|
Originally published In Press as doi:10.1074/jbc.M000492200 on April 20, 2000
J. Biol. Chem., Vol. 275, Issue 26, 19667-19675, June 30, 2000
Phosphorylation and Regulation of a Gq/11-coupled
Receptor by Casein Kinase 1 *
David C.
Budd,
John E.
McDonald, and
Andrew B.
Tobin
From the Department of Cell Physiology and Pharmacology, University
of Leicester, P. O. Box 138, Medical Sciences Building,
University Road, Leicester LE1 9HN, United Kingdom
Received for publication, January 19, 2000, and in revised form, April 12, 2000
 |
ABSTRACT |
Agonist-mediated receptor phosphorylation by one
or more of the members of the G-protein receptor kinase (GRK) family is
an established model for G-protein-coupled receptor (GPCR)
phosphorylation resulting in receptor desensitization. Our recent
studies have, however, suggested that an alternative route to GPCR
phosphorylation may be an operation involving casein kinase 1
(CK1 ). In the current study we investigate the involvement of CK1
in the phosphorylation of the human m3-muscarinic receptor in intact
cells. We show that expression of a catalytically inactive mutant of
CK1 , designed to act in a dominant negative manner, inhibits
agonist-mediated receptor phosphorylation by ~40% in COS-7 and
HEK-293 cells. Furthermore, we present evidence that a peptide
corresponding to the third intracellular loop of the m3-muscarinic
receptor (Ser345-Leu463) is an inhibitor
of CK1 due to its ability to both act as a pseudo-substrate for
CK1 and form a high affinity complex with CK1 . Expression of this
peptide was able to reduce both basal and agonist-mediated
m3-muscarinic receptor phosphorylation in intact cells. These results
support the notion that CK1 is able to mediate GPCR phosphorylation
in an agonist-dependent manner and that this may provide a
novel mechanism for GPCR phosphorylation. The functional role of
phosphorylation was investigated using a mutant of the m3-muscarinic
receptor that showed an ~80% reduction in agonist-mediated
phosphorylation. Surprisingly, this mutant underwent agonist-mediated
desensitization suggesting that, unlike many GPCRs, desensitization of
the m3-muscarinic receptor is not mediated by receptor phosphorylation.
The inositol (1,4,5)-trisphosphate response did, however, appear to be
dramatically potentiated in the phosphorylation-deficient mutant
indicating that phosphorylation may instead control the magnitude of
the initial inositol phosphate response.
 |
INTRODUCTION |
It is now well established that G-protein-coupled receptor
(GPCR)1 phosphorylation is a
general phenomenon that controls specific key signaling properties of
receptors. Originally associated with receptor desensitization (1, 2),
GPCR phosphorylation has now been implicated in a number of processes
including receptor internalization (3-6) and as a molecular switch
that determines coupling to specific signaling pathways (7, 8). The
receptor-specific kinases involved are generally considered to belong
to the G-protein-coupled receptor kinase (GRK) family which are
characterized by their sequence homology to rhodopsin kinase (GRK-1)
and that include the extensively studied -adrenergic receptor
kinases 1 and 2 (GRK-2 and -3, respectively) (2, 9). Reconstitution
experiments using purified, or partially purified, receptors have
demonstrated that in addition to the 2-adrenergic
receptor a number of GPCRs including muscarinic ((10-12), substance P
(13), bradykinin B2 (14), and adenosine A3
receptors (15) can act as GRK substrates. Furthermore, a GRK-2 dominant
negative mutant (16) has been widely employed to probe the role of
endogenous GRK-2 in the regulation of GPCRs (3, 17-19). These studies,
and others, have led to the proposal that the GRKs, and in particular
GRK-2, have a broad receptor substrate specificity and are able to
phosphorylate and regulate GPCRs coupled to both adenylyl cyclase via
Gs/i and those coupled to the phospholipase C pathway via
Gq/11.
In contrast to this model of GRK-mediated phosphorylation of GPCRs, our
studies on the Gq/11-coupled m3-muscarinic receptor have
suggested that there may be an alternative mechanism mediating agonist-dependent receptor phosphorylation. This receptor
is rapidly phosphorylated on serine following agonist addition (20)
with a time course that closely correlates with receptor
desensitization as measured by diminished inositol
(1,4,5)-trisphosphate (Ins(1,4,5)P3) and intracellular
calcium responses (21). Initial characterization of the kinase involved
in this phosphorylation event eliminated a role for protein kinase A,
protein kinase C, and Ca2+/calmodulin-dependent
protein kinase (20). Crude membranes prepared from CHO cells expressing
recombinant m3-muscarinic receptor were also found to contain receptor
kinase activity and that this activity was insensitive to inhibition by
heparin and zinc at concentrations that were known to inhibit GRK-2
activity (22). These were the first data suggesting that the
m3-muscarinic receptor was phosphorylated by a kinase that was distinct
from GRK-2. By using a bacterial fusion protein of the third
intracellular loop of the m3-muscarinic receptor as a pseudo-substrate
for the "putative" muscarinic receptor kinase, we were able to
purify, from porcine cerebellum, a 40-kDa protein kinase that in
membrane reconstitution experiments was able to phosphorylate the
m3-muscarinic receptor in an agonist-dependent manner (23).
Amino acid sequence analysis identified this protein kinase as casein
kinase 1 (CK1 ) (24). Importantly, the ability of CK1 to drive
receptor phosphorylation was not restricted to the m3-muscarinic
receptor since both rhodopsin and the m1-muscarinic receptor were also
shown to be in vitro substrates that were phosphorylated in
a stimulus-dependent manner (24, 25). These in
vitro studies suggested that CK1 may act as a cellular kinase
for specific GPCRs, thereby offering an alternative and distinct route
to GPCR phosphorylation from that of the GRKs.
In the present study we explore this hypothesis further by using a
catalytically inactive mutant of CK1 and a peptide corresponding to
the third intracellular loop of the m3-muscarinic receptor to inhibit
endogenous CK1 activity. These experiments provide evidence for a
cellular role of CK1 in the phosphorylation and regulation of the
m3-muscarinic receptor.
 |
MATERIALS AND METHODS |
Cell Culture--
COS-7, HEK-293, and CHO cells were grown in
medium consisting of -minimum Eagle's medium supplemented with 10%
fetal calf serum, 100 IU/ml penicillin, 100 µg/ml streptomycin, and
2.5 µg/ml fungizone. Cells were grown in a 5% CO2, 95%
air, humidified incubator at 37 °C.
Generation Of F-CK1 K46R--
Wild type bovine casein kinase
1 that had been tagged at the N terminus with the FLAG epitope
(F-CK1 ) and cloned into pcDNA-3 (Invitrogen, see Ref. 24) was
used as a template for the Quikchange site-directed mutagenesis kit
(Stratagene). The mutagenesis primer used was
GAGGAGGTGGCAGTGCGACTAGAATCCCAGAAGGCGAGGCATCCCCAGTTG. This created a
Lys-Arg change at position 46 in the amino acid sequence of CK1 . The
resulting construct F-CK1 K46R was contained in pcDNA-3 and also
possessed a FLAG epitope tag on the N terminus. The mutation was
confirmed by DNA sequencing.
Generation of the Third Intracellular Loop Peptide (3i Loop
Peptide)--
The sequence encoding amino acids
Ser345-Leu463 from the third intracellular
loop of the m3-muscarinic receptor was amplified using the polymerase
chain reaction primers, 5' primer,
GGGGGTACCGCCACCATGTCCCTGGAGAACTCCGCCTCCTCCGAC, and 3' primer,
GGGTCTAGACTACAGAGTGGCTTCCTTGAAGGACAGAGG, and cloned into
KpnI and XbaI sites in pcDNA-3. The resulting
construct was then used in transient transfections of HEK-293 cells or
COS-7 cells or used to make stably expressing CHO cell lines.
Generation of the m3-Muscarinic Receptor Deletion Mutant
Lys370-Ser425 Deletion Mutant--
The
m3-muscarinic receptor coding sequence contained in pcDNA-3 was
digested with HindIII and then religated. This removed the
coding sequence for amino acids Lys370-Ser425
inclusive but maintained the reading frame of the remaining cDNA.
Construction of Bacterial Fusion Proteins--
Generation of the
GST bacterial fusion proteins used in this study have been described
previously (23).
