HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 26, 19667-19675, June 30, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/26/19667    most recent M000492200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Budd, D. C. Articles by Tobin, A. B. Search for Related Content PubMed PubMed Citation Articles by Budd, D. C. Articles by Tobin, A. B. Social Bookmarking                      What's this?

Phosphorylation and Regulation of a G_q/11-coupled Receptor by Casein Kinase 1^*

David C. Budd, John E. McDonald, and Andrew B. Tobin

From the Department of Cell Physiology and Pharmacology, University of Leicester, P. O. Box 138, Medical Sciences Building, University Road, Leicester LE1 9HN, United Kingdom

Received for publication, January 19, 2000, and in revised form, April 12, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Agonist-mediated receptor phosphorylation by one or more of the members of the G-protein receptor kinase (GRK) family is an established model for G-protein-coupled receptor (GPCR) phosphorylation resulting in receptor desensitization. Our recent studies have, however, suggested that an alternative route to GPCR phosphorylation may be an operation involving casein kinase 1 (CK1). In the current study we investigate the involvement of CK1 in the phosphorylation of the human m3-muscarinic receptor in intact cells. We show that expression of a catalytically inactive mutant of CK1, designed to act in a dominant negative manner, inhibits agonist-mediated receptor phosphorylation by ~40% in COS-7 and HEK-293 cells. Furthermore, we present evidence that a peptide corresponding to the third intracellular loop of the m3-muscarinic receptor (Ser³⁴⁵-Leu⁴⁶³) is an inhibitor of CK1 due to its ability to both act as a pseudo-substrate for CK1 and form a high affinity complex with CK1. Expression of this peptide was able to reduce both basal and agonist-mediated m3-muscarinic receptor phosphorylation in intact cells. These results support the notion that CK1 is able to mediate GPCR phosphorylation in an agonist-dependent manner and that this may provide a novel mechanism for GPCR phosphorylation. The functional role of phosphorylation was investigated using a mutant of the m3-muscarinic receptor that showed an ~80% reduction in agonist-mediated phosphorylation. Surprisingly, this mutant underwent agonist-mediated desensitization suggesting that, unlike many GPCRs, desensitization of the m3-muscarinic receptor is not mediated by receptor phosphorylation. The inositol (1,4,5)-trisphosphate response did, however, appear to be dramatically potentiated in the phosphorylation-deficient mutant indicating that phosphorylation may instead control the magnitude of the initial inositol phosphate response.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

It is now well established that G-protein-coupled receptor (GPCR)¹ phosphorylation is a general phenomenon that controls specific key signaling properties of receptors. Originally associated with receptor desensitization (1, 2), GPCR phosphorylation has now been implicated in a number of processes including receptor internalization (3-6) and as a molecular switch that determines coupling to specific signaling pathways (7, 8). The receptor-specific kinases involved are generally considered to belong to the G-protein-coupled receptor kinase (GRK) family which are characterized by their sequence homology to rhodopsin kinase (GRK-1) and that include the extensively studied -adrenergic receptor kinases 1 and 2 (GRK-2 and -3, respectively) (2, 9). Reconstitution experiments using purified, or partially purified, receptors have demonstrated that in addition to the ₂-adrenergic receptor a number of GPCRs including muscarinic ((10-12), substance P (13), bradykinin B₂ (14), and adenosine A₃ receptors (15) can act as GRK substrates. Furthermore, a GRK-2 dominant negative mutant (16) has been widely employed to probe the role of endogenous GRK-2 in the regulation of GPCRs (3, 17-19). These studies, and others, have led to the proposal that the GRKs, and in particular GRK-2, have a broad receptor substrate specificity and are able to phosphorylate and regulate GPCRs coupled to both adenylyl cyclase via G_s/i and those coupled to the phospholipase C pathway via G_q/11.

In contrast to this model of GRK-mediated phosphorylation of GPCRs, our studies on the G_q/11-coupled m3-muscarinic receptor have suggested that there may be an alternative mechanism mediating agonist-dependent receptor phosphorylation. This receptor is rapidly phosphorylated on serine following agonist addition (20) with a time course that closely correlates with receptor desensitization as measured by diminished inositol (1,4,5)-trisphosphate (Ins(1,4,5)P₃) and intracellular calcium responses (21). Initial characterization of the kinase involved in this phosphorylation event eliminated a role for protein kinase A, protein kinase C, and Ca²⁺/calmodulin-dependent protein kinase (20). Crude membranes prepared from CHO cells expressing recombinant m3-muscarinic receptor were also found to contain receptor kinase activity and that this activity was insensitive to inhibition by heparin and zinc at concentrations that were known to inhibit GRK-2 activity (22). These were the first data suggesting that the m3-muscarinic receptor was phosphorylated by a kinase that was distinct from GRK-2. By using a bacterial fusion protein of the third intracellular loop of the m3-muscarinic receptor as a pseudo-substrate for the "putative" muscarinic receptor kinase, we were able to purify, from porcine cerebellum, a 40-kDa protein kinase that in membrane reconstitution experiments was able to phosphorylate the m3-muscarinic receptor in an agonist-dependent manner (23). Amino acid sequence analysis identified this protein kinase as casein kinase 1 (CK1) (24). Importantly, the ability of CK1 to drive receptor phosphorylation was not restricted to the m3-muscarinic receptor since both rhodopsin and the m1-muscarinic receptor were also shown to be in vitro substrates that were phosphorylated in a stimulus-dependent manner (24, 25). These in vitro studies suggested that CK1 may act as a cellular kinase for specific GPCRs, thereby offering an alternative and distinct route to GPCR phosphorylation from that of the GRKs.

In the present study we explore this hypothesis further by using a catalytically inactive mutant of CK1 and a peptide corresponding to the third intracellular loop of the m3-muscarinic receptor to inhibit endogenous CK1 activity. These experiments provide evidence for a cellular role of CK1 in the phosphorylation and regulation of the m3-muscarinic receptor.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Cell Culture-- COS-7, HEK-293, and CHO cells were grown in medium consisting of -minimum Eagle's medium supplemented with 10% fetal calf serum, 100 IU/ml penicillin, 100 µg/ml streptomycin, and 2.5 µg/ml fungizone. Cells were grown in a 5% CO₂, 95% air, humidified incubator at 37 °C.

