|
Originally published In Press as doi:10.1074/jbc.M001371200 on April 13, 2000
J. Biol. Chem., Vol. 275, Issue 25, 19210-19217, June 23, 2000
The Gag-like Protein of the Yeast Ty1 Retrotransposon
Contains a Nucleic Acid Chaperone Domain Analogous to Retroviral
Nucleocapsid Proteins*
Gaël
Cristofari ,
Damien
Ficheux§, and
Jean-Luc
Darlix ¶
From the LaboRetro, Unité de Virologie Humaine,
INSERM (412), Ecole Normale Supérieure de Lyon, 46 Allée d'Italie, 69364 Lyon Cedex 07, France and the
§ Institut de Biologie et Chimie des Protéines, 7 Passage du Vercors, 69367 Lyon, France
Received for publication, February 18, 2000, and in revised form, April 11, 2000
 |
ABSTRACT |
The reverse transcription process for
retroviruses and retrotransposons takes place in a nucleocore structure
in the virus or virus-like particle. In retroviruses the major protein
of the nucleocore is the nucleocapsid protein (NC protein), which
derives from the C-terminal region of GAG. Retroviral NC proteins are formed of either one or two CCHC zinc finger(s) flanked by basic residues and have nucleic acid chaperone and match-maker properties essential for virus replication. Interestingly, the GAG protein of a
number of retroelements including Spumaviruses does not possess the
hallmarks of retroviral GAGs and in particular lacks a canonical NC
protein. In an attempt to search for a nucleic acid chaperone activity
in this class of retroelements we used the yeast Ty1 retrotransposon as
a model system. Results shows that the C-terminal region of Ty1 GAG
contains a nucleic acid chaperone domain capable of promoting the
annealing of primer tRNAiMet to
the multipartite primer binding site, Ty1 RNA dimerization and
initiation of reverse transcription. Moreover Ty1 RNA dimerization, in
a manner similar to Ty3 but unlike retroviral RNAs, appears to be
mediated by tRNAiMet. These findings
suggest that nucleic acid chaperone proteins probably are general
co-factors for reverse transcriptases.
 |
INTRODUCTION |
Retroelements form a large family of mobile genetic elements,
including retroviruses, retrotransposons (or
LTR1 retrotransposon for long
terminal repeats containing retrotransposon) and retroposons (or
non-LTR retrotransposon). Despite their tremendous diversity and
dispersity among living organisms, their replicative cycle shares
several similarities. They all encode a reverse transcriptase (RT) that
converts the genomic RNA into a double-stranded DNA subsequently
integrated into the cellular genome by integrase or endonuclease (1).
Retroelements efficiently spread within eukaryotic organisms and have a
major evolutive impact on the genomes that they inhabit. As repeated
sequences they represent a high potential for homologous recombination
of the host genome and as elements with transcriptional activity, their
integration triggers both insertional mutagenesis and deregulation of
gene expression (2, 3). Furthermore by means of cellular RNAs recruitment and reverse transcription, retroelements have been involved
in pseudogene formation and exon shuffling in plants and mammals
(4-6), long term immunity against nonretroviral RNA viruses in mammals
(7), and intron loss in yeast (8, 9).
The reverse transcription process for retroviruses and probably most
LTR retrotransposons occurs in a nucleocore also called nucleocapsid.
This nucleoprotein structure is composed of the RNA genome and the
primer tRNA coated with nucleocapsid (NC) protein molecules and of the
RT and integrase enzymes. The NC protein has one or two highly
conserved
CX2CX4HX4C
zinc finger(s) flanked by basic residues with key functions in particle
formation and reverse transcription (10). The NC protein exerts major
roles in the replication of retroviruses that can be attributed to its nucleic acid chaperone and match-maker activities (10, 11). The NC
protein annealing and strand transfer activities are involved in
genomic RNA dimerization (12, 13), initiation of reverse transcription
(12, 14, 15), and both in minus DNA (16-20) and plus DNA (21, 22)
strand transfers required for the generation of the LTRs.
The yeast retrotransposon Ty1 is a LTR-retrotransposon with two
overlapping open reading frames TYA1 and TYB1.
TYA1 codes for a protein that can assemble into virus-like
particles (VLPs) and where reverse transcription occurs while
TYB1 codes for the protease, integrase, and RT enzymes
similar to those of retroviruses (23-27). Interestingly, the TYA1
protein appears to be functionally homologous to the retroviral GAG
polyproteins, although it does not have the canonical hallmarks. In
fact TYA1 protein has no zinc finger motif, no major homology region,
and is not processed into matrix, capsid, and NC by the protease (28).
Several LTR retrotransposons such as Gypsy, ZAM, 17.6, 297, tom, 412 (Drosophila melanogaster), TED (Autographa
californica), or Ta1 (Arabidopsis thaliana), and the
members of spumavirus family share these properties in common with Ty1
(29-32).
In view of the ubiquitous nature of the nucleic acid chaperone and
match-maker activities of the NC protein of retroviruses and of a
number of LTR retrotransposon, such as Ty3 (33), or retroposon, such as
I-Factor (34), we have studied Ty1 as a model system to look for a
nucleic acid chaperone in this class of noncanonical GAG proteins. In
the present report we show that a domain derived from the TYA1 protein
exhibits a nucleic acid chaperone activity promoting primer
tRNAiMet annealing to the multipartite
primer binding site (PBS) and dimerization of Ty1 RNA in
vitro.
 |
EXPERIMENTAL PROCEDURES |
Plasmid DNAs, RNAs, NC Proteins, and Enzymes--
The DNA
oligonucleotides used for PCR and plasmid constructions are listed as
follows from 5' to 3': 1) ggaattcctaatacgactcactataggagaacttctagtat (5'Ty1); 2) tacaagcttgggctgcagttaacattggtggtg (3'Ty1); 3)
acccaattctcatggggcggcgtgtgcttcggttacttc (5'Ty1-M2-PBS); 4)
agtgagctaacagctgatgaagcag (3'Ty1-oligo2-PBS); 5)
ggaattcctaatacgactcactatagcggcggtggcgcagtg (5'tRNAimetKC10'); 6)
cgggatcccctggggcggcggctcggtttcg (3'tRNAimetKC10'); 7)
cgggatccgaatcccaacaattatctcaacattcac (5'Ty1A-E2); 8)
cgggatccgatgcatttgaaacaaaag (5'Ty1A-D284); 9) gaagatcttgcaggtgtactgccattatattgc (3'Ty1A-A283); 10)
gaagatctgtgagccctggctgttttc (3'Ty1A-H401).
DNA encoding Ty1 5'-RNA under the T7 promoter was generated by PCR
using Ty1-H3 clone (GenBankTM accession number M18706), a
5'-oligonucleotide containing an EcoRI site, T7 promoter,
and 15 nucleotides of the 5'-end of Ty1 RNA (5'Ty1) and a
3'-oligonucleotide complementary to positions 563-578 of Ty1 RNA and
containing a PstI site (3'Ty1). The amplified DNA was cloned
into pSP64 (Promega) to obtain pTy1-CG73. Template DNA was linearized
at position 587 (HindIII) and 5'Ty1 RNA was generated
in vitro using T7 RNA polymerase (Riboprobe, Promega). Mutations in the PBS (see Fig. 6) were introduced using a method based
on two successive rounds of PCR (35) with oligonucleotides 5'Ty1,
3'Ty1-oligo2-PBS, 5'Ty1-M2-PBS, 3'Ty1, and the pTy1-CG73 as template.
