| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 26, 19723-19727, June 30, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, February 18, 2000, and in revised form, April 9, 2000
We found a cis-regulatory element of
12 base pairs (bp) (GGATTTTACAGT) capable of conferring light
responsiveness to a minimal promoter, CaMV 35S46, in pea. The 12-bp
sequence is located in the 5' upstream region of the light
down-regulated gene pra2, which encodes a small GTPase
belonging to the YPT/rab family. Here we examined gain-of-function
analyses using synthetic promoter-luciferase constructs in a transient
assay and found that the 12-bp element alone was sufficient to confer
dark induction, as well as light down-regulation on the minimal
promoter. We named this dark inducible element
DE1. Effects of various light conditions on the reporter gene activity
showed that DE1 received signals from phytochrome A, phytochrome B, and
blue light photoreceptors. Using phytochrome-deficient mutants, we
showed that the pra2 protein level in seedlings was also regulated by
these photoreceptors. The changes in the immunoblotting pattern of the
pra2 protein in these mutants were correlated with the changes in
epicotyl elongation. Results from transient assays using these mutants
showed that the DE1 received signals from phytochromes A and B,
demonstrating that this element is indeed a light-responsive element.
To our knowledge, this is the first cis-element that by
itself confers light responsiveness to a minimal promoter.
Plants use light not only as an energy source for photosynthesis
but also as an environmental signal. Light signals received by
photoreceptors control many aspects of plant development. There are
several photoreceptors including the blue/UV-A receptor called phototropin, the blue/UV-A light receiving cryptochromes that control
processes such as cotyledon expansion and hypocotyl inhibition (1, 2),
and the red/far-red absorbing phytochromes that control processes such
as seed germination, hypocotyl growth, leaf expansion, and floral
induction (1). Many of these developmental changes are accompanied by
changes in gene expression. The mechanism of light-regulated
transcription has been widely investigated, but the accumulated
evidence has shown that the mechanism is very complex. For example,
whereas cis-elements for up-regulation have been reported,
there is no report of a cis-element that is sufficient to
confer light responsiveness by itself to a minimal promoter (3).
Compared with up-regulation, the mechanism for light down-regulation of
transcription is even less clear. Some genes down-regulated by light
have been identified such as AS1 (4), ATHB-2 (5), NPRs (6), TUB1 (7), and PHYA (8), but
only a few cis-elements for down-regulation have been
reported (8-10), and the details remain unclear.
Previously we have reported that a small GTPase gene in pea,
pra2, which belongs to YPT/rab family (11), is one of the
genes whose expression is down-regulated by phytochrome (12). The pra2 gene is mainly expressed in the growing zone of
etiolated epicotyls, and its expression is repressed when the plant is
illuminated (10, 13). Because small GTPases are molecular switches that are turned on by GTP and off by the hydrolysis of GTP to GDP, and
members of YPT/rab family play important roles during intracellular transport, we propose that pra2 protein may participate in vesicle transport during stem elongation of etiolated seedlings (13). We were
interested in the down-regulation of the pra2 gene, and we
surveyed cis-elements located in the 5' upstream region
using a reporter gene in a transient assay (10). We found that a
12-bp1 sequence in the 5'
upstream region of this gene was important for the light
down-regulation of the reporter gene and that this response was
mediated by phytochrome B. However, we do not know whether the 12-bp
element alone confers light down-regulation to a minimal promoter and
whether the 12-bp element receives signals from photoreceptors other
than phytochrome B. To answer these questions, we have examined the
role of the 12-bp element by gain-of-function analysis in a transient
assay to determine the effect of light conditions on the reporter gene.
We found that the 12-bp element was sufficient to confer light
down-regulation to a minimal promoter and capable of receiving signals
from various photoreceptors. We named this dark inducible
element DE1.