Generation Of F-CK1K46R-- Wild type bovine casein kinase 1 that had been tagged at the N terminus with the FLAG epitope (F-CK1) and cloned into pcDNA-3 (Invitrogen, see Ref. 24) was used as a template for the Quikchange site-directed mutagenesis kit (Stratagene). The mutagenesis primer used was GAGGAGGTGGCAGTGCGACTAGAATCCCAGAAGGCGAGGCATCCCCAGTTG. This created a Lys-Arg change at position 46 in the amino acid sequence of CK1. The resulting construct F-CK1K46R was contained in pcDNA-3 and also possessed a FLAG epitope tag on the N terminus. The mutation was confirmed by DNA sequencing.

Generation of the Third Intracellular Loop Peptide (3i Loop Peptide)-- The sequence encoding amino acids Ser³⁴⁵-Leu⁴⁶³ from the third intracellular loop of the m3-muscarinic receptor was amplified using the polymerase chain reaction primers, 5' primer, GGGGGTACCGCCACCATGTCCCTGGAGAACTCCGCCTCCTCCGAC, and 3' primer, GGGTCTAGACTACAGAGTGGCTTCCTTGAAGGACAGAGG, and cloned into KpnI and XbaI sites in pcDNA-3. The resulting construct was then used in transient transfections of HEK-293 cells or COS-7 cells or used to make stably expressing CHO cell lines.

Generation of the m3-Muscarinic Receptor Deletion Mutant Lys³⁷⁰-Ser⁴²⁵ Deletion Mutant-- The m3-muscarinic receptor coding sequence contained in pcDNA-3 was digested with HindIII and then religated. This removed the coding sequence for amino acids Lys³⁷⁰-Ser⁴²⁵ inclusive but maintained the reading frame of the remaining cDNA.

Construction of Bacterial Fusion Proteins-- Generation of the GST bacterial fusion proteins used in this study have been described previously (23).

Antibody Production-- Production and characterization of the m3-muscarinic receptor specific antiserum raised against residues Ser³⁴⁵-Leu⁴⁶³ in the third intracellular loop of the m3-muscarinic receptor has been previously described (20). The pan-M antiserum was raised against a peptide (DRYFSVTRPLSYRAKRTPRC) corresponding to amino acids Asp¹²²-Arg¹⁴⁰ of the m1-muscarinic receptor. This sequence is conserved in the muscarinic receptor family, and the resulting antiserum would be expected to cross-react with all of the muscarinic receptor subtypes. The peptide was conjugated to Keyhole Limpet hemocyanin and injected into New Zealand White rabbits using standard protocols. Characterization of the antiserum using Western blots showed that the pan-M antiserum cross-reacted with the m1 and m3 muscarinic receptors. This antibody was used in immunoprecipitations where the phosphorylation of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant was investigated.

The CK1-specific antiserum was raised against a peptide corresponding to the N terminus of bovine CK1 (MASSSGSKAEFIVGGKYKLC). Characterization of the antiserum using Western blots showed that it was able to cross-react with purified recombinant bovine CK1 and endogenous CK1 present in CHO, HEK-293, COS-7 cells, and rat brain.

Transient Transfections of HEK-293, CHO, and COS-7 Cells-- Cells were plated onto 12-well dishes 24 h before transfection (cells were 40-60% confluent at the start of transfection). Cells were transfected with m3-muscarinic receptor cDNA (contained in pcDNA-3) or co-transfected with m3-muscarinic receptor plus F-CK1K46R or 3i loop peptide constructs. The transfection reagent used was Fugene (Roche Molecular Biochemicals) using a total DNA concentration of 0.5 µg/well.

In experiments to determine inositol (1,4,5)-trisphosphate levels, HEK-293 cells were plated onto 24-well dishes, and each well was transfected with 0.25 µg of DNA. Cells were used 48-72 h after transfection.

Stable Transfection Of CHO Cells with the Third Intracellular Loop Peptide (3i Loop Peptide)-- CHO-K1 cells were transfected with the 3i loop peptide construct (described above) using the Fugene method. Clones expressing the peptide were selected in G418 (200 µg/ml) and screened for expression by Western blot using the m3-muscarinic receptor antiserum that was raised against this peptide (20). The resulting stably transfected clones were then used in experiments where the m3-muscarinic receptor was transiently transfected.

Immunoprecipitation of Phosphorylated m3-Muscarinic Receptor and Third Intracellular Loop Peptide-- Cells plated onto 12-well dishes were washed in phosphate-free Krebs/HEPES buffer (10 mM HEPES, 118 mM NaCl, 4.3 mM KCl, 1.17 mM MgSO₄·7H₂O, 1.3 mM CaCl₂, 25.0 mM NaHCO₃, 11.7 mM glucose, pH 7.4) and incubated in phosphate-free Krebs/HEPES supplemented with [³²P]orthophosphate (50 µCi/ml) for 1-2 h at 37 °C. Either vehicle or the cholinergic agonist, carbachol (0.1 mM), was added, and incubations were continued for a further 5 min. Reactions were terminated by rapid aspiration of the drug-containing media and application of 1 ml of ice-cold solubilization buffer (10 mM Tris, 10 mM EDTA, 500 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, pH 7.4). Samples were left on ice for 15 min and then cleared by microcentrifugation. Antiserum (0.2 µg) was added, and the samples were left on ice for 60-90 min. Immune complexes were isolated on protein A-Sepharose beads, and the beads were washed three times with TE buffer (10 mM Tris-HCl, 10 mM EDTA, pH 7.4). In the case of receptor immunoprecipitations, the protein A-Sepharose pellet was then resuspended in 1 ml of TE, and an aliquot of the protein A slurry was removed corresponding to a known quantity of receptors as determined by radioreceptor assay (see below). This ensured that for each experiment the same number of receptors from each transfection was run on the gel. Isolated immune complexes were then resolved on 8% SDS-PAGE gels in the case of muscarinic receptors or 15% gels for the 3i loop peptide. The gels were dried and subjected to autoradiography, and the level of phosphorylation was assessed with a Bio-Rad model GS 670 densitometer.