The amplified DNA was cloned into pSP64 to obtain pTy1-Van5, and RNA
synthesis was performed as for Ty1 5'-RNA.
DNA encoding tRNAiMet derived from
plasmid pHG300 which contains the
tRNAiMet sequence under the T7 promoter.
pHG300 (36) was cut by HindIII, and BamHI and the
insert was subcloned into pSP65 (Promega) to obtain pCG90. Template DNA
was linearized at position 73 (BstNI), and
tRNAiMet was generated in
vitro using T7 RNA polymerase (RiboMax, Promega). Mutations in the
tRNAiMet (see Fig. 6) were introduced by
PCR using plasmid pCG90 as template, a 5'-oligonucleotide containing an
EcoRI site, the T7 promoter, the mutations in the
5'-acceptor stem, and the 11 first nucleotides of the
tRNAiMet (5'tRNAimet-KC10') and a
3'-oligonucleotide containing a BamHI site, the mutations in
the 3'-acceptor stem, and the last 11 nucleotides of the
tRNAiMet (3'tRNAimet-KC10'). The
amplified DNA was cloned into pSP64 to obtain pVan6 and RNA synthesis
was performed as for tRNAiMet
wild-type.
All RNAs were purified by spin-column chromatography (Pharmacia S-300
HR) and dissolved at 1 mg/ml in sterile water. For biotinylated RNA
synthesis the final concentration of rNTPs was 1 mM except for rUTP (0.8 mM), and 0.2 mM bio-16-UTP
(Sigma) was added. For [32P]UMP-labeled RNA synthesis,
the final concentration of rNTPs was 1 mM except for rUTP
(0.1 mM) and 10 µCi [ -32P]UTP (Amersham
Pharmacia Biotech) was added. tRNAiMet
was synthesized in vitro using T7 RNA polymerase, purified
by 8% PAGE in 7 M urea, recovered, and dissolved at 0.1 mg/ml in sterile water after ethanol precipitation. It was heated at
90 °C and cooled down progressively at room temperature in the
presence of 1 mM MgCl2 for proper folding. All
mutations were verified by DNA sequencing.
DNA encoding Gag protein and its derivatives were obtained by PCR
amplification using Ty1-H3 as template, a 5'-oligonucleotide containing
a BamHI site (5'Ty1A-E2 or 5'Ty1A-D284) and a
3'-oligonucleotide containing a BglII site (3'Ty1A-A283 or
3'Ty1A-H401). The amplified DNA was cloned into pQE-16 (Qiagen) and
then subcloned into the BamHI and HindIII sites
of pET-21a (Novagen), which allows expression by coupled in
vitro transcription-translation as described by the manufacturer
(TNT system, Promega).
Highly pure HIV-1 NCp7, MLV NCp10, Ty3 NCp9 (wild-type and mutant), and
Ty1 TYA1-D peptide were synthesized by the
Fmoc/o-pentafluorophenyl ester chemical method and purified
by high performance liquid chromatography as described previously (33,
37, 38). The sequence of the TYA1-D peptide derives from the Ty1-H3
clone (GenBankTM accession number M18706). All peptides
were at 1 mg/ml in 20 mM Tris acetate, pH 6.5, 30 mM NaCl, and 1.5 equivalents of ZnCl2. MLV-RT
was from Life Technologies, Inc.
RNA Affinity Precipitation--
Streptavidin magnetic beads were
coated with biotinylated Ty1 5'-RNA 30 min at room temperature in a
total volume of 300 µl in a buffer containing 20 mM
Tris·Cl, pH 7.0, 1 M NaCl, 0.1 mM MgCl2, 10 µM ZnCl2. After a wash,
beads were incubated 30 min at room temperature in a total volume of
300 µl of buffer containing 20 mM Tris·Cl, pH 7.0, 30 mM NaCl, 0.1 mM MgCl2, 10 µM ZnCl2 and 1 mg/ml bovine serum albumin. 5 µl of translation product were incubated with 100 µl of beads in a
final volume of 300 µl in a buffer containing 20 mM
Tris·Cl, pH 7.0, 100 mM NaCl, 0.1 mM MgCl2, 10 µM ZnCl2, 1.5 µg/ml
salmon sperm DNA, and 1 mg/ml bovine serum albumin. Repeated washes
were performed by increasing the concentration of NaCl from 0.03 to 1 M NaCl to minimize nonspecific interactions with proteins.
Beads were resuspended in sample buffer, heated 5 min at 90 °C, and
loaded on a 15% SDS-PAGE gel. The gel was fixed, dried, and autoradiographed.
Bandshift and Sedimentation--
32P-Labeled 5'Ty1
RNA was incubated in presence or absence of the TYA1-D peptide in 10 µl of 20 mM Tris·Cl, pH 7.0, 30 mM NaCl, 0.1 mM MgCl2, 10 µM
ZnCl2, 5 mM dithiothreitol, and 5 units of RNasin (Promega) for 10 min at 30 °C. Then, glycerol (5% final) was
added and samples eletrophoresed on a 4% PAGE in 50 mM
Tris borate, 1 mM EDTA, pH 8.3. After electrophoresis, the
gel was autoradiographed.
For sedimentation assay, the complexes were pelleted at 10,000 × g for 10 min at 4 °C. Pellet and supernatant were
separated, and radioactivity in each fraction was counted.
Nucleic Acid Annealing--
Assays with Tar(+) and
32P-labeled Tar( ) oligonucleotides were performed as
described previously (39) using 0.015 pmol of each oligonucleotide in
10 µl containing 20 mM Tris·Cl, pH 7.5, 30 mM NaCl, 0.2 mM MgCl2, 5 mM dithiothreitol, 0.01 mM ZnCl2. Reactions were stopped by the addition of 0.5% SDS, 5 mM
EDTA (final). Proteins were removed by proteinase K digestion (0.4 mg/ml) 10 min at 30 °C. Then, glycerol (5% final) was added and samples eletrophoresed on a 10% PAGE in 50 mM Tris borate,
1 mM EDTA, pH 8.3. After electrophoresis, the gel was autoradiographed.
Reactions with Ty1 RNA, in vitro synthesized
32P-labeled tRNA, and NC proteins were for 10 min at
30 °C in 10 µl containing 20 mM Tris·Cl, pH 7.5, 30 mM NaCl, 0.2 mM MgCl2, 5 mM dithiothreitol, 0.01 mM ZnCl2, 5 units of RNasin (Promega), 1.5 pmol of RNA, 3 pmol of in
vitro synthesized tRNA and NCp7, NCp10, NCp9, or TYA1-D, at the
indicated protein to nt molar ratios. Reactions were stopped by
SDS/EDTA (0.5%/5 mM final), treated with proteinase K (2 µg) for 10 min at room temperature, phenol-chloroform-extracted, and RNA analyzed by 1.3% agarose gel electrophoresis in 50 mM
Tris borate, pH 8.3, and visualized by ethidium bromide staining.
Thereafter, gels were fixed in 5% trichloroacetic acid, dried, and
subjected to autoradiography. A 0.16-1.77-kilobase RNA ladder was used
for size determination (Life Technologies, Inc.).