Because the DE1 has a capacity to respond to various light signals,
there is a possibility that expression of the pra2 gene is
indeed regulated by various light signals. Previously we had only shown
the involvement of phytochrome B (10). Here we used mutants to examine
the involvement of other photoreceptors in the regulation of
pra2 expression. In Arabidopsis, 5 phytochrome genes (PHYA-PHYE) have been isolated, and it has
been revealed that each phytochrome has distinct but at times
overlapping functions (14). Many photomorphogenic mutants have been
isolated (15, 16) and shown to be powerful tools for investigating
light-regulated expression (17, 18). In pea, several phytochrome
mutants has been isolated. The pcd1 and pcd2
mutations block steps leading to the formation of the phytochrome
chromophore, phytochromobilin (19, 20), whereas the fun1 and
lv mutants are deficient in phytochrome A and phytochrome B
apoproteins, respectively (21, 22). We have used these mutants to
investigate whether photoreceptors, in addition to phytochrome B, are
involved in the expression of the pra2 protein and whether DE1 confers
light down-regulation as expected.
In this paper, we show that the DE1 is indeed a single light-responsive
element and actually received signals from various photoreceptors.
Plant Materials and Growth Conditions--
For the protein level
measurements, pea seeds (Pisum sativum L.) were soaked in
water and sown on irrigated rock wool. Seedlings were grown in the dark
for 5 days at 25 °C. Before light treatment, the epicotyl between 0 and 1 cm from the apical hook was marked by pen under a dim green safe
light. Plants were then irradiated with brief red (2 min) or far-red (5 min) light, returned to darkness, and kept for 12 h. In the
experiments to examine the high irradiance response (HIR), plants were
continuously irradiated with the appropriate light for 12 h. After
irradiation, the stem length was measured. Proteins were extracted from
the upper 1-cm portion of the epicotyl.
For the transient expression assay, pea seeds were imbibed and sown
individually in plastic pots. Seedlings were grown in the dark for 5 or
6 days at 25 °C. Seedlings were then placed horizontally in the
bombardment device (Model GIE-III, Tanaka Co. Ltd.). The bombardment
procedure was as described by Inaba et al. (10). The gold
particles were coated with a mixture of two kinds of plasmids, a
plasmid containing one of the synthetic promoter-luciferase (LUC)
constructs and a plasmid containing a 35 S-GUS construct as the
internal standard. All steps during bombardments were performed in a
darkroom under a dim green safe light. After bombardment, the seedlings
were illuminated by the appropriate light conditions.
Construction of Synthetic Promoter--
The 35S46-LUC vector was
created by inserting the 35S46 promoter into the promoterless
pBI221-LUC+ vector. The 35S46 promoter was created by PCR. The
oligonucleotide,
5'-TGAGGATTTTACAGTAATTGAGGATTTTACAGTAATTGAGGATTTTACAGTAAT-3' (WT1), containing three copies of the 18-bp sequence,
5'-TGAGGATTTTACAGTAAT-3', was synthesized, phosphorylated, and ligated.
The 18-bp oligonucleotide contained the 12-bp cis-regulatory
element with neighboring 3 bp at both ends. Then, the complementary
oligonucleotide,
5'-ATTACTGTAAAATCCTCAATTACTGTAAAATCCTCAATTACTGTAAAATCCTCA (WT2), was
annealed and subcloned into the EcoRV site of the
pZErO-2 plasmid (Invitrogen, San Diego, CA). A plasmid
containing nine tandem repeats of the 18-bp sequence was obtained. Its
sequence was confirmed. To remove the sequence derived from the
pZErO-2 vector, the nine tandem repeats were amplified by PCR
using two primers that contained BamHI and EcoRV
restriction sites. PCR products were purified by a QIAquick PCR
purification kit (QIAGEN) and then digested by EcoRV and
BamHI. The purified DNA fragment was subcloned into
BamHI-EcoRV-digested 35S46-LUC vector. To make the 3 single-base pair mutated construct, the two oligonucleotides used
were as follows:
5'-TGAGGCTTTTCCCGTAATTGAGGCTTTTCCCGTAATTGAGGCTTTTCCCGTAAT-3' (MT1) and
5'-ATTACGGGAAAAGCCTCAATTACGGGAAAAGCCTCAATTACGGGAAAAGCCTCA-3' (MT2).
The mutated construct was prepared by the same method.