Quantification of m3-Muscarinic Receptor Expression-- m3-Muscarinic receptor expression for each transfection was determined by incubating cells plated down onto 12-well dishes with 0.5 ml of Krebs/HEPES buffer (as above but containing KH₂PO₄ 1.17 mM) containing a saturating concentration of muscarinic receptor antagonist [³H]N-methylscopolamine (~0.5 nM) for 60 min at 37 °C. Cells were washed with ice-cold Krebs/HEPES buffer (3 times), and bound [³H]N-methylscopolamine was determined by liquid scintillation counting of cell extracts solubilized in solubilization buffer. Nonspecific binding was determined in the presence of 10 µM atropine and was <3% of the total binding.

Mass Ins(1,4,5)P₃ Determination-- Cells grown in 24-well dishes were washed with Krebs/HEPES buffer and challenged with agonist for the appropriate times. Incubations were terminated by rapid aspiration, addition of ice-cold 0.5 M trichloroacetic acid, and transfer to an ice bath. After 15 min the supernatant was removed and neutralized by addition of EDTA and Freon/tri-N-octylamine as described previously (21). Extracts were brought to pH 7 by addition of NaHCO₃ and stored at 4 °C until analysis. Ins(1,4,5)P₃ mass measurements were performed using a radioreceptor assay described previously (26).

GST Fusion Protein Pull Down Assay-- The hippocampus and cerebral cortex from one rat was homogenized in 15 ml of TE buffer (10 mM Tris-HCl, 2.5 mM EDTA, pH 7.4) by a 5-s pulse in a Polytron (maximum setting). A soluble brain fraction was prepared by centrifugation at 50,000 × g for 15 min. The supernatant was taken and used in the pull down experiment.

GST-m3-muscarinic receptor fusion proteins (5 µg) were incubated with soluble rat brain extract (50 µg) for 1 h at 4 °C. GST fusion protein complexes were isolated on glutathione-Sepharose beads and washed three times in TE buffer. Beads were resuspended in Laemmli buffer and resolved by 12% SDS-PAGE. The presence of CK1 was then determined by Western blot using the casein kinase 1-specific antibody.

In Vitro Kinase Assay for FLAG-tagged Casein Kinase 1 (F-CK1) and F-CK1K46R-- HEK-293 cells were transiently transfected with either recombinant bovine FLAG-tagged F-CK1, FLAG-tagged F-CK1K46R, or vehicle. 72 h after transfection cells were lysed with 1 ml of ice-cold lysis buffer (20 mM Tris-HCl, 0.5% Nonidet P-40, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA, 2 mM Na₃VO₄, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, pH 7.6). The lysate was centrifuged at 21,000 × g for 5 min at 4 °C and the pellet discarded. To the lysate was added mouse M2 anti-FLAG antibody (0.1 µg) for 1 h at 4 °C followed by rabbit anti-mouse IgG (1 µg) for 20 min at 4 °C. The immune complexes isolated on protein A-Sepharose beads and washed twice with lysis buffer and twice with kinase buffer (10 mM Tris-HCl, 1 mM MgCl₂, pH 7.4). The immune complex was then used in a kinase assay by resuspending the protein A beads in kinase buffer containing 20 µM [-³²P]ATP (2.5 µCi/nmol), 5 µg of -casein (total volume = 30 µl). The reactions were allowed to proceed for 15 min at 37 °C and were terminated by the addition of Laemmli buffer (10 µl). Samples were resolved on a 12% SDS-PAGE gel which were then stained with Coomassie Blue to visualize -casein, and an autoradiograph was obtained.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Generation of a Catalytically Inactive Mutant of CK1-- To investigate whether the cellular kinase responsible for m3-muscarinic receptor phosphorylation was CK1, we tested the ability of a catalytically inactive form of CK1 to inhibit agonist-mediated m3-muscarinic receptor phosphorylation. Lysine 46 in bovine CK1 corresponds to the conserved lysine found at the ATP-binding site of all protein kinases (27). By point mutagenesis we constructed a lysine to arginine mutation at position 46 (called F-CK1K46R) that would be predicted to result in a catalytically inactive kinase. Expression of F-CK1K46R was confirmed in transiently transfected HEK-293 cells by Western blotting for the FLAG epitope that was engineered at the N terminus (Fig. 1A). Due to the epitope tag the recombinant mutant ran at a slightly higher molecular mass than the endogenous CK1. Hence by Western blotting with a polyclonal CK1 antiserum that detected both endogenous CK1 and recombinant mutant kinase, we estimated that F-CK1K46R and endogenous CK1 were expressed at approximately equivalent levels (Fig. 1B). Similar results were obtained for F-CK1K46R expressed in COS-7 cells (data not shown).

View larger version (19K): [in this window] [in a new window]   Fig. 1.   Expression of the catalytically inactive F-CK1K46R mutant. A, HEK-293 cells were transfected with (K46R) or without (CNT) the F-CK1K46R construct. Cells were lysed, and an aliquot (~20 µg of protein) of the cell lysis was resolved on a 12% SDS-PAGE gel and immunoblotted with the M2 anti-FLAG epitope antiserum. B, cell lysis from transfected cells (~20 µg of protein) were resolved on a 12% gel and immunoblotted using the CK1-specific antiserum. C, in vitro kinase assays were used to assess the activity of F-CK1K46R. Cells transfected with recombinant FLAG epitope-tagged bovine F-CK1 (CK1) or F-CK1K46R (K46R) or non-transfected (CNT) were lysed, and the M2 anti-FLAG antiserum was used to immunoprecipitate the recombinant kinases. The immunoprecipitate was then used in an in vitro kinase assay with -casein as the substrate. The proteins were resolved by 12% SDS-PAGE, and the gel was stained with Coomassie Blue to visualize the -casein. Gels were then dried, and an autoradiograph was obtained. The positions of molecular mass markers are shown in kilodaltons. The experiments shown are representative of at least three experiments.

In order to determine enzymatic activity, HEK-293 cells were transiently transfected with recombinant bovine F-CK1 or F-CK1K46R, both of which were tagged at the N terminus with the FLAG epitope. In vitro kinases assays on FLAG antiserum immunoprecipitates revealed that the F-CK1K46R had no detectable kinase activity (Fig. 1C).