Reverse Transcription--
Reactions were performed as described
previously (40). After 10 min at 30 °C to allow nucleic acid
annealing in 10 µl (see above), the reaction volume was increased to
25 µl by adding 1 pmol of MLV-RT (Life Technologies, Inc.), dNTPs at
0.25 mM each, 60 mM NaCl, and 2.5 mM MgCl2. Incubation was for 1 h at
37 °C, after which the reaction was stopped and processed as for the analysis of tRNA annealing (see above). After phenol-chloroform extraction nucleic acids were ethanol-precipitated, recovered by
centrifugation, dissolved in 15 µl of formamide, denatured at
95 °C for 2 min, and 2-6 µl were analyzed by 8% PAGE in 7 M urea and 50 mM Tris borate, 1 mM
EDTA, pH 8.3. 5'-32P-Labeled X174 DNA HinfI
markers (Promega) were used for size determination (not shown). In the
case of self-primed reverse transcription, 32P-tRNA was not
used but dNTPs were at 0.25 mM each except for dCTP at 0.01 mM with 2 µCi of [32P]dCTP (Amersham
Pharmacia Biotech) per reaction.
 |
RESULTS |
The C-terminal Domain of p54TYA1 Directs RNA
Binding--
Reverse transcription of Ty1 RNA occurs in VLPs in which
Ty1 RNA is specifically packaged (23, 41). The major protein of Ty1
VLPs is the product of TYA1, which is expressed as a 58-kDa precursor and processed by cleavage at position 401 to remove a small
acidic C-terminal peptide to give rise to the p54TYA1 protein
(28). As already shown the p58TYA1 and p54TYA1 can bind
RNA and DNA (24). Computer analysis indicates that the C-terminal
domain of the p54TYA1 protein possesses three stretches of
basic amino acids, which could mediate nucleic acid binding
(cf. Fig. 1A). To
examine this possibility, we set up an assay with biotinylated Ty1
5'-RNA coupled to streptavidin-magnetic beads. p54TYA1 and
different deletion mutants (see Fig. 1B) were expressed by coupled in vitro transcription/translation in the rabbit
reticulocyte lysate system in the presence of
[35S]methionine (cf. Fig. 1C).
These 35S-labeled products were incubated with the
biotinylated RNA bound to the streptavidin beads. Proteins bound to RNA
were recovered by magnetic separation and analyzed by SDS-PAGE. As
shown in Fig. 1D, p54TYA1 (lane a) and
its C-terminal domain (lane c) were able to bind RNA
(lanes 4 and 6) and not to the beads alone
(lanes 1 and 3), while the C-truncated protein
(lane b) did not interact with RNA-coupled beads (lane
5) or with beads alone (lane 2).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 1.
Identification of the p54TYA1
RNA-binding domain. A, theoretical charge profiles
along the p58TYA1 protein shows three stretches of basic amino
acids in its C-terminal domain (gray background) suggesting
potential nucleic acid binding abilities. The isoelectric point
plotting has been calculated with the Zimmerman et al.
algorithm. B, a schematic representation of the
p54TYA1 derivatives used for RNA binding. The gray
boxes represent the basic stretches. C and
D, RNA affinity precipitation assays. The p54TYA1
derivatives were translated in vitro in the rabbit
reticulocyte lysate in presence of [35S]Met (C,
lanes 1-3). Complete products are indicated by a
star. The translation products were incubated with magnetic
beads coupled to streptavidin preincubated without (D,
lanes 1-3) or with biotinylated 5'Ty1 RNA (D,
lanes 4-6).
|
|
These results confirm that the p54TYA1 protein can interact
with RNA as described previously (24) and suggest that the C-terminal part of this protein is sufficient for RNA binding.
Binding of the C-terminal Domain of p54TYA1 to RNA
Generates High Molecular Weight Nucleoprotein Complexes--
To
further investigate the properties of the C-terminal domain of the
p54TYA1 protein, we synthesized by
Fmoc/o-pentafluorophenyl ester chemistry a 103-amino acids
peptide encompassing amino acids Asn299 to
His401 and named TYA1-D. The RNA binding ability of this
TYA1-D peptide was examined by bandshift assays.
32P-Labeled Ty1 5'-RNA was incubated with the TYA1-D
peptide at increasing protein to nt molar ratios, and complexes were
analyzed by PAGE in nondenaturing conditions. As a negative control we used a GST-cEngrailed2 fusion protein that belongs to the homeoprotein family known to bind to nucleic acids (42). At a protein to nt ratio of
1:20 to 1:10 virtually all the RNA molecules were present in high
molecular weight nucleoprotein complexes (see Fig.
2A, top of gel).
Since no intermediary complexes could be detected, the binding of the
TYA1-D peptide to Ty1 RNA probably takes place in a cooperative manner.
The TYA1-D peptide was found to bind to other RNAs and DNAs in a
similar manner (cf. Fig. 3 and
data not shown), suggesting that it has a strong affinity for nucleic
acids. We have also investigated the ability of the TYA1-D·RNA
complexes to be pelleted by centrifugation. As shown in Fig.
2B all the radiolabeled RNA was found in the pellet at a
1:12 protein:nt molar ratio. Taken together, these results indicate that the C-terminal domain of the Ty1 p54 protein can interact with
nucleic acids generating high molecular weight complexes.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 2.
Formation of sedimentable, high molecular
weight nucleoprotein complexes between the Ty1 RNA and the TYA1-D
peptide. Complexes were formed by incubating
32P-labeled Ty1 5'-RNA and increasing doses of the TYA1-D
peptide (lanes 7-14) or GST-engrailed fusion protein
(lanes 1-6) at 30 °C. A, the complexes were
resolved by PAGE in nondenaturing conditions, and the gel was
autoradiographed (A) or submitted to centrifugation and
radioactivity was counted (B). The protein to nt molar
ratios used in A are indicated at the top of the
lanes.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
The TYA1-D peptide stimulates the annealing
of complementary Tar DNA oligonucleotides. A, HIV-1
Tar(+) and labeled HIV-1 Tar( ) were incubated at 30 °C as
described under "Experimental Procedures" in the absence
(lanes 1-7) or in the presence (lanes 8-17) of
TYA1-D at a 1:5 peptide to nt molar ratio. The incubation time is
indicated above the gel. Proteins were subsequently removed from the
reaction mixture by proteinase K treatment and samples were resolved by
6% PAGE in nondenaturing conditions. After 10 min most of the Tar( )
is annealed to the Tar(+). B, quantification of the
annealing time course. The gel presented in A was quantified
by phosphorimaging. C, HIV-1 Tar(+) and labeled HIV-1
Tar( ) were incubated at 30 °C without (lanes 3 and 9)
or with increasing doses of NCp9 (lanes 4-8) or TYA1-D
peptide (lanes 10-14). As controls labeled Tar( ) alone
(lane 1) and heat-annealed Tar( ):Tar(+) (lane
2) are shown. Proteins were removed by phenol-chloroform
extraction and samples resolved by 6% PAGE in nondenaturing
conditions. D, quantification of the effect of TYA1-D or
NCp9 dose on annealing efficiency. Reactions have been performed in 10 µl with 15 fmol of each oligonucleotide.