Antibody Production--
Production and characterization of the
m3-muscarinic receptor specific antiserum raised against residues
Ser345-Leu463 in the third intracellular loop
of the m3-muscarinic receptor has been previously described (20). The
pan-M antiserum was raised against a peptide (DRYFSVTRPLSYRAKRTPRC)
corresponding to amino acids Asp122-Arg140 of
the m1-muscarinic receptor. This sequence is conserved in the
muscarinic receptor family, and the resulting antiserum would be
expected to cross-react with all of the muscarinic receptor subtypes.
The peptide was conjugated to Keyhole Limpet hemocyanin and injected
into New Zealand White rabbits using standard protocols. Characterization of the antiserum using Western blots showed that the
pan-M antiserum cross-reacted with the m1 and m3 muscarinic receptors.
This antibody was used in immunoprecipitations where the
phosphorylation of the Lys370-Ser425 deletion
mutant was investigated.
The CK1 -specific antiserum was raised against a peptide
corresponding to the N terminus of bovine CK1
(MASSSGSKAEFIVGGKYKLC). Characterization of the antiserum using Western
blots showed that it was able to cross-react with purified recombinant
bovine CK1 and endogenous CK1 present in CHO, HEK-293, COS-7
cells, and rat brain.
Transient Transfections of HEK-293, CHO, and COS-7
Cells--
Cells were plated onto 12-well dishes 24 h before
transfection (cells were 40-60% confluent at the start of
transfection). Cells were transfected with m3-muscarinic receptor
cDNA (contained in pcDNA-3) or co-transfected with
m3-muscarinic receptor plus F-CK1 K46R or 3i loop peptide constructs.
The transfection reagent used was Fugene (Roche Molecular Biochemicals)
using a total DNA concentration of 0.5 µg/well.
In experiments to determine inositol (1,4,5)-trisphosphate levels,
HEK-293 cells were plated onto 24-well dishes, and each well was
transfected with 0.25 µg of DNA. Cells were used 48-72 h after transfection.
Stable Transfection Of CHO Cells with the Third Intracellular
Loop Peptide (3i Loop Peptide)--
CHO-K1 cells were transfected with
the 3i loop peptide construct (described above) using the Fugene
method. Clones expressing the peptide were selected in G418 (200 µg/ml) and screened for expression by Western blot using the
m3-muscarinic receptor antiserum that was raised against this peptide
(20). The resulting stably transfected clones were then used in
experiments where the m3-muscarinic receptor was transiently transfected.
Immunoprecipitation of Phosphorylated m3-Muscarinic Receptor and
Third Intracellular Loop Peptide--
Cells plated onto 12-well dishes
were washed in phosphate-free Krebs/HEPES buffer (10 mM
HEPES, 118 mM NaCl, 4.3 mM KCl, 1.17 mM MgSO4·7H2O, 1.3 mM
CaCl2, 25.0 mM NaHCO3, 11.7 mM glucose, pH 7.4) and incubated in phosphate-free
Krebs/HEPES supplemented with [32P]orthophosphate (50 µCi/ml) for 1-2 h at 37 °C. Either vehicle or the cholinergic
agonist, carbachol (0.1 mM), was added, and incubations
were continued for a further 5 min. Reactions were terminated by rapid
aspiration of the drug-containing media and application of 1 ml of
ice-cold solubilization buffer (10 mM Tris, 10 mM EDTA, 500 mM NaCl, 1% Nonidet P-40, 0.5%
deoxycholate, pH 7.4). Samples were left on ice for 15 min and then
cleared by microcentrifugation. Antiserum (0.2 µg) was added, and the
samples were left on ice for 60-90 min. Immune complexes were isolated on protein A-Sepharose beads, and the beads were washed three times
with TE buffer (10 mM Tris-HCl, 10 mM EDTA, pH
7.4). In the case of receptor immunoprecipitations, the protein
A-Sepharose pellet was then resuspended in 1 ml of TE, and an aliquot
of the protein A slurry was removed corresponding to a known quantity of receptors as determined by radioreceptor assay (see below). This
ensured that for each experiment the same number of receptors from each
transfection was run on the gel. Isolated immune complexes were then
resolved on 8% SDS-PAGE gels in the case of muscarinic receptors or
15% gels for the 3i loop peptide. The gels were dried and subjected to
autoradiography, and the level of phosphorylation was assessed with a
Bio-Rad model GS 670 densitometer.
Quantification of m3-Muscarinic Receptor
Expression--
m3-Muscarinic receptor expression for each
transfection was determined by incubating cells plated down onto
12-well dishes with 0.5 ml of Krebs/HEPES buffer (as above but
containing KH2PO4 1.17 mM)
containing a saturating concentration of muscarinic receptor antagonist
[3H]N-methylscopolamine (~0.5
nM) for 60 min at 37 °C. Cells were washed with ice-cold
Krebs/HEPES buffer (3 times), and bound
[3H]N-methylscopolamine was determined by
liquid scintillation counting of cell extracts solubilized in
solubilization buffer. Nonspecific binding was determined in the
presence of 10 µM atropine and was <3% of the total binding.
Mass Ins(1,4,5)P3 Determination--
Cells grown in
24-well dishes were washed with Krebs/HEPES buffer and challenged with
agonist for the appropriate times. Incubations were terminated by rapid
aspiration, addition of ice-cold 0.5 M trichloroacetic
acid, and transfer to an ice bath. After 15 min the supernatant was
removed and neutralized by addition of EDTA and Freon/tri-N-octylamine
as described previously (21). Extracts were brought to pH 7 by addition
of NaHCO3 and stored at 4 °C until analysis.
Ins(1,4,5)P3 mass measurements were performed using a
radioreceptor assay described previously (26).
GST Fusion Protein Pull Down Assay--
The hippocampus and
cerebral cortex from one rat was homogenized in 15 ml of TE buffer (10 mM Tris-HCl, 2.5 mM EDTA, pH 7.4) by a 5-s
pulse in a Polytron (maximum setting). A soluble brain fraction was
prepared by centrifugation at 50,000 × g for 15 min. The supernatant was taken and used in the pull down experiment.
GST-m3-muscarinic receptor fusion proteins (5 µg) were incubated with
soluble rat brain extract (50 µg) for 1 h at 4 °C. GST fusion
protein complexes were isolated on glutathione-Sepharose beads and
washed three times in TE buffer. Beads were resuspended in Laemmli
buffer and resolved by 12% SDS-PAGE. The presence of CK1 was then
determined by Western blot using the casein kinase 1 -specific antibody.
In Vitro Kinase Assay for FLAG-tagged Casein Kinase 1
(F-CK1 ) and F-CK1 K46R--
HEK-293 cells were transiently
transfected with either recombinant bovine FLAG-tagged F-CK1 ,
FLAG-tagged F-CK1 K46R, or vehicle. 72 h after transfection
cells were lysed with 1 ml of ice-cold lysis buffer (20 mM
Tris-HCl, 0.5% Nonidet P-40, 250 mM NaCl, 3 mM
EDTA, 3 mM EGTA, 2 mM
Na3VO4, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, pH 7.6). The lysate was
centrifuged at 21,000 × g for 5 min at 4 °C and the
pellet discarded. To the lysate was added mouse M2 anti-FLAG antibody
(0.1 µg) for 1 h at 4 °C followed by rabbit anti-mouse IgG (1 µg) for 20 min at 4 °C. The immune complexes isolated on protein
A-Sepharose beads and washed twice with lysis buffer and twice with
kinase buffer (10 mM Tris-HCl, 1 mM
MgCl2, pH 7.4). The immune complex was then used in a
kinase assay by resuspending the protein A beads in kinase buffer
containing 20 µM [ -32P]ATP (2.5 µCi/nmol), 5 µg of -casein (total volume = 30 µl). The
reactions were allowed to proceed for 15 min at 37 °C and were
terminated by the addition of Laemmli buffer (10 µl). Samples were
resolved on a 12% SDS-PAGE gel which were then stained with Coomassie
Blue to visualize -casein, and an autoradiograph was obtained.
 |
RESULTS |
Generation of a Catalytically Inactive Mutant of CK1 --
To
investigate whether the cellular kinase responsible for m3-muscarinic
receptor phosphorylation was CK1 , we tested the ability of a
catalytically inactive form of CK1 to inhibit agonist-mediated m3-muscarinic receptor phosphorylation. Lysine 46 in bovine CK1 corresponds to the conserved lysine found at the ATP-binding site of
all protein kinases (27). By point mutagenesis we constructed a lysine
to arginine mutation at position 46 (called F-CK1 K46R) that
would be predicted to result in a catalytically inactive kinase.