F-CK1K46R Decreases Agonist-mediated Receptor Phosphorylation in Intact Cells-- Human m3-muscarinic receptors transfected into HEK-293 or COS-7 cells were phosphorylated in an agonist-dependent manner by endogenous protein kinase(s) (Fig. 2). Co-transfection of the m3-muscarinic receptor with F-CK1K46R resulted in a decrease in agonist-mediated receptor phosphorylation by 40.1 ± 2.0% (n = 3, ±S.E.) and 43.1 ± 3.5% (n = 3, ±S.E.) in HEK-293 cells and COS-7 cells, respectively (Fig. 2). In these experiments cells were stimulated with a maximum concentration of agonist (carbachol; 100 µM) for 5 min, conditions that we have previously reported results in maximum phosphorylation of the receptor (20).

View larger version (20K): [in this window] [in a new window]   Fig. 2.   Expression of F-CK1K46R reduces agonist-mediated phosphorylation of the m3-muscarinic receptor. Cells expressing the m3-muscarinic receptor alone (CNT) or co-transfected with F-CK1K46R (K46R) were prelabeled with [32P]orthophosphate and stimulated with 0.1 mM carbachol (CCh) for 5 min. m3-muscarinic receptor phosphorylation was then determined by immunoprecipitation using an m3-muscarinic receptor antiserum. An equal number of muscarinic receptors was then applied to an 8% SDS-PAGE gel, and an autoradiograph was obtained. A, a representative gel from an experiment using transiently transfected HEK-293 cells. In this example m3-muscarinic receptor levels were ~1.2 pmol/mg protein. B, a representative gel from an experiment using transiently transfected COS-7 cells. In this example m3-muscarinic receptor levels were ~0.8 pmol/mg protein. The data shown are representative of at least three experiments. The positions of molecular mass markers are shown in kilodaltons.

In each experiment receptor expression was determined, and the amount of receptor applied to the gel was adjusted so that equal receptor numbers were run on the gel. Co-expression of the F-CK1K46R with the receptor did not influence the level of m3-muscarinic receptor expression. Any differences we observed in the level of receptor expression between control and co-transfected cells (usually <30%) were probably due to experimental variations in transfection efficiencies.

A Peptide Corresponding to the Third Intracellular Loop of the m3-Muscarinic Receptor Inhibits Receptor Phosphorylation-- Earlier studies from our laboratory demonstrated that a bacterial fusion protein containing a portion of the third intracellular loop of the m3-muscarinic receptor (Ser³⁴⁵-Leu⁴⁶³) was able to inhibit CK1-mediated muscarinic receptor phosphorylation in membranes (Ref. 23; also see "Discussion"). Here we tested the ability of this peptide to inhibit m3-muscarinic receptor phosphorylation in intact cells.

Expression of the transfected peptide, of ~12.5 kDa, corresponding to amino acids Ser³⁴⁵-Leu⁴⁶³ (3i loop peptide) of the m3-muscarinic receptor was detected by Western blotting using an m3-muscarinic receptor antiserum that was raised against this peptide (20) (Fig. 3). Transient co-expression of m3-muscarinic receptors with the 3i loop peptide in COS-7 cells resulted in a decrease in agonist-mediated m3-muscarinic receptor phosphorylation by 72.0 ± 5.9% (n = 3, ±S.E.) (Fig. 4). Interestingly, the basal phosphorylation seen in COS-7 cells was also reduced (~60%) by the 3i loop peptide (Fig. 4). In HEK-293 cells m3-muscarinic receptor phosphorylation was also inhibited by expression of the 3i loop peptide, in this case by 45.9 ± 2.9% (n = 3, ±S.E.) (Fig. 4).

View larger version (25K): [in this window] [in a new window]   Fig. 3.   Expression of the third intracellular loop peptide Ser345-Leu463 (3i loop peptide). A, diagrammatic representation showing the region in the m3-muscarinic receptor that corresponds to the 12.5-kDa 3i loop peptide. B, Western blot using the m3-muscarinic receptor antiserum of cell lysates from cells not transfected (NT) or transfected with the intact m3-muscarinic receptor (m3-R) or the 3i loop peptide (3i-P). The results shown are representative of three experiments. The position of molecular mass markers are shown in kilodaltons.

View larger version (25K): [in this window] [in a new window]   Fig. 4.   Expression of the 3i loop peptide reduces basal and agonist-mediated phosphorylation of the m3-muscarinic receptor. Cells expressing the m3-muscarinic receptor alone (CNT) or co-transfected with the 3i loop peptide (3i-P) were prelabeled with [32P]orthophosphate and stimulated with 0.1 mM carbachol (CCh) for 5 min. m3-muscarinic receptor phosphorylation was then determined by immunoprecipitation using an m3-muscarinic receptor antiserum. An equal number of muscarinic receptors was then applied to an 8% SDS-PAGE gel, and an autoradiograph was obtained. A, a representative gel from an experiment using transiently transfected COS-7 cells. In this example m3-muscarinic receptor levels were ~1.7 pmol/mg protein. B, a representative gel from an experiment using transiently transfected HEK-293 cells. In this example m3-muscarinic receptor levels were ~1.2 pmol/mg protein. C, a representative gel from an experiment where native CHO-K1 cells (CNT) or cells that were stably expressing the 3i loop peptide (3i-P) were transiently transfected with the m3-muscarinic receptor. In the experiment shown m3-muscarinic receptor levels were ~0.5 pmol/mg protein. The data shown are representative of at least three experiments. The position of molecular mass markers are shown in kilodaltons.

We also developed a stable CHO cell line that expressed the 3i loop peptide constitutively. This cell line was transiently transfected with the m3-muscarinic receptor and receptor phosphorylation compared with native CHO-K1 cells transiently transfected with the receptor. In these experiments expression of the 3i loop peptide reduced agonist-mediated phosphorylation of the m3-muscarinic receptor by 75.2 ± 3.4% (n = 4, ±S.E.). Furthermore, basal phosphorylation was also reduced in the presence of the 3i loop peptide (by ~50%).

The 3i loop peptide expressed in CHO cells was itself phosphorylated, but this phosphorylation was not altered by m3-muscarinic receptor stimulation (Fig. 5). The same results were obtained in COS-7 and HEK-293 cells (data not shown).