|
|
The TYA1-D Peptide Exhibits Nucleic Acid Annealing
Activity--
Because the previous properties of TYA1-D peptide were
reminiscent of nucleic acid chaperone proteins, we have tested its effect on the annealing of two complementary single-strand DNA oligonucleotides. For this purpose we used a 32P-labeled
Tar( ) and a Tar(+) oligonucleotides derived from the HIV-1
5'-sequence as described previously (39). The annealing of Tar( ) to
Tar(+) is most probably prevented at 30 °C due to extensive
secondary structures (see Fig. 3C, lane 1, and
Fig. 3A, lanes 1-7, with Tar( ) structures
migrating as two different forms in the gel). Addition of the TYA1-D
peptide promoted a rapid annealing of the two complementary
oligonucleotides with most of the duplexes formed at 10 min and at a
peptide to nt molar ratio of 1:5 (cf. Fig. 3A,
lane 15, Fig. 3, B and C, lane 14). To
further characterize the annealing activity of the TYA1-D peptide, we
compared it to nucleocapsid protein NCp9 of the yeast retrotransposon Ty3. Interestingly the Ty3 NCp9 and Ty1 TYA1-D were found to behave similarly regarding TAR oligonucleotide annealing (see Fig. 3C, lanes 4-8 for NCp9 and lanes 10-14 for TYA1-D,
and Fig. 3D). In conclusion the TYA1-D peptide has strong nucleic acid
annealing activity.
The TYA1-D Peptide Promotes the Annealing of Primer
tRNAiMet onto Ty1 RNA--
The
next step was to study the TYA1-D annealing activity in a context
relevant to Ty1 replication. For this purpose, we have designed an
in vitro model system comprising the 5'-part of Ty1 genomic
RNA (5'Ty1 RNA) with its multipartite primer binding site (43, 44),
32P-labeled primer tRNAiMet
(45) and TYA1-D. As shown in Fig. 4,
TYA1-D allowed the annealing of primer
tRNAiMet to Ty1 RNA at a peptide:nt
ratio of 1:10 to 1:5 (cf. Fig. 4, A and
B). Furthermore the TYA1-D peptide promoted the dimerization of Ty1 RNA and tRNA at a similar protein to nt ratios (Fig.
4A, lanes 9-10, and Fig. 4B,
lanes 4 and 5). Interestingly RNA dimerization did not occur in the absence of primer tRNA (Fig. 4A,
lanes 1-5). These results indicate that the TYA1-D peptide
promotes the annealing of primer tRNA onto genomic RNA and Ty1 RNA
dimerization.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
The TYA1-D peptide directs the annealing of
primer tRNAiMet to the Ty1
multipartite PBS. Nucleoprotein complexes were formed in the
presence (lanes 6-10) or in the absence (lanes
1-5) of 32P-labeled primer
tRNAiMet with increasing doses of TYA1-D
as described under "Experimental Procedures." After complexes
formation proteins have been removed by phenol-chloroform extraction
and the RNAs resolved by agarose gel electrophoresis in native
conditions. A, ethidium bromide staining of nucleic acids.
B, autoradiography to visualize 32P-labeled
tRNA. A and B show the same gel. M and
D are monomeric and dimeric Ty1 5'-RNA or
tRNAiMet, respectively. The protein to
nucleotide molar ratios used are indicated at the top of the
gel.
|
|
To compare the chaperoning activity of the TYA1-D peptide with NC
proteins from different retroelements, we tested the ability of NCp10
of Moloney murine leukemia virus, NCp7 of the HIV-1, and NCp9 from the
yeast Ty3 retrotransposon or of its deletion mutant without the zinc
finger (NCp9 dd) to direct primer
tRNAiMet annealing and Ty1 RNA:tRNA
dimerization. Clearly NCp9 was as efficient as TYA1-D in promoting tRNA
annealing and Ty1 RNA:tRNA dimerization (cf. Fig.
5, compare lanes 1-4 with
lanes 13-16). The NCp9 dd mutant was less efficient, since
higher protein:nt ratios were required to obtain a high level of tRNA
annealing and dimerization (cf. Fig. 5, compare lanes
1-4 with lanes 17-20). On the other hand, NCp7 and
NCp10 were almost completely inactive in these processes (lanes
5-8 and lanes 9-12). This comparative study indicates
that all NC proteins are not equivalent in the Ty1 model system, since
only NCp9 from the Ty3 retrotransposon was as active as the TYA1-D
peptide in vitro despite the absence of sequence
homologies.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 5.
NCp9 of yeast retrotransposon Ty3, but not
HIV-1 NCp7 or MLV NCp10, can efficiently promote annealing of primer
tRNAiMet to the PBS of Ty1
RNA. Ty1 nucleoprotein complexes have been formed in the presence
of 32P-labeled primer
tRNAiMet with increasing doses of TYA1-D
(lanes 1-4) or MLV NCp10 (lanes 5-8), HIV-1
NCp7 (lanes 9-12), Ty3 NCp9 wild-type (lanes
13-16), or Ty3 NCp9 dd deleted of its zinc finger (lanes
13-16) as described under "Experimental Procedures." After
complexes formation proteins have been removed by phenol-chloroform
extraction and RNAs resolved by agarose gel electrophoresis in native
conditions. A, ethidium bromide staining of nucleic acids.
B, autoradiography to visualize 32P-labeled
tRNA. A and B show the same gel. M and
D are monomeric and dimeric Ty1 5'-RNA or
tRNAiMet, respectively. The protein to
nt molar ratios used are indicated at the top of the
gel.
|
|
Mutations in Primer tRNAiMet
or in the Multipartite PBS Impaired Ty1 RNA:tRNA Dimerization in Vitro
Induced by the TYA1-D Peptide--
As previously suggested for Ty3,
in vitro RNA:tRNA dimerization is probably mediated by the
5'-tRNA acceptor stem (from G2 to C13), which is palindromic (see Fig.
6C, wt panel). To
examine if this hypothesis also holds true for Ty1, mutations in primer tRNAiMet and compensatory mutations in
the PBS (cf. Fig. 6A for Ty1 RNA structure and
Fig. 6B for a description of mutations) have been performed.
It should be noted that the tRNAiMet
mutations were introduced in the 5'- and 3'-strands of the acceptor stem to maintain the stem structure. We selected these mutations made
in vivo, since the PBS or
tRNAiMet mutations alone abolished Ty1
transposition, while using both mutations partially restored
transposition (pKC10 and pKC66 constructed by Chapman et al.
(45)). The only differences between the in vitro and
in vivo mutations are at positions A1G/U72C of
tRNAiMet instead of A1U/U72A to allow
in vitro transcription by T7 RNA polymerase (46).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
Uncoupling of tRNA:Ty1 RNA dimerization
from tRNAiMet annealing
to the PBS. A shows the multipartite primer binding site of
Ty1 RNA and the primer tRNAiMet. The Ty1
RNA and the primer tRNA can form a duplex, which primes synthesis of
minus strong-stop cDNA. According to Friant et al. (44),
duplex formation occurs through extended interactions between the
primer tRNAiMet and the genomic RNA.