Light Sources--
We used light-emitting diodes (LEDs) as the
light sources for continuous irradiation. LEDs used in the experiments
were as follows: Red, STICK-mR LED ( Extraction of Protein and Immunoblotting--
Total protein for
immunoblotting was extracted by grinding tissue in a mortar and pestle
on ice with sand together with 0.3 ml of buffer and 3 stem pieces
(between 0 and 1 cm below the apical hook). The buffer contained 125 mM Tris-HCl (pH 6.8), 6% SDS, and 20% glycerol. The
mixture was heated at 100 °C for 3 min and centrifuged. The
supernatant protein was separated by SDS-polyacrylamide gel
electrophoresis, blotted onto a nitrocellulose membrane, probed with
monoclonal IgG against pra2 protein (13) and goat anti-mouse IgG
conjugated to peroxidase (Bio-Rad), and developed with an ECL kit
(Amersham Pharmacia Biotech).
Measurement of Enzyme Activity--
The stem of the bombarded
pea seedling (between 0 and 1 cm below the apical hook) was ground in
liquid nitrogen using a chilled mortar and pestle. The powder was
dispensed into a microcentrifuge tube and mixed with 300 µl of the
buffer, which consists of 100 mM potassium phosphate (pH
7.8), 1 mM dithiothreitol, 1% Triton X-100, and 1 mM EDTA and then centrifuged at 15,000 g at
4 °C for 5 min. The supernatant was frozen at The 12-bp Element, DE1, Was Sufficient to Confer Light
Down-regulation--
Previously, we identified a
cis-element, a 12-bp sequence, GGATTTTACAGT, involved in
phytochrome down-regulated expression of the pra2 gene of
pea (10). Gain-of-function analysis showed that the 93-bp sequence
containing the 12-bp element could confer light down-regulation when
fused to a heterologous, CaMV 35S90 promoter (cauliflower
mosaic virus 35 S
promoter of 90 bp from the transcriptional start site). The
CaMV 35S90 promoter has the as-1 element, which interacts
with the fused element and complicates interpretation of the results
(3). It is necessary to confirm the role of the 12-bp element in light
responsiveness using a minimal promoter, CaMV 35S46, that has 46 bp
from the transcriptional start site and is a smaller version of CaMV
35S90. We constructed the reporter plasmid, pGF9, containing a
nine-tandem repeat of the cis-element, CaMV 35S46, and the
luciferase gene (Fig. 1). Using the
plasmid pGF9 in a transient assay, we tested whether the 12-bp element
was sufficient to confer light down-regulation of the minimal promoter
in a red/far-red reversible manner. After bombardment, we placed the
plants under a range of light conditions, before incubating them for
12 h in darkness, prior to measurement of their luciferase
activity (Fig. 2A, pGF9). The
expression of the reporter gene was highest in darkness (lane
D). The brief red light treatment repressed the expression
(lane R), and subsequent far-red light immediately after red
light treatment reversed the effect (lane R/F). The 3 single-base pair mutated construct, pGF9M, in which the adenines in the
12-bp element were changed to cytosines, decreased to 20% of the level
observed in the case of pGF9 in darkness and abolished the red/far-red
reversible response. These results indicate that the 12-bp element is
dark-inducible and sufficient to confer red/far-red reversible light
down-regulation to the minimal promoter. When the nine tandem copies of
the cis-element were fused to CaMV 35S46 promoter in the
reverse direction, we could also observe red/far-red reversible
response, indicating that the function of this element is independent
of its direction (data not shown). We named this dark inducible element
DE1.
The DE1 Received Signals from Various Photoreceptors--
The
red/far-red reversible reaction in Fig. 2A is a low fluence
response (LFR) usually mediated by phytochrome B (14). There is a
possibility that DE1 also responds to light signals received by
photoreceptors other than phytochrome B. To examine this possibility, we determined the effects of various continuous light irradiations on
the expression of the reporter gene as shown in Fig. 2B. A response to continuous irradiation is termed an HIR, and red-HIR and
far-red-HIR are thought to be mediated by phytochrome B and phytochrome
A, respectively (14). Responses to blue light may be mediated by
phytochrome A and blue light photoreceptors (1). We exposed plants to
continuous red (lane Rc), far-red (lane Fc), or
blue light (lane Bc) irradiation for 12 h and measured
the reporter gene activity (Fig. 2B). Each treatment
repressed the expression of the reporter gene (pGF9), compared with
that of darkness (lane D), and the 3 single-base pair
mutations abolished dark induction, as well as the HIR (pGF9M). These
results suggest that the DE1 receives signals not only from phytochrome
B, but also from phytochrome A and blue-light photoreceptors. It seems probable that the various photoreceptors transduce the light signal via
the DE1.