View larger version (57K): [in this window] [in a new window]   Fig. 5.   Phosphorylation of the 3i loop peptide. Native CHO-K1 cells (CNT) or CHO cells stably expressing the 3i loop peptide (3i-P) were transiently transfected with the m3-muscarinic receptor. Cells were prelabeled with [32P]orthophosphate and stimulated with 0.1 mM carbachol for 5 min. Cells were then lysed with solubilization buffer, and the 3i loop peptide was immunoprecipitated using the m3-muscarinic receptor-specific antiserum. The immunoprecipitate was resolved on a 15% SDS-PAGE gel. The data shown are representative of three experiments. The positions of molecular mass markers are shown in kilodaltons.

Determination of a Putative CK1-binding Site on the m3-Muscarinic Receptor-- CK1 contained in a crude soluble rat brain fraction specifically associated with the muscarinic receptor portion of a glutathione S-transferase (GST) bacterial fusion protein that contains the third intracellular loop sequence Ser³⁴⁵-Leu⁴⁶³, designated Ex-m3 (Fig. 6). This interaction appeared particularly strong since washes in salt (KCl) up to a concentration of 2 M was not sufficient to disrupt binding of CK1 (data not shown). Deletion mutants of Ex-m3 were used to map the binding site of CK1 (Fig. 7A). Truncation at the N- and C-terminals of Ex-m3 did not affect the ability of the fusion protein to interact with CK1 present in rat brain supernatant (Fig. 7B) or recombinant bovine CK1 partially purified from infected sf-9 cells (data not shown). However, deletion of the region Lys³⁷⁰-Ser⁴²⁵ (Lys³⁷⁰-Ser⁴²⁵) resulted in no detectable binding of CK1 (Fig. 7B). A smaller deletion of 18 amino acids (His³⁷⁴-Val³⁹¹) also resulted in a fusion protein that was unable to associate with CK1 (Fig. 7B). (Note, the identity of the doublet in the Ex-m3 pull down (lane 2, Fig. 7C) is likely to be CK1 running at its correct molecular mass (the lower band) and CK1 that is still associated with Ex-m3 (upper band). The doublet in lane 5 (Fig. 7C) is likely to be CK1 (the upper band) and an unknown protein that cross-reacts with the CK1 antiserum (lower band).)

View larger version (84K): [in this window] [in a new window]   Fig. 6.   Complex formation between CK1 and a GST fusion protein corresponding to the third intracellular loop of the m3-muscarinic receptor. Either GST (5 µg) or the GST fusion protein, Ex-m3, that contains the third intracellular loop sequence Ser345-Leu463 (Ex-m3, 5 µg) were incubated with a soluble rat brain lysate preparation (50 µg of protein). Bacterial fusion proteins were then isolated on glutathione-Sepharose beads and resolved on a 12% gel. The gel was then immunoblotted using the CK1-specific antiserum. Recombinant FLAG-tagged F-CK1 purified from infected insect sf-9 cells was used as a standard (CK1). Note that due to the FLAG tag at the N terminus the standard runs at a slightly higher molecular mass than the brain CK1. The position of molecular mass markers are shown in kilodaltons.

View larger version (14K): [in this window] [in a new window]   Fig. 7.   Determination of the site of interaction between CK1 and the third intracellular loop of the m3-muscarinic receptor. A, diagrammatic representation of the muscarinic receptor portion of the GST fusion proteins showing deleted regions. Also shown in triangles are the positions of the serine residues. B, Coomassie Blue stain of the fusion proteins used in the GST fusion protein pull down assay. C, immunodetection of CK1 isolated from pull down experiments where fusion proteins (5 µg) were incubated with rat brain lysate (50 µg of protein). The data shown are representative of four experiments. The position of molecular mass markers are shown in kilodaltons. Key to lanes, lane CK1, purified recombinant F-CK1 standard; lane B, no fusion protein added; lane 1, GST; lane 2, Ex-m3; lane 3, Lys370-Ser425; lane 4, Ex-345-427; lane 5, Ex-376-463; lane 6, His376-Val391.

Deletion of the Region Lys³⁷⁰-Ser⁴²⁵ from the Third Intracellular Loop of the m3-Muscarinic Receptor Results in Reduced Agonist-mediated Phosphorylation-- Our previous studies have demonstrated that CK1-mediated phosphorylation of the bacterial fusion protein Lys³⁷⁰-Ser⁴²⁵ is reduced from that of the full-length fusion protein, Ex-m3 (23). It was, therefore, decided to make the same deletion in the intact m3-muscarinic receptor with the aim to produce a receptor unable to undergo agonist-mediated phosphorylation.

Hence a stable CHO cell line was generated expressing a m3-muscarinic receptor containing a Lys³⁷⁰-Ser⁴²⁵ deletion in the third intracellular loop. The clone used (clone 17) was carefully selected to have a similar receptor expression level as the control CHO cell line expressing the wild type m3-muscarinic receptor (Lys³⁷⁰-Ser⁴²⁵ deletion mutant expression = 782 ± 67 fmol/mg protein; wild type receptor expression = 908 ± 124 fmol/mg protein).

Deletion of this region did not significantly (p > 0.05 Student's t test) affect agonist or antagonist binding properties of the receptor. K_D values for antagonist binding ([³H]N-methylscopolamine) were 0.23 and 0.20 nM for the Lys³⁷⁰-Ser⁴²⁵ deletion mutant and wild type m3-muscarinic receptor, respectively. K_D values for agonist binding (carbachol) to membranes in the absence of GTP were 62.8 and 78.6 µM for the Lys³⁷⁰-Ser⁴²⁵ deletion mutant and wild type m3-muscarinic receptor, respectively.

Since the polyclonal m3-muscarinic receptor-specific antiserum used throughout this study was raised against the region Ser³⁴⁵-Leu⁴⁶³, it was possible that the Lys³⁷⁰-Ser⁴²⁵ deletion mutant may have epitopes removed that would prevent immunoprecipitation by this antiserum. For this reason an alternative antiserum was raised against a peptide conserved among the muscarinic receptor family (Asp^122-Arg¹⁴⁰ in the 2nd intracellular loop of the m1-muscarinic receptor). This antiserum recognized both m1- and m3-muscarinic receptors as determined by Western blot (data not shown) and was designated pan-M.

By using the pan-M antiserum in immunoprecipitation studies, it was found that the level of agonist-mediated phosphorylation of the receptor containing the Lys³⁷⁰-Ser⁴²⁵ deletion was dramatically reduced (~80%) compared with wild type receptor (Fig. 8). Note that the Lys³⁷⁰-Ser⁴²⁵ deletion mutant runs at ~90 kDa compared with the wild type muscarinic receptor that runs at ~110 kDa.

