3) containing the empty pET9a vector. In E. coli BL21(DE3) containing plasmid pTB2559 Pcs activity was detected without induction, and high Pcs activity was found after induction with isopropyl--D-thiogalactoside. These results demonstrate that the fourth ORF, suspected to be the pcs gene, indeed codes for a functional phosphatidylcholine synthase (Pcs).

Characterization of a Phosphatidylcholine Synthase-deficient Null Mutant of S. meliloti-- In order to precisely define the phenotype of a pcs-deficient S. meliloti, a mutant (KDR568) was constructed by insertion of a spectinomycin resistance-conferring  interposon into the pcs gene (see "Experimental Procedures" and Fig. 1). No Pcs activity was detected in cell-free extracts of KDR568 whereas a KDR568-derived strain, harboring the pcs gene on a multicopy plasmid (pTB2532), was overproducing the Pcs activity (Table II). The growth properties of various sinorhizobial strains were studied on complex TY medium and therefore under conditions where a functional Pcs is able to form PC from choline present in this medium (4). Growth rates and final optical densities of S. meliloti 1021 and IML101 wild types, the Pcs-deficient chemical (CS07) and knock-out mutant (KDR568) as well as of the Pcs-overproducing strain (KDR568 × pTB2532) were determined and in no case any significant difference in growth rate or final cell yield was observed if the strains were compared with the wild type (Fig. 3). Also, when the lipid compositions of the Pcs-deficient chemical (CS07), of the knock-out mutant (KDR568), and of the Pcs-overproducing strain (KDR568 × pTB2532) were compared with S. meliloti 1021 wild type after a 24-h labeling with [¹⁴C]acetate, essentially no difference was observed (data not shown) and they all showed the lipid composition reported earlier for the wild type (21). Obviously, the methylation pathway of PC biosynthesis which is still functioning in Pcs-deficient mutants can compensate for the lack of Pcs to some extent. Also, the steady-state phospholipid composition is a reflection of both synthesis and turnover. This type of analysis was not sensitive enough to exhibit an effect of the pcs mutation under standard laboratory growth conditions.

View larger version (13K): [in this window] [in a new window]   Fig. 3.   Growth on complex TY medium of S. meliloti wild type, phosphatidylcholine synthase-deficient mutants, and complemented mutant. S. meliloti 1021 (), phosphatidylcholine synthase-deficient mutant KDR568 (), KDR568 × pRK404 (), complemented mutant KDR568 × pTB2532 (). Similar growth as in the curves indicated was observed for IML101 and the pcs-deficient chemical mutant CS07. For each growth curve, three independent cultures were analyzed and averaged. Standard error bars are smaller than symbol sizes.

When we measured lipid synthesis rates based on the incorporation of radiolabeled acetate over 30 min into the individual lipid fractions (Table III) we observed that in the wild types, PC comprised 20% in the case of Sm1021 and 23% in the case of IML101 of all lipid material synthesized. However, the Pcs-deficient chemical (CS07) and knock-out mutant (KDR568) as well as the knock-out mutant containing an empty broad host range plasmid (KDR568 × pRK404) showed much reduced rates of PC synthesis (about 2% of all lipid material synthesized). In Pcs-deficient mutants no formation of the phosphorus-free membrane lipids sulfoquinovosyl diacylglycerol, ornithine lipid, or diacylglyceryl-N,N,N-trimethylhomoserine was observed when they were grown on TY medium, similarly as earlier found for the wild type (21). In the Pcs-overproducing strain (KDR568 × pTB2532) high PC synthesis rates, comprising about 25% of all lipid material synthesized, were restored. These results demonstrate that Pcs is responsible for rapid PC biosynthesis in S. meliloti on complex media.