Characterization of Phytochrome Mutants on pra2 Expression--
To
examine whether the expression of the pra2 gene is indeed
regulated by various photoreceptors, we investigated pra2
expression using photoreceptor mutants. In pea there are several
mutants deficient in various phytochromes. We used the
fun1-1 and lv-5 mutants and the
pcd1pcd2 double mutant. The pcd1pcd2 double
mutant is blocked at two steps in chromophore biosynthesis (19, 20). The fun1-1 and lv-5 mutants are deficient in
phytochromes A and B, respectively (21, 22). We exposed these mutants
to various light conditions and examined the pra2 protein level by
immunoblotting (Fig. 3). When grown in
complete darkness, all plants expressed the pra2 protein (lane
D). Red/far-red light reversible down-regulation was observed in
wild type and fun1-1 plants, but not in the lv-5 and pcd1pcd2 plants (Fig. 3, upper row). These
results indicate that this LFR is not mediated by phytochrome A but is
mediated by phytochrome B. The results from pcd1pcd2 plants
show that chromophore biosynthesis is required for functional
phytochrome B activity. This result is in agreement with expectations
from our previous results (12, 13).
To examine whether photoreceptors other than phytochrome B are involved
in pra2 expression, the effects of continuous irradiation were also examined in these mutants (Fig. 3, lower row). The
effect of continuous red irradiation on pcd1pcd2 plants was
different from that of wild type (lane Rc), indicating that
phytochromes mediate this red-HIR as expected. Red-HIR is usually
mediated by phytochrome B but not by phytochrome A (14), and the result from the phytochrome A-deficient fun1-1 plants was in
agreement with this suggestion. However, there was some down-regulation in the phytochrome B-deficient lv-5 mutant, suggesting some
other phytochrome(s) may also play a role in the red-HIR. The effect of
continuous far-red on mutant lv5 was similar to that on wild type. The expression by fun 1-1 or pcd1pcd2
plants was reduced in comparison to wild type plants implicating
phytochrome A in the far-red-HIR. The effect of continuous blue light
on all three mutants was similar to that of wild type (lane
Bc), indicating that phytochromes are not involved in this
response. Presumably blue light photoreceptors are involved in this
response. Thus, the mutant studies indicate that light received by
phytochrome A, phytochrome B, and blue-light receptors affected the
expression of the pra2 protein.
Previously we observed that the pra2 protein level was correlated with
stem elongation in etiolated pea seedlings (13). To test this
observation for the mutants, we measured the epicotyl elongation (Fig.
4) and compared it with the pra2 protein
level represented in Fig. 3 (lower row). Changes in stem elongation were correlated with the pra2 expression pattern, consistent
with the proposition that the pra2 protein may be involved
in stem elongation.
Specific Response Mediated by the DE1 Was Diminished in Phytochrome
Mutants--
It is important to demonstrate that the DE1 is capable of
receiving signals from photoreceptors using the above-characterized mutants. We examined the effect of light on the reporter gene expression by the transient assay using the plasmid pGF9. If the DE1
actually receives signals from a photoreceptor, deficiency of the
photoreceptor should reduce the specific response mediated by it. In
Fig. 3, we showed that a phytochrome A-deficient mutant, fun1-1, is deficient in the far-red-HIR, and a phytochrome
B-deficient mutant, lv-5, is deficient in the LFR for
pra2 expression. Here, we tested the effect of continuous
far-red light or brief red light on the reporter gene expression of
fun1-1 and lv-5 plants. We used the activities
in darkness as the induction control and activities in continuous blue
light as the repression control, because both activities in the two
mutants were similar to those of wild type plants (Fig. 3). In both
mutants, the activities of the reporter gene were highest in darkness
and repressed by blue light (Fig. 5,
lanes D and Bc). In the phytochrome A-deficient mutant fun1-1, response to continuous far-red light
(lane Fc) was somewhat attenuated, whereas a significant
response to brief red light (lane R) was retained. In the
phytochrome B-deficient mutant lv-5, the response to brief
red light (lane R) was attenuated, whereas response to
continuous far-red light (lane Fc) was retained. Thus, the
deficiency of each photoreceptor diminished the specific response
mediated by it. These results are consistent with the results in Figs.