Beside the classical interaction between the 3'-acceptor stem of tRNA
and PBS, the tRNA interacts with three short boxes (boxes 0,
1, and 2.1) in the genomic Ty1 RNA. B,
mutations introduced into the Ty1 PBS and
tRNAiMet. Each mutation in the
3'-acceptor stem of tRNAiMet has been
compensated by a mutation in the 5'-acceptor stem to maintain the tRNA
structure. Both wild-type and mutant tRNAs have been modified at
position 1 by introducing a G to allow efficient in vitro
transcription by T7 RNA polymerase. C, effect of the
mutations introduced in the 3'-acceptor stem of
tRNAiMet on the putative palindromic
tRNA:tRNA interaction. D, mutations in the 5'-end of
tRNAiMet acceptor stem alters Ty1
tRNA:RNA dimerization but not tRNA annealing to the PBS. Nucleoprotein
complexes were formed using either wt (lanes 1-6) or mutant
(lanes 7-12) Ty1 5'-RNA in the presence of wild-type
(lanes 1-3 and 7-9) or mutant (lanes
4-6 and 10-12) 32P-labeled primer
tRNAiMet with increasing doses of the
TYA1-D peptide as described under "Experimental Procedures."
Nucleoprotein complexes were processed as described previously. The gel
has been autoradiographed to visualize 32P-labeled tRNA.
M and D are monomeric and dimeric Ty1 5'-RNA or
tRNAiMet, respectively. The protein to
nt molar ratios are indicated at the top of the gel.
|
|
As shown in Fig. 6D, mutations in
tRNAiMet or the multipartite PBS
drastically decreased tRNA annealing to Ty1 RNA (compare lanes 4-6 or lanes 7-9 with lanes
1-3) and completely inhibited dimerization induced by the TYA1-D
peptide. When compensatory mutations in tRNA and Ty1 RNA were used
(lanes 10-12), tRNA annealing was restored but not RNA
dimerization. Interestingly the mutant
tRNAiMet could not form homodimers
unlike wild-type tRNAiMet (see Fig.
6D, lanes 11 and 12). These results
indicate that Ty1 RNA dimerization probably occurs via a tRNA:tRNA
hybridization process.
Thus each strand of the tRNAiMet
acceptor stem appears to achieve distinct functions, since the
3'-strand allows priming of reverse transcription once hybridized to
the PBS while the 5'-strand promotes RNA:tRNA dimerization
(cf. Fig. 6, B and C).
The TYA1-D Peptide Can Direct Specific Initiation of Reverse
Transcription--
As observed above (see Figs. 4-6), the TYA1-D
peptide supports annealing of replication primer to the Ty1 RNA
template within a nucleoprotein complex. This prompted us to examine
wether this complex was competent for the initiation of Ty1 RNA reverse
transcription. To this end RT and dNTPs were added to preformed
complexes composed of Ty1 RNA, 32P-labeled
tRNAiMet and TYA1-D. With or without
prior annealing of primer
32P-tRNAiMet, minus
strong-stop cDNA (minus ss-cDNA) could only be detected after
overexposure (cf. Fig.
7A, lanes 1 and
2). The addition of TYA1-D peptide resulted in ss-cDNA
synthesis (lanes 4 and 5), indicating that the
nucleoprotein complexes were functional. In presence of an excess of
the TYA1-D peptide (at a peptide:nt ratio of 1:5), ss-cDNA
synthesis was inhibited (lane 6) as described previously for
retroviral NC proteins (20, 47, 48). The fact that heat annealing does
not allow efficient initiation of minus ss-cDNA as does the TYA1-D
peptide suggests that the tRNA-template initiation complex formed in
the two conditions may be different regarding recruitment of the RT
enzyme and thus the transition from initiation to elongation as shown
for HIV-1 (15, 47).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7.
The TYA1-D peptide promotes specific
initiation of reverse transcription in vitro.
A, minus strand strong-stop cDNA synthesis. Ty1 5'-RNA
and 32P-labeled primer
tRNAiMet were incubated without
(lanes 1 and 2) or with increasing doses of
TYA1-D (lanes 3-6). As a control annealing of primer
tRNAiMet has also been performed by heat
(20 min at 70 °C, lane 2). dNTPs with
[32P]dCTP and MLV-RT were added to the complexes to allow
cDNA synthesis (1 h at 30 °C). cDNA products were resolved
by 8% PAGE in denaturing conditions, and the gel was autoradiographed.
The horizontal black arrow shows ss-cDNA of 91 nt
covalently linked to tRNA (72 nt). It should be noted that a faint band
could be seen lanes 2 and 3 after overexposure.
B, inhibition of self-priming. Conditions were the same
except that primer tRNA was absent and that dNTPs added to perform
reverse transcription contained [32P]dCTP. For both panel
the vertical black arrow indicates the direction of
electrophoresis. 5'-32P-Labeled X174 HinfI
DNA markers (Promega) were used for size determination (not shown). The
protein to nt molar ratios are indicated at the top of the gel.
|
|
To further investigate the role of the TYA1-D peptide in the
specificity of reverse transcription initiation, we examined wether it
could inhibit nonspecific cDNA synthesis (cf. Fig.
7B). Such initiation events can arise by intramolecular
interactions or folding back of the template and have been called
self-priming (20, 47). Incubating Ty1 5'-RNA template with RT and dNTPs (including [32P]dCTP) resulted in the synthesis of a
large number of cDNA products (see Fig. 7B, lane
1). However, addition of increasing amounts of the TYA1-D peptide
caused a strong inhibition of self-priming (lanes 2-5) as
observed before with retroviral NC proteins (20, 47, 48).
Thus, the TYA1-D peptide directs specific initiation of reverse
transcription by tRNA annealing to the PBS of Ty1 RNA while inhibiting
self-primed cDNA synthesis.
 |
DISCUSSION |
Ty1, a yeast LTR retrotransposon distantly related to
oncoretroviruses and lentiviruses, encodes a major protein TYA1,
considered to be equivalent to retroviral GAG, although it lacks most
of the hallmarks of GAG. We have investigated the nucleic acid binding properties of the p54TYA1 protein and mapped the nucleic
acid-binding domain within the C-terminal region of p54TYA1
(Fig. 1). In an attempt to extensively characterize the properties of
this domain, it was synthesized in vitro as a highly pure
103-amino acid peptide, designated TYA1-D. This TYA1-D peptide binds
both RNA and DNA in vitro and forms high molecular weight
nucleoprotein complexes (Fig. 2).