The results obtained when studying the incorporation of radiolabeled choline over 30 min into the individual lipid fractions (Table IV) demonstrated that in the case of the Sm1021 wild type, 66% of the choline-derived label in lipids was detected in PC. However, the other major membrane lipids (PG, CL, PE + MMPE) also became considerably labeled. In the Pcs-deficient knock-out mutant (KDR568) as well as in the knock-out mutant containing an empty broad host range plasmid (KDR568 × pRK404), incorporation of radiolabled choline into PC was much reduced and comprised only about 2-3% of the Sm1021 wild type level. In the Pcs-overproducing strain (KDR568 × pTB2532) high rates of incorporation of radiolabled choline into PC were restored and 80% of the choline-derived label in lipids was detected in PC. In all strains with an intact pathway for choline oxidation (Sm1021, KDR568, KDR568 × pRK404, and KDR568 × pTB2532), choline was rapidly degraded and considerable amounts of the choline-derived labeled methyl groups are incorporated into cyclopropane-containing fatty acyl residues of all membrane lipids (3). In betCBA-deficient strains (IML101 and CS07) incorporation of radiolabled choline into lipid material was much reduced. In IML101, the inability to degrade choline essentially eliminated the incorporation of radiolabeled choline into lipids other than PC, and the only labeled lipid that can be detected in IML101 is PC. The Pcs-deficient derivative CS07 hardly incorporated any choline-derived label into lipids.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Recently we have discovered a novel pathway for phosphatidylcholine biosynthesis in the symbiotic soil bacterium S. meliloti (4). In this pathway, a so far unknown enzymatic activity, phosphatidylcholine synthase (systematic name: CDP-diacylglycerol:choline 3-phosphatidyltransferase), condenses choline with CDP-diacylglyceride to form PC and CMP in one step. The choline used for this reaction can be provided by the host plant (4) and thereby the methylation pathway of PC biosynthesis requiring 3 S-adenosylmethionines for each molecule of PC formed can be circumvented. Here we describe the isolation and characterization of the sinorhizobial gene for pcs. Similarity searches using the BLAST algorithm (19) revealed significant similarities to other CDP-alcohol phosphatidyltransferases. Limited similarity is found, i.e. to some phosphatidylserine synthases (Pss) (27% amino acid identity with Pss from Helicobacter pylori), enzymes catalyzing the condensation of serine with CDP-diacylglyceride to yield phosphatidylserine and CMP. However, during alignments of S. meliloti Pcs with Pss, major gaps have to be introduced (Fig. 2). More similar potential CDP-alcohol phosphatidyltransferases, where less or no gaps have to be introduced during alignments (Fig. 2), can be detected in some bacterial genomes. The highest similarity of Pcs from S. meliloti is found to an ORF (43% amino acid identity) from the unfinished R. capsulatus genome project. High similarity is also observed to an ORF (39% amino acid identity) from the unfinished Pseudomonas aeruginosa genome project and to an ORF (29% amino acid identity) from the Borrelia burgdorferi genome. An alignment of those ORFs with the Pcs protein from S. meliloti and the representative Pss from H. pylori is shown in Fig. 2. We have noted that the amino acid sequence derived from the sinorhizobial pcs gene shows a variation of the motif described as being characteristic for CDP-alcohol phosphatidyltransferases (DG(X)2AR(X)8G(X)3D(X)3D). In the sinorhizobial Pcs, 12 amino acid residues instead of 8 are located between the conserved Arg and the second conserved Gly residue of the motif, an area which is thought to be part of the active site of CDP-alcohol phosphatidyltransferases (24). Interestingly, the ORFs from R. sphaeroides, P. aeruginosa, and B. burgdorferi which are most similar to Pcs of S. meliloti show 12 amino acid residues between the conserved Arg and the second conserved Gly. Furthermore, there is a conserved Lys (position 5) and a conserved Pro (position 9) in the 12-amino acid stretch the active site region in all 3 ORFs and the sinorhizobial Pcs which are absent in other CDP-alcohol phosphatidyltransferases. A dendrogram based on CDP-alcohol phosphatidyltransferase amino acid sequences constructed by the UPGMA method of Sneath and Sokal (28) demonstrates that the ORFs from R. sphaeroides, P. aeruginosa, B. burgdorferi, and the Pcs from S. meliloti are related to each other and form a subgroup within the CDP-alcohol phosphatidyltransferases (Fig. 4) (28-37). Presently we are investigating whether the 3 ORFs from R. sphaeroides, P. aeruginosa, and B. burgdorferi code for functional Pcs.

View larger version (21K): [in this window] [in a new window]   Fig. 4.   Dendrogram of CDP-alcohol phosphatidyltransferases. The dendrogram was constructed by the UPGMA method of Sneath and Sokal (28) based on the following CDP-alcohol phosphatidyltransferase amino acid sequences: Pss from yeast (29), Pss from B. subtilis (30), phosphatidylserine synthase (Pss) from H. pylori (26), phosphatidylglycerol phosphate synthase (PgsA) from R. sphaeroides (31), phosphatidylglycerol phosphate synthase (PgsA) from E. coli (32), phosphatidylinositol synthase (Pis) from rat (33), phosphatidylinositol synthase (Pis) from yeast (34), sn-1,2-diacylglycerol cholinephosphotransferase (CPT1) from yeast (35), sn-1,2-diacylglycerol ethanolaminephosphotransferase (EPT1) from yeast (36), amino alcohol phosphotransferase (AAPT1) from soybean (37), phosphatidylcholine synthase (Pcs) from S. meliloti, ORF from R. capsulatus, ORF from P. aeruginosa, ORF from B. burgdorferi.

We have demonstrated earlier that in the case of S. meliloti the choline required for synthesizing PC via the phosphatidylcholine synthase pathway may be supplied by its legume host plants (4). Animal or human hosts also contain considerable amounts of choline in their body fluids (38). It is interesting to note also that the facultative pathogen P. aeruginosa and the obligate pathogen and causative agent of Lyme disease, the spirochaete B. burgdorferi, may possess genes coding for a phosphatidylcholine synthase activity which might enable them to obtain choline for phosphatidylcholine biosynthesis directly from their animal or human hosts. So far we have not detected Pcs-like profiles (DG(X)2AR(X)4K(X)3P(X)3G(X)3D(X)3D) in eukaryotic genomes or expressed sequence tags (data not shown). Pcs activity and the biosynthetic pathway associated with it might therefore be limited to some symbiotic and pathogenic bacteria. If Pcs is required for a successful interaction with the eukaryotic host, drugs directed against Pcs might selectively inhibit Pcs-utilizing bacteria and might show an antibiotic effect.

As the relative amounts of PC in S. meliloti vary considerably depending on the conditions of growth (21), rapid PC synthesis or degradation might be required in this organism in order to quickly adjust to new environmental conditions. In our search for a phenotype associated with a Pcs deficiency we found that in S. meliloti Pcs is required for rapid PC synthesis. This ability might allow the bacterium to rapidly increase the relative amount of PC in its membrane and therefore adjust membrane lipid-dependent properties more rapidly if such an organism is growing in a choline-containing environment as it is normally provided by a eukaryotic host.

	ACKNOWLEDGEMENTS

We thank C. Raetz and M. Schobert for valuable discussions.

	FOOTNOTES

^* This work was supported by the Deutsche Forschungsgemeinschaft (Ge556/2-3).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This article is dedicated to Eugene P. Kennedy on the occasion of his 80th birthday.

^¶ To whom correspondence should be addressed: Centro de Investigación sobre Fijación de Nitrógeno, Universidad Nacional Autónoma de México, Apdo. Postal 565-A, Cuernavaca, Morelos, CP 62210, México. Tel.: 52-73-131697; Fax: 52-73-175581; E-mail: otto@cifn.unam.mx.

Published, JBC Papers in Press, April 12, 2000, DOI 10.1074/jbc.M000844200

	ABBREVIATIONS

The abbreviations used are: PC, phosphatidylcholine; Pcs, phosphatidylcholine synthase; Pss, phosphatidylserine synthase; MOPS, 4-morpholinepropanesulfonic acid; kb, kilobase(s); ORF, open reading frame; PCR, polymerase chain reaction; PE, phosphatidylethanolamine; MMPE, monomethylphosphatidylethanolamine; PG, phosphatidylglycerol; CL, cardiolipin.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Hacker, C. Sohlenkamp, M. Aktas, O. Geiger, and F. Narberhaus Multiple Phospholipid N-Methyltransferases with Distinct Substrate Specificities Are Encoded in Bradyrhizobium japonicum J. Bacteriol., January 15, 2008; 190(2): 571 - 580. [Abstract] [Full Text] [PDF]

				W. R. Riekhof, J. Wu, M. A. Gijon, S. Zarini, R. C. Murphy, and D. R. Voelker Lysophosphatidylcholine Metabolism in Saccharomyces cerevisiae: THE ROLE OF P-TYPE ATPases IN TRANSPORT AND A BROAD SPECIFICITY ACYLTRANSFERASE IN ACYLATION J. Biol. Chem., December 21, 2007; 282(51): 36853 - 36861. [Abstract] [Full Text] [PDF]

				C. Sohlenkamp, K. E. E. de Rudder, and O. Geiger Phosphatidylethanolamine Is Not Essential for Growth of Sinorhizobium meliloti on Complex Culture Media J. Bacteriol., March 15, 2004; 186(6): 1667 - 1677. [Abstract] [Full Text] [PDF]

				X.-G. Wang, J. P. Scagliotti, and L. T. Hu Phospholipid synthesis in Borrelia burgdorferi: BB0249 and BB0721 encode functional phosphatidylcholine synthase and phosphatidylglycerolphosphate synthase proteins Microbiology, February 1, 2004; 150(2): 391 - 397. [Abstract] [Full Text] [PDF]

				F. Martinez-Morales, M. Schobert, I. M. Lopez-Lara, and O. Geiger Pathways for phosphatidylcholine biosynthesis in bacteria Microbiology, December 1, 2003; 149(12): 3461 - 3471. [Abstract] [Full Text] [PDF]

				T. Karnezis, H. C. Fisher, G. M. Neumann, B. A. Stone, and V. A. Stanisich Cloning and Characterization of the Phosphatidylserine Synthase Gene of Agrobacterium sp. Strain ATCC 31749 and Effect of Its Inactivation on Production of High-Molecular-Mass (1->3)-{beta}-D-Glucan (Curdlan) J. Bacteriol., August 1, 2002; 184(15): 4114 - 4123. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) An addition or correction has been published All Versions of this Article: 275/25/18919    most recent M000844200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sohlenkamp, C. Articles by Geiger, O. Search for Related Content PubMed PubMed Citation Articles by Sohlenkamp, C. Articles by Geiger, O. Social Bookmarking                      What's this?