2 and 3 and indicate that the DE1 element actually receives signals
from phytochromes A and B.
In this report, we have shown that a 12-bp element, DE1, could
confer light responsiveness to a minimal promoter, CaMV 35S46, using a
reporter gene in a transient assay and that the element received the
signal from phytochrome A, phytochrome B, and blue light receptors
(Fig. 2). These findings were confirmed by the use of
phytochrome-deficient mutants, because the DE1 lost the ability to
confer light responsiveness only for the specific light conditions
relevant to that photoreceptor (Fig. 5). It seems probable that various
photoreceptors transduce the light signals to the DE1. To date there
are some reports for gain-of-function analysis of various
cis-elements. Most experiments have been done using the CaMV
35S90 promoter that has the as-1 element. The GT-1 tetramer can confer light responsiveness to the CaMV 35S90 promoter, but not to
the CaMV 35S46 promoter, probably because the as-1 element is needed to build a light-responsive module with the GT-1-binding site
(3). In case of light down-regulation, the RE3 could confer light
responsiveness to the modified CaMV 35S46 promoter, probably interacting with the B domain of the 35 S promoter (9). Thus, combinatorial interaction of light-responsive elements determines the
response characteristics of light-regulated promoters (18, 26). The
smallest sequence unit sufficient to confer light responsiveness to the
CaMV 35S46 promoter has been a 52-bp element of the CHS unit
I (3, 27). This 52-bp element is long compared with the DE1. To our
knowledge, DE1 is the first small cis-element reported that,
by itself, confers light responsiveness to a minimal promoter, 35S46.
We propose that the cis-elements for light down-regulation
should be divided into two groups. One is the repressor-binding site
under light, and the other is the activator-binding site in darkness.
Previously, we proposed that the 12-bp element regulates induction in
darkness rather than repression by light (10). The present data show
that introduction of the pGF9 construct resulted in dark induction of
the reporter gene and that the 3 single-base pair mutations abolished
dark induction rather than light-repressed expression (Fig. 2),
supporting the hypothesis that the DE1 is an activator-binding site in
darkness. Previous gel mobility shift assays also suggested the
possibility that DE1 is an activator-binding site in darkness (10).
Moreover, pra2 expression itself shows a dark-inducible
pattern. When etiolated plants were illuminated for one day and then
returned to darkness, pra2 expression was restored (13).
Thus, these data support the view that DE1 is an activator-binding site
in darkness. The RE1 element on the PHYA promoter and the
RE3 element on the AS1 promoter have been identified as
cis-elements involved in phytochrome downregulation, but
these two elements are thought to be binding sites for transcriptional
repressors (8, 9). By contrast, DE1 may be responsible for dark
induction rather than light down-regulation.
The pra2 protein level was regulated by phytochrome A, phytochrome B,
and blue-light photoreceptors (Fig. 3). DE1 received signals from these
photoreceptors, suggesting that DE1 is likely to regulate pra2
expression mediated by various photoreceptors. In lv-5
plants, the pra2 protein level did show a red-HIR, whereas the
expression did not show an LFR. In general, both red-HIR and LFR are
mediated by phytochrome B. However, our data suggest that the red-HIR
of the pra2 gene is not mediated solely by phytochrome B. Because the various phytochromes have overlapping functions, it is not
surprising that the red-HIR was regulated by other phytochromes. For
example, the Arabidopsis phyB mutant retained an LFR for
CAB gene expression, which is generally mediated by
phytochrome B (17). In lv-5 plants, other phytochromes are
likely to regulate the red-HIR for pra2 expression, as well
as phytochrome B.
The observed correlation between pra2 gene expression and
epicotyl elongation observed in the mutants is consistent with our previous hypothesis that the pra2 protein may be involved with epicotyl
elongation in etiolated pea seedlings. One possibility is that the pra2
protein is induced in darkness and leads to stem elongation. Upon
illumination, various photoreceptors send a signal to the DE1 and
repress pra2 expression, which then results in reduced
elongation. This hypothesis requires detailed testing, and the
interaction of pra2 expression with the hormones involved with elongation deserves examination.
In conclusion we have shown that a 12-bp cis-regulatory
element, DE1, confers dark induction to a minimal promoter.
Introduction of the DE1 into other species should reveal whether this
element is functionally conserved between species
We thank Drs. Winslow R. Briggs and Minami
Matsui for suggestions and discussion and Dr. James Weller for
production of phytochrome mutants.
*
This work was supported by grants from the Japanese Ministry
of Education, Science, Sports and Culture and from the Japan Society
for the Promotion of Science (Research for the Future Program, number
JSPS-RTFT. 96L006012).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Received research fellowships from the Japan Society for the
Promotion of Science for Young Scientists.
Published, JBC Papers in Press, April 20, 2000, DOI 10.1074/jbc.M001337200
1
bp, base pair; HIR, high irradiance response;
LUC, luciferase; PCR, polymerase chain reaction; LED(s), light-emitting
diodes; LFR, low fluence response; GUS,
DE1, a 12-Base Pair cis-Regulatory Element Sufficient
to Confer Dark-inducible and Light Down-regulated Expression to a
Minimal Promoter in Pea*
§,,
Laboratory of Plant Molecular Biology,
Graduate School of Agricultural Sciences, Nagoya University, Nagoya
464-8601, Japan and the ¶ School of Plant Science, University of
Tasmania, Hobart, Tasmania 7001, Australia
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
max = 660 nm at 30 µmol m
2 s1; TOKYO RIKA Co. Ltd., Tokyo,
Japan); Far-red, STICK-mFR (max = 735 nm at 25 µmol
m2 s1); Blue, STICK-mB LED
(max = 470 nm at 25 µmol m2
s1). Equipment for the red/far-red reversible experiments
was the same as described previously (10, 12). The length of exposure to red was 2 min at 30.5 µmol m2 sec1,
and far-red was 5 min at 36.5 µmol m2
sec1.
80 °C until the
enzyme assay was conducted. Luciferase assays were performed as
described by Miller et al. (23) using the Pica Gene
luciferase assay kit (Wako, Osaka, Japan). Photon emission derived from
LUC activity was counted by AUTO LUMAT LB953 (Berthold, Bad Wildbad,
Germany). GUS assays were conducted using the method of Jefferson
et al. (24), with some modification (25).
4-Methylumbelliferone solutions dissolved in 0.2 M
Na2CO3 were used as standards. All LUC values were normalized to the corresponding GUS values. Samples of at least 6 bombardments were independently assayed for each construct.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (13K):
[in a new window]
Fig. 1.
Construction of the plasmids. The
plasmid, pGF9, containing a nine-tandem repeat of the
cis-element fused to a CaMV 35S46 promoter and the
luciferase gene was created. The plasmid pGF9M has 3 single-base pair
mutations in the 12-bp element. The details are described under
"Experimental Procedures." NOS, nopaline synthase terminator.
View larger version (24K):
[in a new window]
Fig. 2.
Effect of light on reporter enzyme activity
in wild type plants. Synthetic promoter-luciferase constructs
(pGF9 or pGF9M) were introduced into the growing region of etiolated
pea epicotyl by particle bombardment with the 35 S-GUS construct as the
internal standard. The reporter enzyme activity was measured 12 h
after the start of light irradiation. D, dark;
Rc, continuous red; Fc, continuous far-red;
Bc, continuous blue, R, brief red;
R/F, brief far-red, immediately after brief red;
F, brief far-red. Relative activity was defined under
"Experimental Procedures," and the average of pGF9 in darkness was
taken as 100. Values are the means of at least six independently
bombarded samples, with error bars representing S.E.
View larger version (98K):
[in a new window]
Fig. 3.
Immunoblot analysis of the pra2 protein after
irradiation with various wavelengths of light. Upper
panel, six-day-old seedlings grown in darkness were irradiated
with various light conditions. D, dark; Rc,
continuous red; Fc, continuous far-red; Bc,
continuous blue; R, brief red; R/F, brief far-red
immediately after brief red. After 12 h total proteins from the
upper 1 cm of the epicotyl were extracted, separated by
SDS-polyacrylamide gel electrophoresis (12.5% gel), and probed with
anti-pra2 protein IgG. 30 µg of protein were loaded in each lane.
Lower panel, to confirm the equal loading of proteins, the
gel was stained with Coomassie Brilliant Blue after the
SDS-polyacrylamide gel electrophoresis (12.5% gel). WT, wild
type.
View larger version (42K):
[in a new window]
Fig. 4.
Stem elongation during light
irradiation. The stem of 6-day-old seedlings was marked 1 cm below
the apical hook before irradiation for 12 h. After irradiation
elongation was measured. WT, wild type. D, dark;
Rc, continuous red; Fc, continuous far-red;
Bc, continuous blue.
View larger version (45K):
[in a new window]
Fig. 5.
Effect of light on the reporter enzyme
activity in mutant plants. The pGF9 construct was introduced into
the growing region of etiolated pea shoots by particle bombardment with
the 35 S-GUS construct as the internal standard. Plants were irradiated
with various lights, and the reporter enzyme activity was measured
after a 12-h incubation. D, dark; R, brief red;
Fc, continuous far-red; Bc, continuous blue.
Relative activity was defined in the legend to Fig. 2. Values are the
means of at least six independently bombarded samples, with error
bars representing S.E.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed. Tel.:
81-52-789-4165; Fax: 81-52-789-4165; E-mail:
sasaki@agr.nagoya-u.ac.jp.
-glucuronidase.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Chory, J.
(1997)
Plant Cell
9,
1225-1234
2.
Briggs, W. R.,
and Huala, E.
(1999)
Annu. Rev. Cell Dev. Biol.
15,
33-62
3.
Terzaghi, W. B.,
and Cashmore, A. R.
(1995)
Annu. Rev. Plant Physiol. Plant Mol. Biol.
46,
445-474
4.
Ngai, N.,
Tsai, F.-Y.,
and Coruzzi, G.
(1997)
Plant J.
12,
1021-1034
5.
Carabelli, M.,
Morelli, G.,
Whitelam, G.,
and Ruberti, I.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
3530-3535
6.
Okubara, P. A.,
and Tobin, E. M.
(1991)
Plant Physiol.
96,
1237-1245
7.
Leu, W.-M.,
Cao, X.-L.,
Wilson, T. J.,
Snustad, D. P.,
and Chua, N.-H.
(1995)
Plant Cell
7,
2187-2196
8.
Bruce, W. B.,
Deng, X.-W.,
and Quail, P. H.
(1991)
EMBO J.
10,
3015-3024
9.
Neuhaus, G.,
Bowler, C.,
Hiratsuka, K.,
Yamagata, H.,
and Chua, N.-H.
(1997)
EMBO J.
16,
2554-2564
10.
Inaba, T.,
Nagano, Y.,
Sakakibara, T.,
and Sasaki, Y.
(1999)
Plant Physiol.
120,
491-499
11.
Nagano, Y.,
Murai, N.,
Matsuno, R.,
and Sasaki, Y.
(1993)
Plant Cell Physiol.
34,
447-455
12.
Yoshida, K.,
Nagano, Y.,
Murai, N.,
and Sasaki, Y.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
6636-6640
13.
Nagano, Y.,
Okada, Y.,
Narita, H.,
Asaka, Y.,
and Sasaki, Y.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
6314-6318
14.
Smith, H.
(1995)
Annu. Rev. Plant Physiol. Plant Mol. Biol.
46,
289-315
15.
Chory, J.
(1992)
Development
115,
337-354
16.
von Arnim, A.,
and Deng, X.-W.
(1996)
Annu. Rev. Plant Physiol. Plant Mol. Biol.
47,
215-243
17.
Reed, J. W.,
Nagatani, A.,
Elich, T. D.,
Fagan, M.,
and Chory, J.
(1994)
Plant Physiol.
104,
1139-1149
18.
Chattopadhyay, S.,
Puente, P.,
Deng, X.-W.,
and Wei, N.
(1998)
Plant J.
15,
69-77
19.
Weller, J. L.,
Terry, M. J.,
Rameau, C.,
Reid, J. B.,
and Kendrick, R. E.
(1996)
Plant Cell
8,
55-67
20.
Weller, J. L.,
Terry, M. J.,
Reid, J. B.,
and Kendrick, R. E.
(1997)
Plant J.
11,
1177-1186
21.
Weller, J. L.,
Nagatani, A.,
Kendrick, R. E.,
Murfet, I. C.,
and Reid, J. B.
(1995)
Plant Physiol.
108,
525-532
22.
Weller, J. L.,
Murfet, I. C.,
and Reid, J. B.
(1997)
Plant Physiol.
114,
1225-1236
23.
Miller, A. J.,
Short, S. R.,
Hiratsuka, K.,
Chua, N.-H.,
and Kay, S. A.
(1992)
Plant Mol. Biol. Reptr.
10,
324-337
24.
Jefferson, R. A.,
Kavanaugh, T. A.,
and Bevan, M. W.
(1987)
EMBO J.
6,
3901-3907
25.
Kosugi, S.,
Ohashi, Y.,
Nakajima, K.,
and Arai, Y.
(1990)
Plant Sci.
70,
133-140
26.
Puente, P.,
Wei, N.,
and Deng, X.-W.
(1996)
EMBO J.
15,
3732-3743
27.
Weisshaar, B.,
Armstrong, G. A.,
Block, A.,
da Costa e Silva, O.,
and Hahlbrock, K.
(1991)
EMBO J.
10,
1777-1786
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  C. Polge, M. Jossier, P. Crozet, L. Gissot, and M. Thomas {beta}-Subunits of the SnRK1 Complexes Share a Common Ancestral Function Together with Expression and Function Specificities; Physical Interaction with Nitrate Reductase Specifically Occurs via AKIN{beta}1-Subunit Plant Physiology, November 1, 2008; 148(3): 1570 - 1582. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Jiao, L. Ma, E. Strickland, and X. W. Deng Conservation and Divergence of Light-Regulated Genome Expression Patterns during Seedling Development in Rice and Arabidopsis PLANT CELL, December 1, 2005; 17(12): 3239 - 3256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. E. Hudson and P. H. Quail Identification of Promoter Motifs Involved in the Network of Phytochrome A-Regulated Gene Expression by Combined Analysis of Genomic Sequence and Microarray Data Plant Physiology, December 1, 2003; 133(4): 1605 - 1616. [Abstract] [Full Text]
|
|
|
|
 |
|
 E. Sato, N. Nakamichi, T. Yamashino, and T. Mizuno Aberrant Expression of the Arabidopsis Circadian-Regulated APRR5 Gene Belonging to the APRR1/TOC1 Quintet Results in Early Flowering and Hypersensitiveness to Light in Early Photomorphogenesis Plant Cell Physiol., November 15, 2002; 43(11): 1374 - 1385. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Iliev, W. Xu, D. H. Polisensky, M.-H. Oh, R. S. Torisky, S. D. Clouse, and J. Braam Transcriptional and Posttranscriptional Regulation of Arabidopsis TCH4 Expression by Diverse Stimuli. Roles of cis Regions and Brassinosteroids Plant Physiology, October 1, 2002; 130(2): 770 - 783. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Inaba, Y. Nagano, T. Nagasaki, and Y. Sasaki Distinct Localization of Two Closely Related Ypt3/Rab11 Proteins on the Trafficking Pathway in Higher Plants J. Biol. Chem., March 8, 2002; 277(11): 9183 - 9188. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-i. Tanaka, N. Mochizuki, and A. Nagatani Expression of the AtGH3a Gene, an Arabidopsis Homologue of the Soybean GH3 Gene, is Regulated by Phytochrome B Plant Cell Physiol., March 1, 2002; 43(3): 281 - 289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Nagano, H. Furuhashi, T. Inaba, and Y. Sasaki A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences Nucleic Acids Res., October 15, 2001; 29(20): 4097 - 4105. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