Also the TYA1-D peptide was found to promote the annealing of
complementary DNA oligonucleotides in a manner very similar to NCp9 of
the yeast retrotransposon Ty3 and of retroviral NC proteins (Fig. 3),
raising the possibility that the TYA1-D peptide has nucleic acid
chaperone and match-maker activities similar to previously
characterized NC zinc finger proteins (10, 33, 34). Using an in
vitro reconstituted Ty1 replication system, the TYA1-D peptide was
able to direct the hybridization of primer tRNAiMet to the multipartite PBS of Ty1
RNA, allowing elongation of tRNAiMet by
RT (Figs. 4 and 7). Furthermore due to its nucleic acid chaperone and
match-maker activities, the TYA1-D domain is expected to direct the DNA
strand transfers during Ty1 reverse transcription as shown for
retroviral NC proteins (16-22), and this is presently under investigation. Both the TYA1-D peptide and Ty3 NCp9 appeared to be
efficient in primer annealing to the PBS and in the formation of Ty1
RNA:tRNAiMet dimers, while HIV-1 NCp7
was poorly active and MLV NCp10 inactive. The common use of replication
primer tRNAiMet in Ty1 and Ty3 (45, 49),
the nature of their multipartite PBS, and the extended
tRNAiMet-PBS interactions (33, 44) might
explain the differences seen between Ty1 TYA1-D peptide and Ty3 NCp9,
and the retroviral NC proteins. In agreement with this, HIV-1 primer
tRNALys3 probably also interacts with genomic sequences
flanking the PBS (50), but to a lesser extent than in Ty1 and Ty3. The
nucleic acid binding and chaperoning activities of the TYA1-D peptide suggest that the C-terminal domain of p54TYA1 probably is a
major factor driving genomic RNA and
tRNAiMet packaging required for the
formation of functional Ty1 VLPs. In agreement with this notion,
binding of tRNAiMet to the multipartite
PBS appears to mediate its recruitment into VLPs (51). Biochemical data
presented in Fig. 4 are the first direct evidences indicating that Ty1
RNA can exist in a dimer form. According to genetic data (52)
intermolecular DNA strand transfers take place in the course of Ty1
replication in agreement with Ty1 RNA dimers. The observation that Ty1
RNA dimerization only occurs in presence of
tRNAiMet leads us to propose a model
where two genomic RNAs are linked via two
tRNAiMet molecules (see Fig.
8). Dimerization of
tRNAiMet would be mediated by 5'-5'
interactions involving a 12-nucleotide palindrome (position 2-13,
GCGCCGUGGCGC, see Fig. 6C). In support of this dimerization
model, mutations in the 5'-tRNA palindrome impaired dimerization (Fig.
6D). Interestingly, Chapman et al. (45) found
that these tRNA mutations (cf. Fig. 6C) inhibited retrotransposition, probably by interfering with
tRNAiMet annealing to the PBS and
reverse transcription. However, mutating the PBS to insert compensatory
mutations did not restore a wild-type level of retrotransposition, but
only 15% of it. In the light of our in vitro data, it is
tempting to speculate that this might be due to the low level of Ty1
RNA:tRNA dimerization.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 8.
A model for Ty1 RNA dimerization.
A, Ty1 RNA dimerization. B, Ty3 RNA dimerization
(33). The black arrows indicate the start of reverse
transcription (minus strand ss-cDNA synthesis). Note the
multipartite PBS in both Ty1 and Ty3.
|
|
In many aspects Ty1 is much different from other retrotransposons like
Ty3 or retroviruses, for example in respect to the structure and
maturation of its GAG precursor, called TYA1. In fact, Ty1 does not
contain a retroviral
(CX2CX4HX4C)
zinc finger motif, the major homology region, and is not processed into
mature matrix, capsid, and NC proteins. The sole maturation event
occurs by cleavage of p58 resulting in the release of p54. The cleavage product, a very acidic peptide of 40 amino acids, cannot be detected and is probably degraded (28). It is likely that the TYA1-D peptide
will exhibit nucleic acid chaperone and match-maker activities in the
context of the full-length p54TYA1 protein. As already shown
for other nucleic acid chaperone proteins like hnRNP C1/C2, the
chaperone activity was found in both the full-length protein and in the
RNA-binding domain alone (53). Furthermore in HIV-1, the nucleic acid
chaperone activity was found in the mature NCp7, in the precursor NCp15
(13) and in the Gag polyprotein (54). Thus p54TYA1 might be a
multidomain protein with several associated functions rather than a
polyprotein-like in retroviruses. The mapping of a minimal nucleic acid
chaperone domain in TYA1-D is under way. A number of retroelements such
as Gypsy, ZAM, 17.6, 297, tom, 412, TED, or Ta1 and the Spumaviruses
share these properties in common with Ty1, since they all possess a
domain with stretches of basic amino acids with possible nucleic acid
chaperone properties (29-32).
Due to the general property of single-stranded nucleic acids to fold
into and to be kinetically trapped in several conformations (55),
reverse transcriptases might be especially sensible to the existence of
nonfunctional initiation complexes. Based on our datas and previous
reports on retroviruses (10), Ty3, another yeast very distant LTR
retrotransposon (33, 38) and I factor, a long interspersed nuclear
element-like element in Drosophila (34), we propose that RT
activity, whatever the reverse transcription mechanism, should be
associated with a nucleic acid chaperone protein that acts in setting
up functional and specific initiation complexes. This would be achieved
through two complementary mechanisms: first by annealing the primer to
the template and second by inhibiting nonspecific priming events. In
agreement with this notion, it has recently been reported (56) that
hnRNP A1, a nucleic acid-binding protein known to exhibit a strong
chaperoning activity (53), probably interacts with telomeric repeats so
as to stimulate telomere elongation by telomerase, distantly related to
RTs (57). Thus functional interactions between RTs and a nucleic acid
chaperone protein might be a general feature of genome maintenance in
retroelements and their cellular hosts.
 |
ACKNOWLEDGEMENTS |
C. Gabus is acknowledged for expert technical
assistance. We thank T. Heyman for the gift of the Ty1-H3 clone and A. Maizel for the gift of the GST-cEN2 protein. Thanks are due to ANRS
and MGEN for support.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed. E-mail:
Jean-Luc.Darlix@ens-lyon.fr.
Published, JBC Papers in Press, April 13, 2000, DOI 10.1074/jbc.M001371200
 |
ABBREVIATIONS |
The abbreviations used are:
LTR, long terminal
repeat;
RT, reverse transcriptase;
NC, nucleocapsid;
VLP, virus-like
particle;
PBS, primer binding site;
PCR, polymerase chain reaction;
PAGE, polyacrylamide gel electrophoresis;
HIV-1, human immunodeficiency
virus, type 1;
Fmoc, N-(9-fluorenyl)methoxycarbonyl;
MLV, murine leukemia virus;
nt, nucleotide(s);
ss-cDNA, strong-stop
cDNA.
 |
REFERENCES |
| 1.
|
Boeke, J. D.,
and Stoye, J. P.
(1997)
in
Retroviruses
(Cofin, J. M.
, Hughes, S. H.
, and Varmus, H. E., eds)
, pp. 343-435, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 2.
|
Kazazian, H. H., Jr.,
and Moran, J. V.
(1998)
Nat. Genet.
19,
19-24
|
| 3.
|
Wessler, S. R.,
Bureau, T. E.,
and White, S. E.
(1995)
Curr. Opin. Genet. Dev.
5,
814-821
|
| 4.
|
Flavell, A. J.,
Pearce, S. R.,
and Kumar, A.
(1994)
Curr. Opin. Genet. Dev.
4,
838-844
|
| 5.
|
Moran, J. V.,
DeBerardinis, R. J.,
and Kazazian, H. H., Jr.
(1999)
Science
283,
1530-1534
|
| 6.
|
Esnault, C.,
Maestre, J.,
and Heidmann, T.
(2000)
Nat. Genet.
24,
363-367
|
| 7.
|
Klenerman, P.,
Hengartner, H.,
and Zinkernagel, R. M.
(1997)
Nature
390,
298-301
|
| 8.
|
Derr, L. K.,
Strathern, J. N.,
and Garfinkel, D. J.
(1991)
Cell
67,
355-364
|
| 9.
|
Fink, G. R.
(1987)
Cell
49,
5-6
|
| 10.
|
Darlix, J. L.,
Lapadat-Tapolsky, M.,
de Rocquigny, H.,
and Roques, B. P.
(1995)
J. Mol. Biol.
254,
523-537
|
| 11.
|
Rein, A.,
Henderson, L. E.,
and Levin, J. G.
(1998)
Trends Biochem. Sci.
23,
297-301
|
| 12.
|
Prats, A. C.,
Sarih, L.,
Gabus, C.,
Litvak, S.,
Keith, G.,
and Darlix, J. L.
(1988)
EMBO J.
7,
1777-1783
|
| 13.
|
Darlix, J. L.,
Gabus, C.,
Nugeyre, M. T.,
Clavel, F.,
and Barre-Sinoussi, F.
(1990)
J. Mol. Biol.
216,
689-699
|
| 14.
|
Barat, C.,
Lullien, V.,
Schatz, O.,
Keith, G.,
Nugeyre, M. T.,
Gruninger-Leitch, F.,
Barre-Sinoussi, F.,
LeGrice, S. F.,
and Darlix, J. L.
(1989)
EMBO J.
8,
3279-3285
|
| 15.
|
Rong, L.,
Liang, C.,
Hsu, M.,
Kleiman, L.,
Petitjean, P.,
de Rocquigny, H.,
Roques, B. P.,
and Wainberg, M. A.
(1998)
J. Virol.
72,
9353-9358
|
| 16.
|
Darlix, J. L.,
Vincent, A.,
Gabus, C.,
de Rocquigny, H.,
and Roques, B.
(1993)
C. R. Acad. Sci. III (Paris)
316,
763-771
|
| 17.
|
Allain, B.,
Lapadat-Tapolsky, M.,
Berlioz, C.,
and Darlix, J. L.
(1994)
EMBO J.
13,
973-981
|
| 18.
|
Peliska, J. A.,
Balasubramanian, S.,
Giedroc, D. P.,
and Benkovic, S. J.
(1994)
Biochemistry
33,
13817-13823
|
| 19.
|
Kim, J. K.,
Palaniappan, C.,
Wu, W.,
Fay, P. J.,
and Bambara, R. A.
(1997)
J. Biol. Chem.
272,
16769-16777
|
| 20.
|
Guo, J.,
Henderson, L. E.,
Bess, J.,
Kane, B.,
and Levin, J. G.
(1997)
J. Virol.
71,
5178-5188
|
| 21.
|
Auxilien, S.,
Keith, G.,
Le Grice, S. F.,
and Darlix, J. L.
(1999)
J. Biol. Chem.
274,
4412-4420
|
| 22.
|
Wu, T.,
Guo, J.,
Bess, J.,
Henderson, L. E.,
and Levin, J. G.
(1999)
J. Virol.
73,
4794-4805
|
| 23.
|
Mellor, J.,
Malim, M. H.,
Gull, K.,
Tuite, M. F.,
McCready, S.,
Dibbayawan, T.,
Kingsman, S. M.,
and Kingsman, A. J.
(1985)
Nature
318,
583-586
|
| 24.
|
Mellor, J.,
Fulton, A. M.,
Dobson, M. J.,
Roberts, N. A.,
Wilson, W.,
Kingsman, A. J.,
and Kingsman, S. M.
(1985)
Nucleic Acids Res.
13,
6249-6263
|
| 25.
|
Mellor, J.,
Fulton, S. M.,
Dobson, M. J.,
Wilson, W.,
Kingsman, S. M.,
and Kingsman, A. J.
(1985)
Nature
313,
243-246
|
| 26.
|
Eichinger, D. J.,
and Boeke, J. D.
(1988)
Cell
54,
955-966
|
| 27.
|
Youngren, S. D.,
Boeke, J. D.,
Sanders, N. J.,
and Garfinkel, D. J.
(1988)
Mol. Cell. Biol.
8,
1421-1431
|
| 28.
|
Merkulov, G. V.,
Swiderek, K. M.,
Brachmann, C. B.,
and Boeke, J. D.
(1996)
J. Virol.
70,
5548-5556
|
| 29.
|
Sandmeyer, S. B.,
and Menees, T. M.
(1996)
Curr. Top. Microbiol. Immunol.
214,
261-296
|
| 30.
|
Yu, S. F.,
Edelmann, K.,
Strong, R. K.,
Moebes, A.,
Rethwilm, A.,
and Linial, M. L.
(1996)
J. Virol.
70,
8255-8262
|
| 31.
|
Enssle, J.,
Fischer, N.,
Moebes, A.,
Mauer, B.,
Smola, U.,
and Rethwilm, A.
(1997)
J. Virol.
71,
7312-7317
|
| 32.
|
Hajek, K. L.,
and Friesen, P. D.
(1998)
J. Virol.
72,
8718-8724
|
| 33.
|
Gabus, C.,
Ficheux, D.,
Rau, M.,
Keith, G.,
Sandmeyer, S.,
and Darlix, J. L.
(1998)
EMBO J.
17,
4873-4880
|
| 34.
|
Dawson, A.,
Hartswood, E.,
Paterson, T.,
and Finnegan, D. J.
(1997)
EMBO J.
16,
4448-4455
|
| 35.
|
Mikaelian, I.,
and Sergeant, A.
(1992)
Nucleic Acids Res.
20,
376
|
| 36.
|
Senger, B.,
Despons, L.,
Walter, P.,
and Fasiolo, F.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10768-10771
|
| 37.
|
De Rocquigny, H.,
Gabus, C.,
Vincent, A.,
Fournie-Zaluski, M. C.,
Roques, B.,
and Darlix, J. L.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
6472-6476
|
| 38.
|
Cristofari, G.,
Gabus, C.,
Ficheux, D.,
Bona, M.,
Le Grice, S. F.,
and Darlix, J. L.
(1999)
J. Biol. Chem.
274,
36643-36648
|
| 39.
|
Lapadat-Tapolsky, M.,
Pernelle, C.,
Borie, C.,
and Darlix, J. L.
(1995)
Nucleic Acids Res.
23,
2434-2441
|
| 40.
|
Tanchou, V.,
Gabus, C.,
Rogemond, V.,
and Darlix, J. L.
(1995)
J. Mol. Biol.
252,
563-571
|
| 41.
|
Garfinkel, D. J.,
Boeke, J. D.,
and Fink, G. R.
(1985)
Cell
42,
507-517
|
| 42.
|
Kissinger, C. R.,
Liu, B. S.,
Martin-Blanco, E.,
Kornberg, T. B.,
and Pabo, C. O.
(1990)
Cell
63,
579-590
|
| 43.
|
Friant, S.,
Heyman, T.,
Wilhelm, M. L.,
and Wilhelm, F. X.
(1996)
Nucleic Acids Res.
24,
441-449
|
| 44.
|
Friant, S.,
Heyman, T.,
Bystrom, A. S.,
Wilhelm, M.,
and Wilhelm, F. X.
(1998)
Mol. Cell. Biol.
18,
799-806
|
| 45.
|
Chapman, K. B.,
Bystrom, A. S.,
and Boeke, J. D.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
3236-3240
|
| 46.
|
Milligan, J. F.,
Groebe, D. R.,
Witherell, G. W.,
and Uhlenbeck, O. C.
(1987)
Nucleic Acids Res.
15,
8783-8798
|
| 47.
|
Lapadat-Tapolsky, M.,
Gabus, C.,
Rau, M.,
and Darlix, J. L.
(1997)
J. Mol. Biol.
268,
250-260
|
| 48.
|
Rascle, J. B.,
Ficheux, D.,
and Darlix, J. L.
(1998)
J. Mol. Biol.
280,
215-225
|
| 49.
|
Keeney, J. B.,
Chapman, K. B.,
Lauermann, V.,
Voytas, D. F.,
Astrom, S. U.,
von Pawel-Rammingen, U.,
Bystrom, A.,
and Boeke, J. D.
(1995)
Mol. Cell. Biol.
15,
217-226
|
| 50.
|
Wakefield, J. K.,
Kang, S. M.,
and Morrow, C. D.
(1996)
J. Virol.
70,
966-975
|
| 51.
|
Wilhelm, M.,
Wilhelm, F. X.,
Keith, G.,
Agoutin, B.,
and Heyman, T.
(1994)
Nucleic Acids Res.
22,
4560-4565
|
| 52.
|
Wilhelm, M.,
Boutabout, M.,
Heyman, T.,
and Wilhelm, F. X.
(1999)
J. Mol. Biol.
288,
505-510
|
| 53.
|
Portman, D. S.,
and Dreyfuss, G.
(1994)
EMBO J.
13,
213-221
|
| 54.
|
Feng, Y. X.,
Campbell, S.,
Harvin, D.,
Ehresmann, B.,
Ehresmann, C.,
and Rein, A.
(1999)
J. Virol.
73,
4251-4256
|
| 55.
|
Herschlag, D.
(1995)
J. Biol. Chem.
270,
20871-20874
|
| 56.
|
LaBranche, H.,
Dupuis, S.,
Ben-David, Y.,
Bani, M. R.,
Wellinger, R. J.,
and Chabot, B.
(1998)
Nat. Genet.
19,
199-202
|
| 57.
|
Nakamura, T. M.,
and Cech, T. R.
(1998)
Cell
92,
587-590
|
| 58.
|
Zimmerman, J. M.,
Eliezer, N.,
and Simha, R.
(1968)
J. Theor. Biol.
21,
170-201
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
E. D. Pratico and S. K. Silverman
Ty1 reverse transcriptase does not read through the proposed 2',5'-branched retrotransposition intermediate in vitro
RNA,
September 1, 2007;
13(9):
1528 - 1536.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gabus, R. Ivanyi-Nagy, J. Depollier, A. Bucheton, A. Pelisson, and J.-L. Darlix
Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy
Nucleic Acids Res.,
November 6, 2006;
34(20):
5764 - 5777.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. R. Cullen
Role and Mechanism of Action of the APOBEC3 Family of Antiretroviral Resistance Factors
J. Virol.,
February 1, 2006;
80(3):
1067 - 1076.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Heras, M. C. Lopez, J. L. Garcia-Perez, S. L. Martin, and M. C. Thomas
The L1Tc C-Terminal Domain from Trypanosoma cruzi Non-Long Terminal Repeat Retrotransposon Codes for a Protein That Bears Two C2H2 Zinc Finger Motifs and Is Endowed with Nucleic Acid Chaperone Activity
Mol. Cell. Biol.,
November 1, 2005;
25(21):
9209 - 9220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Cristofari, R. Ivanyi-Nagy, C. Gabus, S. Boulant, J.-P. Lavergne, F. Penin, and J.-L. Darlix
The hepatitis C virus Core protein is a potent nucleic acid chaperone that directs dimerization of the viral (+) strand RNA in vitro
Nucleic Acids Res.,
May 11, 2004;
32(8):
2623 - 2631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Matsumoto, H. Takahashi, and H. Fujiwara
Targeted Nuclear Import of Open Reading Frame 1 Protein Is Required for In Vivo Retrotransposition of a Telomere-Specific Non-Long Terminal Repeat Retrotransposon, SART1
Mol. Cell. Biol.,
January 1, 2004;
24(1):
105 - 122.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F.-X. Wilhelm, M. Wilhelm, and A. Gabriel
Extension and Cleavage of the Polypurine Tract Plus-strand Primer by Ty1 Reverse Transcriptase
J. Biol. Chem.,
November 28, 2003;
278(48):
47678 - 47684.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Copeland, P. J. Brindley, O. Heyers, S. F. Michael, D. A. Johnston, D. L. Williams, A. C. Ivens, and B. H. Kalinna
Boudicca, a Retrovirus-Like Long Terminal Repeat Retrotransposon from the Genome of the Human Blood Fluke Schistosoma mansoni
J. Virol.,
June 1, 2003;
77(11):
6153 - 6166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D. Peterson-Burch and D. F. Voytas
Genes of the Pseudoviridae (Ty1/copia Retrotransposons)
Mol. Biol. Evol.,
November 1, 2002;
19(11):
1832 - 1845.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Lawler Jr., D. P. Haeusser, A. Dull, J. D. Boeke, and J. B. Keeney
Ty1 Defect in Proteolysis at High Temperature
J. Virol.,
March 27, 2002;
76(9):
4233 - 4240.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kameoka, M. Morgan, M. Binette, R. S. Russell, L. Rong, X. Guo, A. Mouland, L. Kleiman, C. Liang, and M. A. Wainberg
The Tat Protein of Human Immunodeficiency Virus Type 1 (HIV-1) Can Promote Placement of tRNA Primer onto Viral RNA and Suppress Later DNA Polymerization in HIV-1 Reverse Transcription
J. Virol.,
March 19, 2002;
76(8):
3637 - 3645.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Gao, D. J. Rowley, X. Gai, and D. F. Voytas
Ty5 gag Mutations Increase Retrotransposition and Suggest a Role for Hydrogen Bonding in the Function of the Nucleocapsid Zinc Finger
J. Virol.,
March 7, 2002;
76(7):
3240 - 3247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. F. Lawler Jr., G. V. Merkulov, and J. D. Boeke
A Nucleocapsid Functionality Contained within the Amino Terminus of the Ty1 Protease That Is Distinct and Separable from Proteolytic Activity
J. Virol.,
January 1, 2002;
76(1):
346 - 354.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Martin and F. D. Bushman
Nucleic Acid Chaperone Activity of the ORF1 Protein from the Mouse LINE-1 Retrotransposon
Mol. Cell. Biol.,
January 15, 2001;
21(2):
467 - 475.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Y.-X. Feng, S. P. Moore, D. J. Garfinkel, and A. Rein
The Genomic RNA in Ty1 Virus-Like Particles Is Dimeric
J. Virol.,
November 15, 2000;
74(22):
10819 - 10821.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
F. Jossinet, J. S. Lodmell, C. Ehresmann, B. Ehresmann, and R. Marquet
Identification of the in Vitro HIV-2/SIV RNA Dimerization Site Reveals Striking Differences with HIV-1
J. Biol. Chem.,
February 16, 2001;
276(8):
5598 - 5604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Gabus, E. Derrington, P. Leblanc, J. Chnaiderman, D. Dormont, W. Swietnicki, M. Morillas, W. K. Surewicz, D. Marc, P. Nandi, et al.
The Prion Protein Has RNA Binding and Chaperoning Properties Characteristic of Nucleocapsid Protein NCp7 of HIV-1
J. Biol. Chem.,
May 25, 2001;
276(22):
19301 - 19309.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|