Expression of F-CK1 K46R was confirmed in transiently transfected
HEK-293 cells by Western blotting for the FLAG epitope that was
engineered at the N terminus (Fig.
1A). Due to the epitope tag
the recombinant mutant ran at a slightly higher molecular mass than the
endogenous CK1 . Hence by Western blotting with a polyclonal CK1
antiserum that detected both endogenous CK1 and recombinant mutant
kinase, we estimated that F-CK1 K46R and endogenous CK1 were
expressed at approximately equivalent levels (Fig. 1B).
Similar results were obtained for F-CK1 K46R expressed in COS-7 cells
(data not shown).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of the catalytically inactive
F-CK1 K46R mutant. A, HEK-293
cells were transfected with (K46R) or without (CNT) the F-CK1 K46R
construct. Cells were lysed, and an aliquot (~20 µg of protein) of
the cell lysis was resolved on a 12% SDS-PAGE gel and immunoblotted
with the M2 anti-FLAG epitope antiserum. B, cell lysis from
transfected cells (~20 µg of protein) were resolved on a 12% gel
and immunoblotted using the CK1 -specific antiserum. C,
in vitro kinase assays were used to assess the activity of
F-CK1 K46R. Cells transfected with recombinant FLAG epitope-tagged
bovine F-CK1 (CK1 ) or F-CK1 K46R (K46R) or non-transfected
(CNT) were lysed, and the M2 anti-FLAG antiserum was used to
immunoprecipitate the recombinant kinases. The immunoprecipitate was
then used in an in vitro kinase assay with -casein as the
substrate. The proteins were resolved by 12% SDS-PAGE, and the gel was
stained with Coomassie Blue to visualize the -casein. Gels were then
dried, and an autoradiograph was obtained. The positions of molecular
mass markers are shown in kilodaltons. The experiments shown are
representative of at least three experiments.
|
|
In order to determine enzymatic activity, HEK-293 cells were
transiently transfected with recombinant bovine F-CK1 or
F-CK1 K46R, both of which were tagged at the N terminus with the FLAG
epitope. In vitro kinases assays on FLAG antiserum
immunoprecipitates revealed that the F-CK1 K46R had no detectable
kinase activity (Fig. 1C).
F-CK1 K46R Decreases Agonist-mediated Receptor Phosphorylation in
Intact Cells--
Human m3-muscarinic receptors transfected into
HEK-293 or COS-7 cells were phosphorylated in an
agonist-dependent manner by endogenous protein kinase(s)
(Fig. 2). Co-transfection of the m3-muscarinic receptor with F-CK1 K46R resulted in a decrease in
agonist-mediated receptor phosphorylation by 40.1 ± 2.0%
(n = 3, ±S.E.) and 43.1 ± 3.5%
(n = 3, ±S.E.) in HEK-293 cells and COS-7 cells,
respectively (Fig. 2). In these experiments cells were stimulated with
a maximum concentration of agonist (carbachol; 100 µM)
for 5 min, conditions that we have previously reported results in
maximum phosphorylation of the receptor (20).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2.
Expression of
F-CK1 K46R reduces agonist-mediated
phosphorylation of the m3-muscarinic receptor. Cells expressing
the m3-muscarinic receptor alone (CNT) or co-transfected
with F-CK1 K46R (K46R) were prelabeled with
[32P]orthophosphate and stimulated with 0.1 mM carbachol (CCh) for 5 min. m3-muscarinic
receptor phosphorylation was then determined by immunoprecipitation
using an m3-muscarinic receptor antiserum. An equal number of
muscarinic receptors was then applied to an 8% SDS-PAGE gel, and an
autoradiograph was obtained. A, a representative gel from an
experiment using transiently transfected HEK-293 cells. In this example
m3-muscarinic receptor levels were ~1.2 pmol/mg protein.
B, a representative gel from an experiment using transiently
transfected COS-7 cells. In this example m3-muscarinic receptor levels
were ~0.8 pmol/mg protein. The data shown are representative of at
least three experiments. The positions of molecular mass markers are
shown in kilodaltons.
|
|
In each experiment receptor expression was determined, and the amount
of receptor applied to the gel was adjusted so that equal receptor
numbers were run on the gel. Co-expression of the F-CK1 K46R with the
receptor did not influence the level of m3-muscarinic receptor
expression. Any differences we observed in the level of receptor
expression between control and co-transfected cells (usually <30%)
were probably due to experimental variations in transfection efficiencies.
A Peptide Corresponding to the Third Intracellular Loop of the
m3-Muscarinic Receptor Inhibits Receptor Phosphorylation--
Earlier
studies from our laboratory demonstrated that a bacterial fusion
protein containing a portion of the third intracellular loop of the
m3-muscarinic receptor (Ser345-Leu463) was
able to inhibit CK1 -mediated muscarinic receptor phosphorylation in
membranes (Ref. 23; also see "Discussion"). Here we tested the
ability of this peptide to inhibit m3-muscarinic receptor phosphorylation in intact cells.
Expression of the transfected peptide, of ~12.5 kDa, corresponding to
amino acids Ser345-Leu463 (3i loop peptide) of
the m3-muscarinic receptor was detected by Western blotting using an
m3-muscarinic receptor antiserum that was raised against this peptide
(20) (Fig. 3). Transient co-expression of
m3-muscarinic receptors with the 3i loop peptide in COS-7 cells
resulted in a decrease in agonist-mediated m3-muscarinic receptor
phosphorylation by 72.0 ± 5.9% (n = 3, ±S.E.)
(Fig. 4). Interestingly, the basal
phosphorylation seen in COS-7 cells was also reduced (~60%) by the
3i loop peptide (Fig. 4). In HEK-293 cells m3-muscarinic receptor
phosphorylation was also inhibited by expression of the 3i loop
peptide, in this case by 45.9 ± 2.9% (n = 3, ±S.E.) (Fig. 4).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of the third intracellular loop
peptide Ser345-Leu463 (3i loop peptide).
A, diagrammatic representation showing the region in the
m3-muscarinic receptor that corresponds to the 12.5-kDa 3i loop
peptide. B, Western blot using the m3-muscarinic receptor
antiserum of cell lysates from cells not transfected (NT) or
transfected with the intact m3-muscarinic receptor (m3-R) or
the 3i loop peptide (3i-P). The results shown are
representative of three experiments. The position of molecular mass
markers are shown in kilodaltons.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
Expression of the 3i loop peptide reduces
basal and agonist-mediated phosphorylation of the m3-muscarinic
receptor. Cells expressing the m3-muscarinic receptor alone
(CNT) or co-transfected with the 3i loop peptide
(3i-P) were prelabeled with
[32P]orthophosphate and stimulated with 0.1 mM carbachol (CCh) for 5 min. m3-muscarinic
receptor phosphorylation was then determined by immunoprecipitation
using an m3-muscarinic receptor antiserum. An equal number of
muscarinic receptors was then applied to an 8% SDS-PAGE gel, and an
autoradiograph was obtained. A, a representative gel from an
experiment using transiently transfected COS-7 cells. In this example
m3-muscarinic receptor levels were ~1.7 pmol/mg protein.
B, a representative gel from an experiment using transiently
transfected HEK-293 cells. In this example m3-muscarinic receptor
levels were ~1.2 pmol/mg protein. C, a representative gel
from an experiment where native CHO-K1 cells (CNT) or cells
that were stably expressing the 3i loop peptide (3i-P) were
transiently transfected with the m3-muscarinic receptor. In the
experiment shown m3-muscarinic receptor levels were ~0.5 pmol/mg
protein. The data shown are representative of at least three
experiments. The position of molecular mass markers are shown in
kilodaltons.
|
|
We also developed a stable CHO cell line that expressed the 3i loop
peptide constitutively. This cell line was transiently transfected with
the m3-muscarinic receptor and receptor phosphorylation compared with
native CHO-K1 cells transiently transfected with the receptor. In these
experiments expression of the 3i loop peptide reduced agonist-mediated
phosphorylation of the m3-muscarinic receptor by 75.2 ± 3.4%
(n = 4, ±S.E.). Furthermore, basal phosphorylation was
also reduced in the presence of the 3i loop peptide (by ~50%).