View larger version (103K): [in this window] [in a new window]   Fig. 8.   Deletion of the region Lys370-S425 from the m3-muscarinic receptor reduces the level of agonist-mediated phosphorylation. Native CHO-K1 cells (CHO) or CHO cells stably transfected with the wild type m3-muscarinic receptor (WT) or Lys370-Ser425 deletion mutant (K-S) were prelabeled with [32P]orthophosphate and stimulated with 0.1 mM carbachol (CCh) for 5 min. The receptors were solubilized and immunoprecipitated using the pan-M antiserum. The results shown are representative of four experiments. The position of molecular mass markers in kilodaltons is shown.

The pan-M antiserum did, however, cross-react with phosphoproteins other than the m3-muscarinic receptor as evident by bands at ~120 and ~82 kDa in non-transfected control cells (Fig. 8.). The identities of these proteins are not known.

Analysis of the Ins(1,4,5)P₃ Response in the Lys³⁷⁰-Ser⁴²⁵ Deletion Mutant of the m3-Muscarinic Receptor-- These experiments were carried out on CHO cells stably expressing either the wild type m3-muscarinic receptor or the Lys³⁷⁰-Ser⁴²⁵ deletion mutant. Analysis of the wild type m3-muscarinic receptor Ins(1,4,5)P₃ response to agonist challenge showed a characteristic peak of Ins(1,4,5)P₃ production followed by a plateau phase (Fig. 9A) consistent with previous reports (21, 28). Also consistent with previous studies was the demonstration that the peak Ins(1,4,5)P₃ response could be desensitized by 41.5% following a 5-min pre-stimulation with agonist (Fig. 9A) (21, 28).

View larger version (18K): [in this window] [in a new window]   Fig. 9.   Ins(1,4,5)P3 determinations in CHO cells stably expressing the wild-type m3-muscarinic receptor or the Lys370-Ser425 deletion mutant. CHO cells were either pretreated with vehicle (Control) or carbachol (1 mM; pre-stimulated) for 5 min. The cells were washed (3 times) and challenged with carbachol (1 mM) for the indicated times. Ins(1,4,5)P3 levels were then determined as described under "Materials and Methods." A, Ins(1,4,5)P3 levels in CHO cells stably transfected with the wild type m3-muscarinic receptor; expression levels = 908 ± 124 fmol/mg protein (n = 3). B, Ins(1,4,5)P3 levels in CHO cells stably transfected with the Lys370-Ser425 deletion mutant; expression levels = 782 ± 67 fmol/mg protein (n = 3). C, comparison of the control Ins(1,4,5)P3 responses for wild type m3-muscarinic receptors and the Lys370-Ser425 deletion mutant. The data shown are the mean value ± S.E. (n = 3).

The temporal profile of the Ins(1,4,5)P₃ response on agonist stimulation of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant was similar to the wild type receptor (Fig. 9B). Importantly, despite the fact that agonist-mediated phosphorylation of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant was dramatically reduced, this receptor was still desensitized by 51.2% following a 5-min agonist pre-stimulation (Fig. 9B).

There was, however, a dramatic difference in the magnitude of the peak Ins(1,4,5)P₃ responses between the Lys³⁷⁰-Ser⁴²⁵ deletion mutant and wild type m3-muscarinic receptor (Fig. 9C). The control wild type receptor peak response was 249.7 ± 5.4 pmol of Ins(1,4,5)P₃/mg protein compared with 517.3 ± 72.0 pmol of Ins(1,4,5)P₃/mg protein (n = 3 ± S.E.) in the case of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant. This increased in Ins(1,4,5)P₃ production observed on stimulation of the mutant receptor was restricted to the peak response since the plateau responses for the mutant and wild type receptors were similar (Fig. 9C). Interestingly, despite the greater responsiveness of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant in terms of the magnitude of the Ins(1,4,5)P₃ response, there was no significant difference (p > 0.05 Student's t test) in the potency of the carbachol-mediated Ins(1,4,5)P₃ elevation between the wild type receptor and the Lys³⁷⁰-Ser⁴²⁵ deletion mutant (EC₅₀ values for wild type and Lys³⁷⁰-Ser⁴²⁵ deletion mutant receptors were 7.14 ± 3.2 and 9.71 ± 1.9 µM (n = 3, ±S.E.), respectively).

The ability of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant to show increased stimulation of inositol phosphate production was also tested in transiently transfected HEK-293 cells. Such experiments are free from the potential clonal artifacts of the stably transfected cell lines. In these experiments the Lys³⁷⁰-Ser⁴²⁵ deletion mutant peak (10 s) Ins(1,4,5)P₃ response was 24.3 ± 0.4% (n = 3) greater than the wild type receptor response (data not shown). The fact that the increased responsiveness of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant was not as great as that observed in the stable transfections may be due to the different experimental protocol and cell lines; however, the trend is the same, namely the Lys³⁷⁰-Ser⁴²⁵ deletion mutant appears to generate a greater Ins(1,4,5)P₃ response than the wild type receptor.

Functional Analysis of Transiently Transfected HEK-293 Cells Co-expressing the m3-Muscarinic Receptor and F-CK1K46R-- Peak Ins(1,4,5)P₃ responses to agonist stimulation was analyzed in HEK-293 cells transiently transfected with the m3-muscarinic receptor only or co-transfected with F-CK1K46R. Following a 5-min pre-stimulation with agonist and a 5-min wash period, the Ins(1,4,5)P₃ response to stimulation of the m3-muscarinic receptor was desensitized by 28.3% (Fig. 10). In cells co-transfected with the m3-muscarinic receptor and the catalytically inactive kinase F-CK1K46R, a procedure that reduces agonist-mediated receptor phosphorylation (see above), the peak response was still desensitized (by 33.8%) following agonist pre-stimulation (Fig. 10).

View larger version (20K): [in this window] [in a new window]   Fig. 10.   Ins(1,4,5)P3 determination in HEK-293 cells transiently transfected with the m3-muscarinic receptor alone (m3) or co-transfected with F-CK1K46R (m3+K46R). Cells were either pretreated with vehicle (Control) or carbachol (1 mM; pre-stimulated) for 5 min. The cells were washed and challenged with carbachol (1 mM). Ins(1,4,5)P3 levels were then determined as described under "Materials and Methods." The data shown are the mean value ± S.E. (n = 3).