The 3i loop peptide expressed in CHO cells was itself phosphorylated,
but this phosphorylation was not altered by m3-muscarinic receptor
stimulation (Fig. 5). The same results
were obtained in COS-7 and HEK-293 cells (data not shown).

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 5.
Phosphorylation of the 3i loop peptide.
Native CHO-K1 cells (CNT) or CHO cells stably expressing the
3i loop peptide (3i-P) were transiently transfected with the
m3-muscarinic receptor. Cells were prelabeled with
[32P]orthophosphate and stimulated with 0.1 mM carbachol for 5 min. Cells were then lysed with
solubilization buffer, and the 3i loop peptide was immunoprecipitated
using the m3-muscarinic receptor-specific antiserum. The
immunoprecipitate was resolved on a 15% SDS-PAGE gel. The data shown
are representative of three experiments. The positions of molecular
mass markers are shown in kilodaltons.
|
|
Determination of a Putative CK1 -binding Site on the
m3-Muscarinic Receptor--
CK1 contained in a crude soluble rat
brain fraction specifically associated with the muscarinic receptor
portion of a glutathione S-transferase (GST) bacterial
fusion protein that contains the third intracellular loop sequence
Ser345-Leu463, designated Ex-m3 (Fig.
6). This interaction appeared
particularly strong since washes in salt (KCl) up to a concentration of
2 M was not sufficient to disrupt binding of CK1 (data
not shown). Deletion mutants of Ex-m3 were used to map the binding site
of CK1 (Fig. 7A).
Truncation at the N- and C-terminals of Ex-m3 did not affect the
ability of the fusion protein to interact with CK1 present in rat
brain supernatant (Fig. 7B) or recombinant bovine CK1
partially purified from infected sf-9 cells (data not
shown). However, deletion of the region
Lys370-Ser425
( Lys370-Ser425) resulted in no detectable
binding of CK1 (Fig. 7B). A smaller deletion of 18 amino
acids (His374-Val391) also resulted in a
fusion protein that was unable to associate with CK1 (Fig.
7B). (Note, the identity of the doublet in the Ex-m3 pull
down (lane 2, Fig. 7C) is likely to be CK1
running at its correct molecular mass (the lower band) and
CK1 that is still associated with Ex-m3 (upper band). The
doublet in lane 5 (Fig. 7C) is likely to be
CK1 (the upper band) and an unknown protein that
cross-reacts with the CK1 antiserum (lower band).)

View larger version (84K):
[in this window]
[in a new window]
|
Fig. 6.
Complex formation between
CK1 and a GST fusion protein corresponding to
the third intracellular loop of the m3-muscarinic receptor. Either
GST (5 µg) or the GST fusion protein, Ex-m3, that contains the third
intracellular loop sequence Ser345-Leu463
(Ex-m3, 5 µg) were incubated with a soluble rat brain lysate
preparation (50 µg of protein). Bacterial fusion proteins were then
isolated on glutathione-Sepharose beads and resolved on a 12% gel. The
gel was then immunoblotted using the CK1 -specific antiserum.
Recombinant FLAG-tagged F-CK1 purified from infected insect
sf-9 cells was used as a standard (CK1 ). Note that due to
the FLAG tag at the N terminus the standard runs at a slightly higher
molecular mass than the brain CK1 . The position of molecular mass
markers are shown in kilodaltons.
|
|

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 7.
Determination of the site of interaction
between CK1 and the third intracellular loop
of the m3-muscarinic receptor. A, diagrammatic
representation of the muscarinic receptor portion of the GST fusion
proteins showing deleted regions. Also shown in triangles
are the positions of the serine residues. B, Coomassie Blue
stain of the fusion proteins used in the GST fusion protein pull down
assay. C, immunodetection of CK1 isolated from pull down
experiments where fusion proteins (5 µg) were incubated with rat
brain lysate (50 µg of protein). The data shown are representative of
four experiments. The position of molecular mass markers are shown in
kilodaltons. Key to lanes, lane CK1 , purified
recombinant F-CK1 standard; lane B, no fusion protein
added; lane 1, GST; lane 2, Ex-m3; lane
3, Lys370-Ser425; lane 4, Ex-345-427; lane 5, Ex-376-463; lane 6, His376-Val391.
|
|
Deletion of the Region Lys370-Ser425 from
the Third Intracellular Loop of the m3-Muscarinic Receptor Results in
Reduced Agonist-mediated Phosphorylation--
Our previous studies
have demonstrated that CK1 -mediated phosphorylation of the bacterial
fusion protein Lys370-Ser425 is reduced
from that of the full-length fusion protein, Ex-m3 (23). It was,
therefore, decided to make the same deletion in the intact
m3-muscarinic receptor with the aim to produce a receptor unable to
undergo agonist-mediated phosphorylation.
Hence a stable CHO cell line was generated expressing a m3-muscarinic
receptor containing a Lys370-Ser425 deletion
in the third intracellular loop. The clone used (clone 17) was
carefully selected to have a similar receptor expression level as the
control CHO cell line expressing the wild type m3-muscarinic receptor
(Lys370-Ser425 deletion mutant expression = 782 ± 67 fmol/mg protein; wild type receptor expression = 908 ± 124 fmol/mg protein).
Deletion of this region did not significantly (p > 0.05 Student's t test) affect agonist or antagonist binding
properties of the receptor. KD values for antagonist
binding ([3H]N-methylscopolamine) were 0.23 and 0.20 nM for the
Lys370-Ser425 deletion mutant and wild type
m3-muscarinic receptor, respectively. KD values for
agonist binding (carbachol) to membranes in the absence of GTP were
62.8 and 78.6 µM for the
Lys370-Ser425 deletion mutant and wild type
m3-muscarinic receptor, respectively.
Since the polyclonal m3-muscarinic receptor-specific antiserum used
throughout this study was raised against the region
Ser345-Leu463, it was possible that the
Lys370-Ser425 deletion mutant may have
epitopes removed that would prevent immunoprecipitation by this
antiserum. For this reason an alternative antiserum was raised against
a peptide conserved among the muscarinic receptor family
(Asp122-Arg140 in the 2nd intracellular loop of
the m1-muscarinic receptor). This antiserum recognized both m1- and
m3-muscarinic receptors as determined by Western blot (data not shown)
and was designated pan-M.
By using the pan-M antiserum in immunoprecipitation studies, it was
found that the level of agonist-mediated phosphorylation of the
receptor containing the Lys370-Ser425 deletion
was dramatically reduced (~80%) compared with wild type receptor
(Fig. 8). Note that the
Lys370-Ser425 deletion mutant runs at ~90
kDa compared with the wild type muscarinic receptor that runs at ~110
kDa.

View larger version (103K):
[in this window]
[in a new window]
|
Fig. 8.
Deletion of the region
Lys370-S425 from the m3-muscarinic receptor
reduces the level of agonist-mediated phosphorylation. Native
CHO-K1 cells (CHO) or CHO cells stably transfected with the wild type
m3-muscarinic receptor (WT) or
Lys370-Ser425 deletion mutant (K-S)
were prelabeled with [32P]orthophosphate and stimulated
with 0.1 mM carbachol (CCh) for 5 min. The
receptors were solubilized and immunoprecipitated using the pan-M
antiserum. The results shown are representative of four experiments.
The position of molecular mass markers in kilodaltons is shown.
|
|
The pan-M antiserum did, however, cross-react with phosphoproteins
other than the m3-muscarinic receptor as evident by bands at ~120 and
~82 kDa in non-transfected control cells (Fig. 8.). The identities of
these proteins are not known.
Analysis of the Ins(1,4,5)P3 Response in the
Lys370-Ser425 Deletion Mutant of the
m3-Muscarinic Receptor--
These experiments were carried out on CHO
cells stably expressing either the wild type m3-muscarinic receptor or
the Lys370-Ser425 deletion mutant. Analysis of
the wild type m3-muscarinic receptor Ins(1,4,5)P3 response
to agonist challenge showed a characteristic peak of
Ins(1,4,5)P3 production followed by a plateau phase (Fig. 9A) consistent with previous
reports (21, 28). Also consistent with previous studies was the
demonstration that the peak Ins(1,4,5)P3 response could be
desensitized by 41.5% following a 5-min pre-stimulation with
agonist (Fig. 9A) (21, 28).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 9.
Ins(1,4,5)P3 determinations in
CHO cells stably expressing the wild-type m3-muscarinic receptor or the
Lys370-Ser425 deletion mutant. CHO cells
were either pretreated with vehicle (Control) or carbachol
(1 mM; pre-stimulated) for 5 min. The cells were washed (3 times) and challenged with carbachol (1 mM) for the
indicated times. Ins(1,4,5)P3 levels were then determined
as described under "Materials and Methods." A,
Ins(1,4,5)P3 levels in CHO cells stably transfected with
the wild type m3-muscarinic receptor; expression levels = 908 ± 124 fmol/mg protein (n = 3). B,
Ins(1,4,5)P3 levels in CHO cells stably transfected with
the Lys370-Ser425 deletion mutant; expression
levels = 782 ± 67 fmol/mg protein (n = 3).
C, comparison of the control Ins(1,4,5)P3
responses for wild type m3-muscarinic receptors and the
Lys370-Ser425 deletion mutant. The data shown
are the mean value ± S.E. (n = 3).
|
|
The temporal profile of the Ins(1,4,5)P3 response on
agonist stimulation of the Lys370-Ser425
deletion mutant was similar to the wild type receptor (Fig.
9B). Importantly, despite the fact that agonist-mediated
phosphorylation of the Lys370-Ser425 deletion
mutant was dramatically reduced, this receptor was still desensitized
by 51.2% following a 5-min agonist pre-stimulation (Fig.
9B).
There was, however, a dramatic difference in the magnitude of the peak
Ins(1,4,5)P3 responses between the
Lys370-Ser425 deletion mutant and wild type
m3-muscarinic receptor (Fig. 9C). The control wild type
receptor peak response was 249.7 ± 5.4 pmol of
Ins(1,4,5)P3/mg protein compared with 517.3 ± 72.0 pmol of Ins(1,4,5)P3/mg protein (n = 3 ± S.E.) in the case of the Lys370-Ser425
deletion mutant. This increased in Ins(1,4,5)P3 production
observed on stimulation of the mutant receptor was restricted to the
peak response since the plateau responses for the mutant and wild type receptors were similar (Fig. 9C). Interestingly, despite the
greater responsiveness of the Lys370-Ser425
deletion mutant in terms of the magnitude of the
Ins(1,4,5)P3 response, there was no significant difference
(p > 0.05 Student's t test) in the potency
of the carbachol-mediated Ins(1,4,5)P3 elevation between
the wild type receptor and the Lys370-Ser425
deletion mutant (EC50 values for wild type and
Lys370-Ser425 deletion mutant receptors were
7.14 ± 3.2 and 9.71 ± 1.9 µM
(n = 3, ±S.E.), respectively).
The ability of the Lys370-Ser425 deletion
mutant to show increased stimulation of inositol phosphate production
was also tested in transiently transfected HEK-293 cells. Such
experiments are free from the potential clonal artifacts of the stably
transfected cell lines. In these experiments the
Lys370-Ser425 deletion mutant peak (10 s)
Ins(1,4,5)P3 response was 24.3 ± 0.4% (n = 3) greater than the wild type receptor response (data not shown). The
fact that the increased responsiveness of the Lys370-Ser425 deletion mutant was not as great
as that observed in the stable transfections may be due to the
different experimental protocol and cell lines; however, the trend is
the same, namely the Lys370-Ser425 deletion
mutant appears to generate a greater Ins(1,4,5)P3 response than the wild type receptor.
Functional Analysis of Transiently Transfected HEK-293 Cells
Co-expressing the m3-Muscarinic Receptor and F-CK1 K46R--
Peak
Ins(1,4,5)P3 responses to agonist stimulation was analyzed
in HEK-293 cells transiently transfected with the m3-muscarinic receptor only or co-transfected with F-CK1 K46R. Following a 5-min pre-stimulation with agonist and a 5-min wash period, the
Ins(1,4,5)P3 response to stimulation of the m3-muscarinic
receptor was desensitized by 28.3% (Fig.
10). In cells co-transfected with the
m3-muscarinic receptor and the catalytically inactive kinase
F-CK1 K46R, a procedure that reduces agonist-mediated receptor
phosphorylation (see above), the peak response was still desensitized
(by 33.8%) following agonist pre-stimulation (Fig. 10).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 10.
Ins(1,4,5)P3 determination in
HEK-293 cells transiently transfected with the m3-muscarinic receptor
alone (m3) or co-transfected with
F-CK1 K46R (m3+K46R).
Cells were either pretreated with vehicle (Control) or
carbachol (1 mM; pre-stimulated) for 5 min. The cells were
washed and challenged with carbachol (1 mM).
Ins(1,4,5)P3 levels were then determined as described under
"Materials and Methods." The data shown are the mean value ± S.E. (n = 3).
|
|
Interestingly, the peak Ins(1,4,5)P3 response in cells
co-transfected with the m3-muscarinic receptor and the F-CK1 K46R
mutant was larger (by ~25%) than the peak response of cells
transfected with the m3-muscarinic receptor alone (Fig. 10). It
therefore appears that transient transfection of F-CK1 K46R resulting
in decreased receptor phosphorylation has no effect on the ability of
the inositol phosphate response to be desensitized but does result in
an increase the magnitude of the Ins(1,4,5)P3 response.
This is consistent with the data from the stably transfected CHO cells
where the Lys370-Ser425 deletion mutant, which
showed reduced receptor phosphorylation, had an increased inositol
phosphate response when compared with wild type receptors (see above).
 |
DISCUSSION |
The present study presents in vivo evidence that CK1
is responsible, at least in part, for agonist-mediated receptor
phosphorylation of the m3-muscarinic receptor expressed in transfected
cell lines. Furthermore, phosphorylation appears not to mediate
receptor desensitization but instead may control the magnitude of the
peak Ins(1,4,5)P3 response. This represents a radical
departure from the widely accepted model for GPCR phosphorylation and
desensitization mediated by the GRKs.
Previous in vitro studies from our laboratory have
established that CK1 is able to mediate
stimulus-dependent phosphorylation of a number of GPCRs
(24, 25) suggesting that CK1 may represent a pathway, distinct from
the GRKs, for receptor phosphorylation in intact cells. In the present
study we have taken advantage of the fact that, like many GPCRs, the
m3-muscarinic receptor is phosphorylated in an
agonist-dependent manner by endogenous receptor kinases
expressed in a number of commonly used cell lines (i.e. CHO,
COS-7, and HEK-293 cells). To investigate whether CK1 was one of
these endogenous receptor kinases, we tested the ability of a
catalytically inactive mutant of CK1 to inhibit m3-muscarinic receptor phosphorylation. By mutating a conserved lysine residue (Lys46) to an arginine (F-CK1 K46R) in sub-domain II of
the catalytic domain of CK1 , known to be essential for
phospho-transfer (27), the catalytic activity of the kinase was lost.
Analogous mutations in other protein kinases, in particular GRK-2, have
been used to generate dominant negative mutants (16). Furthermore,
mutation of this conserved lysine in CK1 has been shown to result in
a dominant negative mutant able to block endogenous CKI -mediated phosphorylation of dishevelled in Xenopus oocytes (29). We
predicted, therefore, that if endogenous CK1 was responsible for
m3-muscarinic receptor phosphorylation then expression of the
F-CK1 K46R mutant would inhibit receptor phosphorylation by acting in
a dominant negative manner. We show here that F-CK1 K46R when
expressed in cells at approximately equivalent levels to the endogenous
CK1 resulted in a dramatic reduction in the level of
agonist-mediated m3-muscarinic receptor phosphorylation, suggesting
that at least a proportion of the receptor phosphorylation was mediated
by endogenous CK1 .
We aimed to confirm this finding by raising an alternative inhibitor to
CK1 . Previous studies have shown that a peptide corresponding to the
third intracellular loop of the m3-muscarinic receptor (Ser345-Leu463) contained in a GST bacterial
fusion protein was able to inhibit m3-muscarinic receptor
phosphorylation in membranes (23). This inhibitory property was
attributed to the ability of the peptides to act as a pseudo-substrate
for CK1 and therefore compete with the receptor for endogenous
CK1 present in the membrane preparation. Additionally, in the
present study we demonstrate that this peptide forms a high affinity
complex with CK1 , and this may also contribute to its inhibitory
properties. In order to investigate the involvement of CK1 in the
phosphorylation of m3-muscarinic receptors in intact cells, we tested
the ability of the third intracellular loop peptide Ser345-Leu463 (3i loop peptide) to inhibit
receptor phosphorylation in transfected cell lines. Expression of the
3i loop peptide resulted in a dramatic reduction in both basal and
agonist-mediated m3-muscarinic receptor phosphorylation. The peptide
itself became phosphorylated suggesting that, as in the membrane
experiments, the peptide was acting as a pseudo-substrate for CK1 .
Although it is possible that the 3i loop peptide may be inhibiting
receptor phosphorylation by interacting with kinases other than CK1 ,
the cellular data presented here is consistent with the earlier
in vitro data and suggests that m3-muscarinic receptor
phosphorylation in intact cells is mediated, at least in part, by
CK1 .
Interestingly, the m3-muscarinic receptor is not the only GPCR found to
be phosphorylated by casein kinase I in intact cells. In a recent
study, stimulus-dependent phosphorylation of the -factor pheromone receptor of Saccharomyces cerevisiae (Ste2p) was
also reported to be mediated by casein kinase I, and this was
associated with control of receptor ubiquitination and endocytosis
(30).
The fact that agonist-mediated phosphorylation of the m3-muscarinic
receptor in the present study was not completely inhibited by either
F-CK1 K46R or the 3i loop peptide indicates that either the
inhibitors are not expressed in sufficiently high concentrations or
that phosphorylation is mediated by kinases in addition to CK1 . In
the case of the GRK-2 dominant negative mutant, in vitro studies have demonstrated that a 10-fold molar excess of the dominant negative mutant was required to inhibit GRK-2-mediated
2-adrenergic receptor phosphorylation by 60% (in the
presence of G-protein  -subunits) (16). In the present study we
were only able to achieve a level of F-CK1 K46R expression that was
approximately equivalent to endogenous CK1 . This level of expression
may have been insufficient to inhibit completely the endogenous kinase activity.
An alternative, and attractive, proposition is that CK1 is one of a
number of kinases responsible for agonist-mediated phosphorylation. There is, for example, evidence for the involvement of the GRKs in
muscarinic receptor phosphorylation. The adenylyl cyclase-coupled m2-muscarinic receptor was one of the first receptors to be shown to be
an in vitro substrate for the GRKs (31). Phosphorylation at
sites on the third intracellular loop is thought to mediate m2-muscarinic receptor internalization (6, 32). m3-muscarinic receptors
contained in urea-treated membranes have previously been shown to be
phosphorylated by purified GRK-2 and -3 but not GRK-5 and -6 (11). A
peptide corresponding to the third intracellular loop of the
m3-muscarinic receptor has also been shown to be a substrate for GRK-2
in in vitro studies (33). Furthermore, the purified
m1-muscarinic receptor is phosphorylated in an
agonist-dependent manner following reconstitution with
GRK-2 (12). These in vitro reconstitution studies indicate
that certain GRKs have the potential to phosphorylate members of the
muscarinic receptor family coupled via both Gi and
Gq/11 G-proteins, although direct evidence that this is the
case in cells has yet to be presented. Hence, placed in context with
previous studies our data suggest the intriguing possibility that the
m3-muscarinic receptor may be phosphorylated by CK1 and possibly one
or more of the GRKs. Ongoing studies in our laboratory mapping the
phosphorylation sites on the m3-muscarinic receptor may reveal
phospho-acceptor sites that cannot be assigned to CK1 and thereby
indicate the involvement of other receptor kinases.
The functional consequences of receptor phosphorylation were
investigated in a receptor where the region
Lys370-Ser425 in the third intracellular loop
had been deleted. Compared with the wild type receptor this mutant
showed an ~80% decrease in agonist-mediated receptor
phosphorylation. The region deleted included the putative
CK1 -binding site, identified in this study to reside in the domain
His374-Val391. Although the reduction in the
ability of the Lys370-Ser425 deletion mutant
to undergo agonist-mediated receptor phosphorylation might be explained
by the loss of the putative CK1 -binding site, it must be noted that
this deletion also removed eight serine residues that may act as
potential phospho-acceptor sites. Furthermore, the results reported
here are consistent with our previous studies using bacterial fusion
proteins where we showed that deletion of either
Lys370-Ser425 or
His374-Val391 from a bacterial fusion protein
expressing the majority of the third intracellular loop
(i.e. Ser345-Leu463, termed Ex-m3)
resulted in a dramatic reduction in the level of phosphorylation
mediated by purified CK1 (23).
Functional analysis of the wild type m3-muscarinic receptor
Ins(1,4,5)P3 response revealed a characteristic
peak/plateau response to agonist stimulation where the peak response at
5-10 s was desensitized by a pre-stimulation with agonist. Previously
we have speculated that due to the rapid time course of
agonist-mediated m3-muscarinic receptor phosphorylation, and the large
weight of evidence in the literature linking receptor phosphorylation
to GPCR desensitization, that phosphorylation was the mechanism
underlying the desensitization of the peak Ins(1,4,5)P3
response (20, 25, 34). To our surprise the
Lys370-Ser425 deletion mutant receptor showed
a peak/plateau Ins(1,4,5)P3 response with a temporal
profile very similar to the wild type receptor. Furthermore,
pre-stimulation of the Lys370-Ser425 deletion
mutant resulted in desensitization of the peak Ins(1,4,5)P3 response. These data suggest that agonist-mediated phosphorylation of
the m3-muscarinic receptor was not involved in the desensitization of
the peak Ins(1,4,5)P3 response. It is, however, possible
that the small amount of phosphorylation that remains in the
Lys370-Ser425 deletion mutant receptor,
possibly mediated by one or more of the GRKs (see above), may be
sufficient to induce desensitization of the peak
Ins(1,4,5)P3 response.
Recent studies have identified a number of GPCRs that undergo
phosphorylation-independent desensitization. For example, heterologous desensitization of the formyl-methionyl-leucyl-phenylalanine and the
bradykinin B2 receptors are not associated with receptor
phosphorylation (35-37). A similar lack of correlation between
receptor phosphorylation and desensitization has also been reported for
the chemoattractant receptor of Dictyostelium where removal
of the phospho-acceptor sites does not affect desensitization of the
adenylyl and guanylyl cyclase responses (38). The possibility that
desensitization of the m3-muscarinic receptor is a result of mechanisms
downstream of the receptor is currently being pursued in our laboratory.
In the present study the Lys370-Ser425
deletion mutant gave a more robust Ins(1,4,5)P3 response
when compared with the wild type receptor (2-3 fold). This was not due
to changes in agonist affinities for the receptor nor changes in the
efficacy of the agonist but may reflect an enhanced coupling of the
receptor to Gq/11. An increase in the magnitude of the
Ins(1,4,5)P3 response was also seen in cells where
m3-muscarinic receptor phosphorylation was reduced by co-transfection
with F-CK1 K46R, suggesting that receptor phosphorylation mediated by
CK1 was able to control the magnitude of the
Ins(1,4,5)P3 response. An enhanced inositol phosphate
signal has previously been reported for truncation mutants of the
platelet-activating factor (39) and neurokinin-2 receptors (40) where
putative phospho-acceptor sites had been removed. In these cases
receptor-stimulated phospholipase C activity appeared to be
"up-regulated" by removing phospho-acceptor sites resulting in
augmented signaling. It appears, therefore, that receptor
phosphorylation may play a role in controlling the magnitude of the
inositol phosphate response mediated by m3-muscarinic receptors and
possibly other phospholipase C-coupled GPCRs.
In summary we show that inhibition of endogenously expressed CK1
reduces agonist-mediated phosphorylation of the m3-muscarinic receptor.
These data support our earlier studies suggesting that CK1 is a
receptor kinase involved in GPCR phosphorylation. Furthermore, by using
a receptor mutant that shows reduced agonist-mediated phosphorylation,
we show that phosphorylation is not associated with desensitization of
the peak Ins(1,4,5)P3 response but may instead be involved
in controlling the magnitude of the inositol phosphate response.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Gary Willars for careful reading
of the manuscript and Prof. Steve Nahorski for many helpful discussions
and suggestions.
 |
FOOTNOTES |
*
This work was supported by the Wellcome Trust Grant
047600/Z/96.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 0116-2522935;
Fax: 0116-252 5045; E-mail: TBA@le.ac.uk.