Interestingly, the peak Ins(1,4,5)P₃ response in cells co-transfected with the m3-muscarinic receptor and the F-CK1K46R mutant was larger (by ~25%) than the peak response of cells transfected with the m3-muscarinic receptor alone (Fig. 10). It therefore appears that transient transfection of F-CK1K46R resulting in decreased receptor phosphorylation has no effect on the ability of the inositol phosphate response to be desensitized but does result in an increase the magnitude of the Ins(1,4,5)P₃ response. This is consistent with the data from the stably transfected CHO cells where the Lys³⁷⁰-Ser⁴²⁵ deletion mutant, which showed reduced receptor phosphorylation, had an increased inositol phosphate response when compared with wild type receptors (see above).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The present study presents in vivo evidence that CK1 is responsible, at least in part, for agonist-mediated receptor phosphorylation of the m3-muscarinic receptor expressed in transfected cell lines. Furthermore, phosphorylation appears not to mediate receptor desensitization but instead may control the magnitude of the peak Ins(1,4,5)P₃ response. This represents a radical departure from the widely accepted model for GPCR phosphorylation and desensitization mediated by the GRKs.

Previous in vitro studies from our laboratory have established that CK1 is able to mediate stimulus-dependent phosphorylation of a number of GPCRs (24, 25) suggesting that CK1 may represent a pathway, distinct from the GRKs, for receptor phosphorylation in intact cells. In the present study we have taken advantage of the fact that, like many GPCRs, the m3-muscarinic receptor is phosphorylated in an agonist-dependent manner by endogenous receptor kinases expressed in a number of commonly used cell lines (i.e. CHO, COS-7, and HEK-293 cells). To investigate whether CK1 was one of these endogenous receptor kinases, we tested the ability of a catalytically inactive mutant of CK1 to inhibit m3-muscarinic receptor phosphorylation. By mutating a conserved lysine residue (Lys⁴⁶) to an arginine (F-CK1K46R) in sub-domain II of the catalytic domain of CK1, known to be essential for phospho-transfer (27), the catalytic activity of the kinase was lost. Analogous mutations in other protein kinases, in particular GRK-2, have been used to generate dominant negative mutants (16). Furthermore, mutation of this conserved lysine in CK1 has been shown to result in a dominant negative mutant able to block endogenous CKI-mediated phosphorylation of dishevelled in Xenopus oocytes (29). We predicted, therefore, that if endogenous CK1 was responsible for m3-muscarinic receptor phosphorylation then expression of the F-CK1K46R mutant would inhibit receptor phosphorylation by acting in a dominant negative manner. We show here that F-CK1K46R when expressed in cells at approximately equivalent levels to the endogenous CK1 resulted in a dramatic reduction in the level of agonist-mediated m3-muscarinic receptor phosphorylation, suggesting that at least a proportion of the receptor phosphorylation was mediated by endogenous CK1.

We aimed to confirm this finding by raising an alternative inhibitor to CK1. Previous studies have shown that a peptide corresponding to the third intracellular loop of the m3-muscarinic receptor (Ser³⁴⁵-Leu⁴⁶³) contained in a GST bacterial fusion protein was able to inhibit m3-muscarinic receptor phosphorylation in membranes (23). This inhibitory property was attributed to the ability of the peptides to act as a pseudo-substrate for CK1 and therefore compete with the receptor for endogenous CK1 present in the membrane preparation. Additionally, in the present study we demonstrate that this peptide forms a high affinity complex with CK1, and this may also contribute to its inhibitory properties. In order to investigate the involvement of CK1 in the phosphorylation of m3-muscarinic receptors in intact cells, we tested the ability of the third intracellular loop peptide Ser³⁴⁵-Leu⁴⁶³ (3i loop peptide) to inhibit receptor phosphorylation in transfected cell lines. Expression of the 3i loop peptide resulted in a dramatic reduction in both basal and agonist-mediated m3-muscarinic receptor phosphorylation. The peptide itself became phosphorylated suggesting that, as in the membrane experiments, the peptide was acting as a pseudo-substrate for CK1. Although it is possible that the 3i loop peptide may be inhibiting receptor phosphorylation by interacting with kinases other than CK1, the cellular data presented here is consistent with the earlier in vitro data and suggests that m3-muscarinic receptor phosphorylation in intact cells is mediated, at least in part, by CK1.

Interestingly, the m3-muscarinic receptor is not the only GPCR found to be phosphorylated by casein kinase I in intact cells. In a recent study, stimulus-dependent phosphorylation of the -factor pheromone receptor of Saccharomyces cerevisiae (Ste2p) was also reported to be mediated by casein kinase I, and this was associated with control of receptor ubiquitination and endocytosis (30).

The fact that agonist-mediated phosphorylation of the m3-muscarinic receptor in the present study was not completely inhibited by either F-CK1K46R or the 3i loop peptide indicates that either the inhibitors are not expressed in sufficiently high concentrations or that phosphorylation is mediated by kinases in addition to CK1. In the case of the GRK-2 dominant negative mutant, in vitro studies have demonstrated that a 10-fold molar excess of the dominant negative mutant was required to inhibit GRK-2-mediated ₂-adrenergic receptor phosphorylation by 60% (in the presence of G-protein -subunits) (16). In the present study we were only able to achieve a level of F-CK1K46R expression that was approximately equivalent to endogenous CK1. This level of expression may have been insufficient to inhibit completely the endogenous kinase activity.