Published, JBC Papers in Press, April 20, 2000, DOI 10.1074/jbc.M000492200
 |
ABBREVIATIONS |
The abbreviations used are:
GPCR, G-protein-coupled receptor;
CK1 , casein kinase 1 ;
GRK, G-protein-coupled receptor kinase;
Ins(1, 4,5)P3,
inositol (1,4,5) trisphosphate;
CHO, Chinese hamster ovary;
PAGE, polyacrylamide gel electrophoresis;
GST, glutathione
S-transferase.
 |
REFERENCES |
| 1.
|
Tobin, A. B.
(1997)
Pharmacol. Ther.
75,
135-151
|
| 2.
|
Pitcher, J. A.,
Freedman, N. J.,
and Lefkowitz, R. J.
(1998)
Annu. Rev. Biochem.
67,
653-692
|
| 3.
|
Tsuga, H.,
Kameyama, K.,
Haga, T.,
Kurise, H.,
and Nagao, T.
(1994)
J. Biol. Chem.
269,
32522-32527
|
| 4.
|
Ruiz-Gomez, A.,
and Mayor, F., Jr.
(1997)
J. Biol. Chem.
272,
9601-9604
|
| 5.
|
Tsuga, H.,
Okuno, E.,
Kameyama, K.,
and Haga, T.
(1998)
Mol. Pharmacol.
284,
1218-1226
|
| 6.
|
Tsuga, H.,
Kameyama, K.,
Haga, T.,
Honma, T.,
Lameh, J.,
and Sadee, W.
(1998)
J. Biol. Chem.
273,
5323-5330
|
| 7.
|
Daaka, Y.,
Luttrell, L. M.,
and Lefkowitz, R. J.
(1997)
Nature
390,
88-91
|
| 8.
|
Luttrell, L. M.,
Ferguson, S. S. G.,
Daaka, Y.,
Miller, W. E.,
Maudsley, S.,
Della Rocca, G. J.,
Lin, F.-T.,
Kawakatsu, H.,
Owada, K.,
Luttrell, D. K.,
Caron, M. G.,
and Lefkowitz, R. J.
(1999)
Science
283,
655-660
|
| 9.
|
Lefkowitz, R. J.
(1993)
Cell
74,
409-412
|
| 10.
|
Kameyama, K.,
Haga, K.,
Haga, T.,
Kotani, K.,
Katada, T.,
and Fukada, Y.
(1993)
J. Biol. Chem.
268,
7753-7758
|
| 11.
|
DebBurman, S. K.,
Kunapuli, P.,
Benovic, J. L.,
and Hosey, M.
(1994)
Mol. Pharmacol.
47,
224-233
|
| 12.
|
Haga, K.,
Kameyama, K.,
Haga, T.,
Kikkawa, U.,
Shiozaki, K.,
and Uchiyama, H.
(1996)
J. Biol. Chem.
271,
2776-2782
|
| 13.
|
Kwatra, M. M.,
Schwinn, D. A.,
Schreurs, J.,
Blank, J. L.,
Kim, C. M.,
Benovic, J. L.,
Krausse, J. E.,
Caron, M. G.,
and Lefkowitz, R. J.
(1993)
J. Biol. Chem.
268,
9161-9164
|
| 14.
|
Blaukat, A.,
Alla, S. A.,
Lohse, M. J.,
and Muller-Esterl, W.
(1996)
J. Biol. Chem.
271,
32366-32374
|
| 15.
|
Palmer, T. M.,
Benovic, J. L.,
and Stiles, G. L.
(1995)
J. Biol. Chem.
270,
29607-29613
|
| 16.
|
Kong, G.,
Penn, R.,
and Benovic, J. L.
(1994)
J. Biol. Chem.
269,
13084-13087
|
| 17.
|
Diviani, D.,
Lattion, A.-L.,
Kunapuli, P.,
Pronin, A.,
Benovic, J. L.,
and Cotecchia, S.
(1996)
J. Biol. Chem.
271,
5049-5058
|
| 18.
|
Oppermann, M.,
Freedman, N. J.,
Alexander, W. R.,
and Lefkowitz, R. J.
(1996)
J. Biol. Chem.
271,
13266-13272
|
| 19.
|
Freedman, N. J.,
Ament, A. S.,
Oppermann, M.,
Stoffel, R. H.,
Exum, S. T.,
and Lefkowitz, R. J.
(1997)
J. Biol. Chem.
272,
17734-17743
|
| 20.
|
Tobin, A. B.,
and Nahorski, S. R.
(1993)
J. Biol. Chem.
268,
9817-9823
|
| 21.
|
Tobin, A. B.,
Lambert, D. G.,
and Nahorski, S. R.
(1992)
Mol. Pharmacol.
42,
1042-1048
|
| 22.
|
Tobin, A. B.,
Keys, B.,
and Nahorski, S. R.
(1993)
FEBS Lett.
335,
353-357
|
| 23.
|
Tobin, A. B.,
Keys, B.,
and Nahorski, S. R.
(1996)
J. Biol. Chem.
271,
3907-3916
|
| 24.
|
Tobin, A. B.,
Totty, N. F.,
Sterlin, A. E.,
and Nahorski, S. R.
(1997)
J. Biol. Chem.
272,
20844-20849
|
| 25.
|
Waugh, M. G.,
Challiss, R. A. J.,
Berstein, G.,
Nahorski, S. R.,
and Tobin, A. B.
(1999)
J. Biochem. (Tokyo)
338,
175-183
|
| 26.
|
Challiss, R. A. J.,
Batty, I. H.,
and Nahorski, S. R.
(1988)
Biochem. Biophys. Res. Commun.
157,
684-691
|
| 27.
|
Carrera, A. C.,
Alexandrov, K.,
and Roberts, T. M.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
442-445
|
| 28.
|
Fisher, S. K.,
Slowiejko, D. M.,
and McEwen, E. L.
(1994)
Neurochem. Res.
19,
195-204
|
| 29.
|
Peters, J. M.,
McKay, R. M.,
McKay, J. P.,
and Graff, J. M.
(1999)
Nature
401,
345-350
|
| 30.
|
Hicke, L.,
Zanolari, B.,
and Riezman, H.
(1998)
J. Cell Biol.
141,
349-358
|
| 31.
|
Haga, K.,
and Haga, T.
(1992)
J. Biol. Chem.
267,
2222-2227
|
| 32.
|
Nakata, H.,
Kameyama, K.,
Haga, K.,
and Haga, T.
(1994)
Eur. J. Biochem.
220,
29-36
|
| 33.
|
Wu, G.,
Benovic, J. L.,
Hildebrandt, J. D.,
and Lanier, S. M.
(1998)
J. Biol. Chem.
273,
7197-7200
|
| 34.
|
Wojcikiewicz, R. J. H.,
Tobin, A. B.,
and Nahorski, S. R.
(1993)
Trends Pharmacol. Sci.
14,
279-285
|
| 35.
|
Ali, H.,
Richardson, R. M.,
Tomhave, E. D.,
Didsbury, J. R.,
and Snyderman, R.
(1993)
J. Biol. Chem.
268,
24247-24254
|
| 36.
|
Richardson, R. M.,
Ali, H.,
Tomhave, E. D.,
Haribabu, B.,
and Synderman, R.
(1995)
J. Biol. Chem.
270,
27829-27833
|
| 37.
|
Willars, G. B.,
Muller-Esterl, W.,
and Nahorski, S. R.
(1999)
Am. J. Physiol.
277,
C859-C869
|
| 38.
|
Caterina, M. J.,
Devreotes, P. N.,
Borleis, J.,
and Hereld, D.
(1995)
J. Biol. Chem.
270,
8667-8672
|
| 39.
|
Takano, T.,
Honda, Z.-I.,
Sakanaka, C.,
Izumi, T.,
Kameyama, K.,
Haga, K.,
Haga, T.,
Kurokawa, K.,
and Shimizu, T.
(1994)
J. Biol. Chem.
269,
22453-22458
|
| 40.
|
Alblas, J.,
van Etten, I.,
Khanum, A.,
and Moolenaar, W. H.
(1995)
J. Biol. Chem.
270,
8944-8951
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. J. Butcher, I. Torrecilla, K. W. Young, K. C. Kong, S. C. Mistry, A. R. Bottrill, and A. B. Tobin
N-Methyl-D-aspartate Receptors Mediate the Phosphorylation and Desensitization of Muscarinic Receptors in Cerebellar Granule Neurons
J. Biol. Chem.,
June 19, 2009;
284(25):
17147 - 17156.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lariviere, G. Garrel-Lazayres, V. Simon, N. Shintani, A. Baba, R. Counis, and J. Cohen-Tannoudji
Gonadotropin-Releasing Hormone Inhibits Pituitary Adenylyl Cyclase-Activating Polypeptide Coupling to 3',5'-Cyclic Adenosine-5'-Monophosphate Pathway in L{beta}T2 Gonadotrope Cells through Novel Protein Kinase C Isoforms and Phosphorylation of Pituitary Adenylyl Cyclase-Activating Polypeptide Type I Receptor
Endocrinology,
December 1, 2008;
149(12):
6389 - 6398.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Luo, J. M. Busillo, and J. L. Benovic
M3 Muscarinic Acetylcholine Receptor-Mediated Signaling Is Regulated by Distinct Mechanisms
Mol. Pharmacol.,
August 1, 2008;
74(2):
338 - 347.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. V. Gurevich and E. V. Gurevich
Rich Tapestry of G Protein-Coupled Receptor Signaling and Regulatory Mechanisms
Mol. Pharmacol.,
August 1, 2008;
74(2):
312 - 316.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Hashimoto, K. Morisawa, H. Saito, E. Jojima, N. Yoshida, and T. Haga
Muscarinic M4 Receptor Recycling Requires a Motif in the Third Intracellular Loop
J. Pharmacol. Exp. Ther.,
June 1, 2008;
325(3):
947 - 953.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Gonzales, D. L. Mellman, and R. A. Anderson
CKI{alpha} Is Associated with and Phosphorylates Star-PAP and Is Also Required for Expression of Select Star-PAP Target Messenger RNAs
J. Biol. Chem.,
May 2, 2008;
283(18):
12665 - 12673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. So, V. Verma, B. F. O'Dowd, and S. R. George
Desensitization of the Dopamine D1 and D2 Receptor Hetero-Oligomer Mediated Calcium Signal by Agonist Occupancy of Either Receptor
Mol. Pharmacol.,
August 1, 2007;
72(2):
450 - 462.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Torrecilla, E. J. Spragg, B. Poulin, P. J. McWilliams, S. C. Mistry, A. Blaukat, and A. B. Tobin
Phosphorylation and regulation of a G protein-coupled receptor by protein kinase CK2
J. Cell Biol.,
April 9, 2007;
177(1):
127 - 137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Simon, J. Guidry, T. W. Gettys, A. B. Tobin, and S. M. Lanier
The Proto-oncogene SET Interacts with Muscarinic Receptors and Attenuates Receptor Signaling
J. Biol. Chem.,
December 29, 2006;
281(52):
40310 - 40320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. S. Waddell, N. T. Liberati, X. Guo, J. P. Frederick, and X.-F. Wang
Casein Kinase I{epsilon} Plays a Functional Role in the Transforming Growth Factor-{beta} Signaling Pathway
J. Biol. Chem.,
July 9, 2004;
279(28):
29236 - 29246.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. B. Clark and T. C. Rich
Probing the Roles of Protein Kinases in G-Protein-Coupled Receptor Desensitization
Mol. Pharmacol.,
November 1, 2003;
64(5):
1015 - 1017.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Willets, R. Mistry, S. R. Nahorski, and R. A. J. Challiss
Specificity of G Protein-Coupled Receptor Kinase 6-Mediated Phosphorylation and Regulation of Single-Cell M3 Muscarinic Acetylcholine Receptor Signaling
Mol. Pharmacol.,
November 1, 2003;
64(5):
1059 - 1068.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Mitchell, D. N. Robertson, P. J. Holland, D. Collins, E. M. Lutz, and M. S. Johnson
ADP-ribosylation Factor-dependent Phospholipase D Activation by the M3 Muscarinic Receptor
J. Biol. Chem.,
September 5, 2003;
278(36):
33818 - 33830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Budd, J. McDonald, N. Emsley, K. Cain, and A. B. Tobin
The C-terminal Tail of the M3-muscarinic Receptor Possesses Anti-apoptotic Properties
J. Biol. Chem.,
May 23, 2003;
278(21):
19565 - 19573.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Liu, D. M. Virshup, A. C. Nairn, and P. Greengard
Mechanism of Regulation of Casein Kinase I Activity by Group I Metabotropic Glutamate Receptors
J. Biol. Chem.,
November 15, 2002;
277(47):
45393 - 45399.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Gaudreau, C. Le Gouill, M.-H. Venne, J. Stankova, and M. Rola-Pleszczynski
Threonine 308 within a Putative Casein Kinase 2 Site of the Cytoplasmic Tail of Leukotriene B4 Receptor (BLT1) Is Crucial for Ligand-induced, G-protein-coupled Receptor-specific Kinase 6-mediated Desensitization
J. Biol. Chem.,
August 23, 2002;
277(35):
31567 - 31576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Willets, R. A. J. Challiss, and S. R. Nahorski
Endogenous G Protein-coupled Receptor Kinase 6 Regulates M3 Muscarinic Acetylcholine Receptor Phosphorylation and Desensitization in Human SH-SY5Y Neuroblastoma Cells
J. Biol. Chem.,
May 3, 2002;
277(18):
15523 - 15529.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. K. Billington and R. B. Penn
m3 Muscarinic Acetylcholine Receptor Regulation in the Airway
Am. J. Respir. Cell Mol. Biol.,
March 1, 2002;
26(3):
269 - 272.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. R. Watterson, E. Johnston, C. Chalmers, A. Pronin, S. J. Cook, J. L. Benovic, and T. M. Palmer
Dual Regulation of EDG1/S1P1 Receptor Phosphorylation and Internalization by Protein Kinase C and G-protein-coupled Receptor Kinase 2
J. Biol. Chem.,
February 15, 2002;
277(8):
5767 - 5777.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Willets, R. A. J. Challiss, E. Kelly, and S. R. Nahorski
G Protein-Coupled Receptor Kinases 3 and 6 Use Different Pathways to Desensitize the Endogenous M3 Muscarinic Acetylcholine Receptor in Human SH-SY5Y Cells
Mol. Pharmacol.,
August 1, 2001;
60(2):
321 - 330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. G. Ferguson
Evolving Concepts in G Protein-Coupled Receptor Endocytosis: The Role in Receptor Desensitization and Signaling
Pharmacol. Rev.,
March 1, 2001;
53(1):
1 - 24.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Budd, G. B. Willars, J. E. McDonald, and A. B. Tobin
Phosphorylation of the Gq/11-coupled M3-Muscarinic Receptor Is Involved in Receptor Activation of the ERK-1/2 Mitogen-activated Protein Kinase Pathway
J. Biol. Chem.,
February 9, 2001;
276(7):
4581 - 4587.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. E. Brinson and T. K. Harden
Differential Regulation of the Uridine Nucleotide-activated P2Y4 and P2Y6 Receptors. SER-333 AND SER-334 IN THE CARBOXYL TERMINUS ARE INVOLVED IN AGONIST-DEPENDENT PHOSPHORYLATION DESENSITIZATION AND INTERNALIZATION OF THE P2Y4 RECEPTOR
J. Biol. Chem.,
April 6, 2001;
276(15):
11939 - 11948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Dubois, P. Kerai, E. Zemlickova, S. Howell, T. R. Jackson, K. Venkateswarlu, P. J. Cullen, A. B. Theibert, L. Larose, P. J. Roach, et al.
Casein Kinase I Associates with Members of the Centaurin-alpha Family of Phosphatidylinositol 3,4,5-Trisphosphate-binding Proteins
J. Biol. Chem.,
May 25, 2001;
276(22):
18757 - 18764.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Olivares-Reyes, R. D. Smith, L. Hunyady, B. H. Shah, and K. J. Catt
Agonist-induced Signaling, Desensitization, and Internalization of a Phosphorylation-deficient AT1A Angiotensin Receptor
J. Biol. Chem.,
October 5, 2001;
276(41):
37761 - 37768.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|