An alternative, and attractive, proposition is that CK1 is one of a number of kinases responsible for agonist-mediated phosphorylation. There is, for example, evidence for the involvement of the GRKs in muscarinic receptor phosphorylation. The adenylyl cyclase-coupled m2-muscarinic receptor was one of the first receptors to be shown to be an in vitro substrate for the GRKs (31). Phosphorylation at sites on the third intracellular loop is thought to mediate m2-muscarinic receptor internalization (6, 32). m3-muscarinic receptors contained in urea-treated membranes have previously been shown to be phosphorylated by purified GRK-2 and -3 but not GRK-5 and -6 (11). A peptide corresponding to the third intracellular loop of the m3-muscarinic receptor has also been shown to be a substrate for GRK-2 in in vitro studies (33). Furthermore, the purified m1-muscarinic receptor is phosphorylated in an agonist-dependent manner following reconstitution with GRK-2 (12). These in vitro reconstitution studies indicate that certain GRKs have the potential to phosphorylate members of the muscarinic receptor family coupled via both G_i and G_q/11 G-proteins, although direct evidence that this is the case in cells has yet to be presented. Hence, placed in context with previous studies our data suggest the intriguing possibility that the m3-muscarinic receptor may be phosphorylated by CK1 and possibly one or more of the GRKs. Ongoing studies in our laboratory mapping the phosphorylation sites on the m3-muscarinic receptor may reveal phospho-acceptor sites that cannot be assigned to CK1 and thereby indicate the involvement of other receptor kinases.

The functional consequences of receptor phosphorylation were investigated in a receptor where the region Lys³⁷⁰-Ser⁴²⁵ in the third intracellular loop had been deleted. Compared with the wild type receptor this mutant showed an ~80% decrease in agonist-mediated receptor phosphorylation. The region deleted included the putative CK1-binding site, identified in this study to reside in the domain His³⁷⁴-Val³⁹¹. Although the reduction in the ability of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant to undergo agonist-mediated receptor phosphorylation might be explained by the loss of the putative CK1-binding site, it must be noted that this deletion also removed eight serine residues that may act as potential phospho-acceptor sites. Furthermore, the results reported here are consistent with our previous studies using bacterial fusion proteins where we showed that deletion of either Lys³⁷⁰-Ser⁴²⁵ or His³⁷⁴-Val³⁹¹ from a bacterial fusion protein expressing the majority of the third intracellular loop (i.e. Ser³⁴⁵-Leu⁴⁶³, termed Ex-m3) resulted in a dramatic reduction in the level of phosphorylation mediated by purified CK1 (23).

Functional analysis of the wild type m3-muscarinic receptor Ins(1,4,5)P₃ response revealed a characteristic peak/plateau response to agonist stimulation where the peak response at 5-10 s was desensitized by a pre-stimulation with agonist. Previously we have speculated that due to the rapid time course of agonist-mediated m3-muscarinic receptor phosphorylation, and the large weight of evidence in the literature linking receptor phosphorylation to GPCR desensitization, that phosphorylation was the mechanism underlying the desensitization of the peak Ins(1,4,5)P₃ response (20, 25, 34). To our surprise the Lys³⁷⁰-Ser⁴²⁵ deletion mutant receptor showed a peak/plateau Ins(1,4,5)P₃ response with a temporal profile very similar to the wild type receptor. Furthermore, pre-stimulation of the Lys³⁷⁰-Ser⁴²⁵ deletion mutant resulted in desensitization of the peak Ins(1,4,5)P₃ response. These data suggest that agonist-mediated phosphorylation of the m3-muscarinic receptor was not involved in the desensitization of the peak Ins(1,4,5)P₃ response. It is, however, possible that the small amount of phosphorylation that remains in the Lys³⁷⁰-Ser⁴²⁵ deletion mutant receptor, possibly mediated by one or more of the GRKs (see above), may be sufficient to induce desensitization of the peak Ins(1,4,5)P₃ response.

Recent studies have identified a number of GPCRs that undergo phosphorylation-independent desensitization. For example, heterologous desensitization of the formyl-methionyl-leucyl-phenylalanine and the bradykinin B₂ receptors are not associated with receptor phosphorylation (35-37). A similar lack of correlation between receptor phosphorylation and desensitization has also been reported for the chemoattractant receptor of Dictyostelium where removal of the phospho-acceptor sites does not affect desensitization of the adenylyl and guanylyl cyclase responses (38). The possibility that desensitization of the m3-muscarinic receptor is a result of mechanisms downstream of the receptor is currently being pursued in our laboratory.

In the present study the Lys³⁷⁰-Ser⁴²⁵ deletion mutant gave a more robust Ins(1,4,5)P₃ response when compared with the wild type receptor (2-3 fold). This was not due to changes in agonist affinities for the receptor nor changes in the efficacy of the agonist but may reflect an enhanced coupling of the receptor to G_q/11. An increase in the magnitude of the Ins(1,4,5)P₃ response was also seen in cells where m3-muscarinic receptor phosphorylation was reduced by co-transfection with F-CK1K46R, suggesting that receptor phosphorylation mediated by CK1 was able to control the magnitude of the Ins(1,4,5)P₃ response. An enhanced inositol phosphate signal has previously been reported for truncation mutants of the platelet-activating factor (39) and neurokinin-2 receptors (40) where putative phospho-acceptor sites had been removed. In these cases receptor-stimulated phospholipase C activity appeared to be "up-regulated" by removing phospho-acceptor sites resulting in augmented signaling. It appears, therefore, that receptor phosphorylation may play a role in controlling the magnitude of the inositol phosphate response mediated by m3-muscarinic receptors and possibly other phospholipase C-coupled GPCRs.

In summary we show that inhibition of endogenously expressed CK1 reduces agonist-mediated phosphorylation of the m3-muscarinic receptor. These data support our earlier studies suggesting that CK1 is a receptor kinase involved in GPCR phosphorylation. Furthermore, by using a receptor mutant that shows reduced agonist-mediated phosphorylation, we show that phosphorylation is not associated with desensitization of the peak Ins(1,4,5)P₃ response but may instead be involved in controlling the magnitude of the inositol phosphate response.

	ACKNOWLEDGEMENTS

We thank Dr. Gary Willars for careful reading of the manuscript and Prof. Steve Nahorski for many helpful discussions and suggestions.

	FOOTNOTES

^* This work was supported by the Wellcome Trust Grant 047600/Z/96.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 0116-2522935; Fax: 0116-252 5045; E-mail: TBA@le.ac.uk.

Published, JBC Papers in Press, April 20, 2000, DOI 10.1074/jbc.M000492200

	ABBREVIATIONS

The abbreviations used are: GPCR, G-protein-coupled receptor; CK1, casein kinase 1; GRK, G-protein-coupled receptor kinase; Ins(1, 4,5)P₃, inositol (1,4,5) trisphosphate; CHO, Chinese hamster ovary; PAGE, polyacrylamide gel electrophoresis; GST, glutathione S-transferase.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg