JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M002351200 on April 11, 2000

J. Biol. Chem., Vol. 275, Issue 26, 19985-19991, June 30, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/26/19985    most recent
M002351200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baker, D. M.
Right arrow Articles by Davis, R. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baker, D. M.
Right arrow Articles by Davis, R. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

One or More Labile Proteins Regulate the Stability of Chimeric mRNAs Containing the 3'-Untranslated Region of Cholesterol-7alpha -hydroxylase mRNA*

Daniel M. Baker, Shui-Long Wang, David J. Bell, Christian A. DrevonDagger, and Roger A. Davis§

From the Mammalian Cell and Molecular Biology Laboratory, San Diego State University, San Diego, California 92182-4614

Received for publication, March 21, 2000, and in revised form, April 11, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Multiple AUUUA elements similar to those that regulate the degradation of several different mRNAs are conserved in the 3'-untranslated region (3'-UTR) of cholesterol-7alpha -hydroxylase (CYP7A1) mRNAs from several species. We examined if stabilization of mRNA decay could account for the >20-fold increase in the expression of CYP7A1 mRNA without a detectable change in transcription following dexamethasone treatment of rat hepatoma cells (L35 cells). Following RNA polymerase II-dependent transcription block or protein synthesis block, the decay of CYP7A1 mRNA displayed a short half-life (~30 min). Control experiments showed that in cells pre-treated with a RNA polymerase II inhibitor, dexamethasone had no detectable effect on CYP7A1 mRNA decay. Stable expression of luciferase reporter mRNAs in L35 cells showed that the CYP7A1 3'-UTR was required to observe a dexamethasone induction. To examine the hypothesis that a labile protein is required for dexamethasone-induced mRNA stabilization, cells were stably transfected with a tetracycline-repressible promoter that drives the expression of a green fluorescent protein analogue (ECFP) with or without the 3'-UTR of CYP7A1. Cells expressing ECFP with the 3'-UTR of CYP7A1 displayed a 3-fold dexamethasone induction of ECFP mRNA, whereas cells expressing ECFP without the 3'-UTR did not. Moreover, specific block of the transcription of ECFP containing the 3'-UTR by adding the tetracycline analogue doxycycline clearly displayed dexamethasone-induced stabilization of mRNA decay. These data provide compelling evidence that a putative labile protein and the 3'-UTR of CYP7A1 act together to decrease the rate of CYP7A1 mRNA degradation.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The initial step controlling bile acid synthesis from cholesterol is catalyzed by cholesterol-7alpha -hydroxylase (CYP7A11; EC 1.14.13.17) (reviewed in Refs. 1-5). The expression of CYP7A1 mRNA, protein, and enzyme activity varies rapidly and markedly in response to diurnal variation (6-8), dietary cholesterol (9-11), hormones (12-14), and cytokines (15). Changes in CYP7A1 gene transcription appear to play a major role in regulating expression levels (reviewed in Refs. 3-5). In cultured cells and rodents, several different DNA-binding proteins have been shown to regulate the transcription of the endogenous CYP7A1 gene in regard to diurnal variation (albumin D site-binding protein) (7, 8), liver specificity (CYP7A1 promoter binding factor) (16), oxysterols (liver X receptoralpha ) (11, 17), and bile acids (basic transcription element-binding protein) (18) and (farnesoid X receptor) (19). Transcriptional variation results in an almost concomitant change in CYP7A1 mRNA levels, suggesting that CYP7A1 mRNA displays rapid turnover (6-8). Additional studies have led to the conclusion that these rapid diurnal variations are due to regulated degradation of its mRNA and protein (20).

Previous studies suggested that a post-transcriptional mechanism (e.g. stabilization of mRNA) might have been responsible for a >20-fold increase in the steady-state levels of CYP7A1 mRNA in L35 rat hepatoma cells treated with dexamethasone (14). This hypothesis was based solely on the observation that no detectable change in CYP7A1 transcription was observed in nuclei prepared from control and dexamethasone-treated cells (14). In this report we examine the effect of dexamethasone on the stability and expression of rat CYP7A1 and chimeric mRNAs encoding luciferase or an analogue of green fluorescent protein (ECFP). Our results show that the 3'-UTR of rat CYP7A1 and a labile protein, which is rapidly depleted from cells whose transcription or translation is blocked, are sufficient to allow dexamethasone-induced stabilization of mRNA decay.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

All reagents used for biochemical techniques were purchased from Sigma, VWR, or Fisher. Restriction enzymes and enzymes for labeling cDNA probes were purchased from New England Biolabs and Roche Molecular Biochemicals. Plasmid pcDNA3 encoding a cytomegalovirus promoter and a neomycin resistance gene (G418 resistance), was purchased from Invitrogen. A modified version of the TetOff expression system (21) was purchased from CLONTECH (Palo Alto CA). Cell culture medium was obtained from Life Technologies, Inc., and serum was obtained from Gemini. The cDNA probes used for hybridizations have been described elsewhere (14, 22, 23).

Cell Culture

L35 rat hepatoma cells were cultured in Dulbecco's modified Eagle's medium as described in detail (14, 22, 23). Cells were treated with dexamethasone (0.1 mM), 5,6-dichlorobenzimidazole (DRB), cycloheximide, or doxycycline-HCl at the concentrations indicated in the figure legends. Control cells received ethanol (vehicle) only.

RNA Isolation and Quantitation

Cells were harvested at the times indicated in the figure legends by removing the culture medium and adding guanidinium isothiocyanate (24) with modifications (23). Poly(A)-containing RNA was obtained using the miniscale oligo(dT)-cellulose (Collaborative Biotech type 3) method as described previously (23). RNA (2 to 5 µg of poly(A) RNA) was loaded onto 0.8% agarose, 3% formaldehyde gels and subjected to electrophoresis. The gels were blotted onto Zetaprobe GT (Bio-Rad) nylon membranes and hybridized with nick-translated cDNA probes using the conditions described for Zetaprobe by Bio-Rad. After hybridization and washing, Northern blots were exposed to phosphor screens of a Molecular Dynamics PhosphorImager, Kodak Biomax MS film, or to DuPont Reflection Autoradiography film, as described (14, 23).

Luciferase Reporter Plasmid Constructs

The pcDNA3-Luc plasmid was constructed by ligating the firefly luciferase reporter gene into the BamHI-XhoI site of pcDNA3. This construct was used as the backbone for the subsequent addition of the 3'-UTR of CYP7A1 mRNA. The entire 3'-UTR of rat CYP7A1 was obtained from two individual pBSSK:7alpha 3'-UTR plasmids (kindly supplied by Dr. John Chiang, Department of Biochemistry and Molecular Pathology, Northeastern Ohio Universities College of Medicine). The CYP7A1 3'-UTR was excised from the pBSSK:7alpha 3'-UTR plasmids with NotI and Bsp120I and ligated into pcDNA3-Luc that had been linearized with Bsp120I to form the pcDNA3-7alpha 3'-5' construct. This plasmid (designated pcDNA3-luc-7alpha 3'-5') was sequenced and shown to contain sequences identical to the 3'-UTR in the reverse orientation. To construct the luciferase plasmid with the 3'-UTR in the correct 5' to 3' orientation, (pcDNA3-luc-7alpha 5'-3' construct), PCR was utilized. Using pcDNA3-Luc-7alpha 3'-5' as a template, PCR primers (DM1-5'CCGCGTCGACTACGTGGTTGGAAGAAGCGAACACT3' and DM2-5'CGCCGGCCGTTGCTAGTCTGTGTGTCACATGTCA3') were used to amplify the CYP7A1 3'-UTR in the following reaction: 94 °C for 30 s, 65 °C for 1 min, 72 °C for 1.5 min for 30 cycles. A SalI site was engineered into the DM1 primer, and an EagI site was engineered into the DM2 primer for cloning of the PCR product into pcDNA3-Luc. The vector pcDNA3-Luc was digested with XhoI and Bsp120I and ligated with the CYP7A1 5'-3' PCR SalI-EagI fragment to produce pcDNA3-Luc 3'-UTR. Each construct containing the CYP7A1 3'-UTR in either orientation was sequenced using the dideoxy method (25) and an automated DNA sequence analyzer (DuPont). The sequence was in total agreement with published data (26).

ECFP Reporter Plasmid Constructs

A modified version of the TetOff expression system (21) was purchased from CLONTECH. pECFP (CLONTECH) was ligated into the bidirectional tetracycline response plasmid, pBI-L, to form pBIL-ECFP, whose sequence was confirmed to be correct. The plasmid encoding ECFP containing the rat CYP7A1 3'-UTR was made by inserting the rat CYP7A1 3'-UTR into pBIL-ECFP as follows. PCR was utilized to produce an amplified segment of DNA template containing EagI restriction sites at the ends for cloning into pBIL-ECFP. The entire rat CYP7A1 3'-UTR was PCR-amplified using Luc 3'-UTR as a template and appropriate primers containing EagI on each end. The resulting amplified segment was digested with EagI and ligated into pBIL-ECFP. Clones containing the entire 3'-UTR in the correct orientation were identified by restriction digestions. The sequence of the plasmid, pBIL-ECFP 3'-UTR, was confirmed to be correct.

Cell Transfection

Luciferase Constructs-- L35 rat hepatoma cells were cultured until 70% confluency. Each expression plasmid pcDNA3-Luc 3'-UTR and the control plasmid pcDNA3-Luc was transfected into L35 cells using Ca3PO4, as described (27). Cells were selected for stable expression of the plasmid expressing neomycin resistance by culturing in G418 (400 µg/ml). Once selected, at least three single cell clones/transfection were isolated.

ECFP Constructs-- L35 cells were transfected with the TetOff regulatory plasmid and selected for resistance to the neomycin analogue, G418 (400 µg/ml). Single cell clones were isolated using the limiting dilution method. Clones were then screened for the presence of a doxycycline-repressible expression of luciferase (produced by a transiently transfected pBIL expression plasmid). A single cell clone (L35ctTA-X) exhibiting high expression of luciferase in the absence of doxycycline and low expression of luciferase in the presence of doxycycline was used to obtain stable clones of cells expressing the ECFP expression plasmids, as described below.

L35ctTA-X cells were transfected with either pBIL-ECFP or pBIL-ECFP 3'-UTR along with pTK-Hyg, and stable cells were selected for resistance to hygromycin (400 µg/ml). Cells were single cell-cloned by limiting dilution. Single cell clones resistant to G418 (400 µg/ml) and hygromycin (400 µg/ml) displaying ECFP fluorescence in the absence of doxycycline and no fluorescence in the presence of doxycycline were used for the studies described below.

Genomic DNA Isolation and Quantitation-- Genomic DNA was isolated using a QIAamp blood kit (Qiagen). The relative copy numbers of the transfected plasmids in the isolated genomic DNA were digested with BamHI and StuI to excise the luciferase-encoding region. The digests were loaded onto 0.8% agarose gels and subjected to electrophoresis, transferred, and hybridized using 32P-labeled probes for the coding region of luciferase and CYP7A1 (22). Relative copies of luciferase/genomic CYP7A1 were determined using PhosphorImager densitometry of the Southern blots.

Statistics Analysis-- Results are given as the mean ± S.D. Statistical analysis was determined by Student's t test. Values of p <=  0.05 were considered to be significant.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The 3'-UTR of CYP7A mRNA Contains AUUUA Elements That Are Conserved among Several Species-- It has been generally noted that the 3'-UTR of CYP7A1 contains multiple AUUUA elements (6, 26, 28). In an appropriate context, AUUUA sequences in the 3'-UTR of several mRNAs influence mRNA stability (29-33). We examined the cDNAs from rat, hamster, mouse, rabbit, and human CYP7A1 for conserved AUUUA elements (Fig. 1). All five of the different species mRNAs contain AU elements in their coding region and 3'-UTRs (Fig. 1). The rat CYP7A1 mRNA contains eight AUUUA elements and many near-consensus AUUUA elements. Seven of the AUUUA elements are located in the 3'-UTR, and five are clustered between bases 2585 and 2782. Interspersed among the seven AUUUA motifs in the 3'-UTR are 10 mid-sized (5-7 nucleotides long) U stretches. These mid-sized U stretches combined with one to three AUUUA motifs have been shown to regulate the stability of other mRNAs (e.g. c-fos (34, 35)). Rat CYP7A1 mRNA also contains four heptameric UAUUUA(U/A) sequences, which may regulate mRNA stability when present in the 3'-UTR as three copies (31). In addition, the rat CYP7A1 mRNA contains a perfect nonomeric UUAUUU(U/A)(U/A) sequence, which by itself has been shown to cause rapid degradation (31, 33). The phylogenetic conservation of several of these AUUUA elements in the 3'-UTR of CYP7A1 mRNA raises the possibility that they may play an important physiologic role.


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 1.   Sequence homology analysis of AUUUA elements found in CYP7A1 mRNA from human, rabbit, hamster, mouse, and rat. AUUUA elements are marked by vertical lines. Heptameric UAUUUA(U/A) elements are indicated by unfilled arrows. Nonomeric UUAUUUA(U/A)(U/A) elements are indicated by filled arrows. Sequences of the mRNA were obtained from human (46), rabbit (47), hamster (48), mouse (49), and rat (26, 28).

The Degradation Rate CYP7A1 mRNA Is Similar to That of c-myc-- We examined the rate of CYP7A1 mRNA decay following inhibition of RNA polymerase II-dependent transcription by DRB (36) in L35 cells treated with or without dexamethasone (Fig. 2A). At 0 h before the addition of DRB, the expression of CYP7A1 mRNA by L35 cells treated with dexamethasone was >20-fold compared with untreated cells (Fig. 2A). Within 1 h of adding DRB, approximately 75% of the CYP7A1 mRNA was lost from both groups of L35 cells. After this time up until 4 h, there was no detectable loss of the remaining CYP7A1 mRNA. The rate of decay of CYP7A1 mRNA (half-life ~30 min) was similar to that of c-myc mRNA (half-life ~36 min), a cell cycle-specific gene product whose mRNA displays rapid turnover. Furthermore, using this experimental protocol, dexamethasone treatment did not significantly affect the rate of decay of either CYP7A1 or c-myc mRNA. In HepG2 cells, dexamethasone did not alter the rate of decay of human CYP7A1 following polymerase II inhibition (37). These data suggest that either dexamethasone did not affect the rate of turnover of CYP7A1 mRNA or that a factor that is required for dexamethasone-mediated stabilization of CYP7A1 mRNA was lost upon RNA polymerase II block by DRB.


View larger version (28K):
[in this window]
[in a new window]
  		Fig. 2.   mRNA levels of CYP7A1 (A) and c-myc (B) isolated from L35 cells incubated with the transcription inhibitor, DRB. L35 cells were incubated with Dulbecco's modified Eagle's medium containing 100 µM dexamethasone (Dex) for 24 h at 37 °C. DRB (65 µM) was added to the medium and incubated for the time indicated. Poly(A) mRNA (5 µg) was Northern-blotted and then subjected to hybridization with probes for CYP7A1, c-myc, and beta -actin. The abundance of CYP7A1 and c-myc was corrected for loading differences with beta -actin. For CYP7A1 all bands for each time point were averaged, and results from three different individual plates of cells were plotted. A, after 1 h of DRB treatment there was a significant decrease in CYP7A1 mRNA compared with the zero time point, p < 0.01. B, after 1 h of DRB treatment there was a significant decrease in c-myc mRNA compared with the zero time point, p < 0.01. Northern blot shows one representative lane for each time point.

Inhibition of Protein Synthesis by Cycloheximide Causes Rapid Degradation of CYP7A mRNA-- To determine if translation is required for the rapid degradation of CYP7A1 mRNA, dexamethasone-induced L35 cells were treated with cycloheximide (0.05 mg/ml). Under the conditions and time course of these experiments, there was no evidence of cell toxicity as determined by trypan blue exclusion (data not shown). Within 1 h of adding cycloheximide CYP7A1 mRNA decreased (Fig. 3) in a manner that was similar to the decrease observed following RNA polymerase II block with DRB (Fig. 2). The decay of CYP7A1 mRNA was specific, since even after 4 h there was no detectable loss of mRNAs encoding beta -actin (Fig. 3) or c-myc (data not shown). These data suggest that translation is not required for the rapid degradation of CYP7A1 mRNA and that a labile protein required for dexamethasone-mediated stabilization of CYP7A1 mRNA was lost upon cycloheximide treatment.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 3.   mRNA levels of CYP7A1 isolated from hepatocytes incubated with the translation inhibitor, cycloheximide. L35 cells were incubated with Dulbecco's modified Eagle's medium containing 100 µM dexamethasone for 24 h at 37 °C. Cycloheximide (50 µg/ml) was added to the medium and incubated up to 4 h in two separate experiments. Poly(A) mRNA was isolated, gel-electrophoresed, and subjected to blot hybridization with probes for CYP7A1 and beta -actin. Each time point represents the mean ± S.D. of three individual plates of cells.

The 3'-UTR of the Rat CYP7A 3'-UTR Is Sufficient to Display Dexamethasone Induction of a Chimeric mRNA Encoding Luciferase-- Cytomegalovirus promoter-driven expression plasmids encoding both a neomycin-resistant gene product and the enzyme luciferase were constructed so that the entire rat CYP7A1 3'-UTR was either absent or present 3' to the luciferase mRNA. Single cell clones resistant to G418 were obtained and assayed for luciferase mRNA expression by Northern blotting (Fig. 4). Cells expressing the plasmid without the CYP7A1 3'-UTR contained a single luciferase mRNA (~2 kilobases) (Fig. 4). In the cells expressing luciferase containing the CYP7A1 3'-UTR, three different-sized mRNAs encoding luciferase were present (Fig. 4). These three luciferase mRNAs had sizes similar to the sizes of rat CYP7A1 mRNA plus an additional 0.16 kilobases, which is equal to the larger coding region of luciferase compared with CYP7A1. These data suggest that the different molecular weight forms of the rat CYP7A1 mRNA are produced by different usages of polyadenylation sites contained within the 3'-UTR, as predicted (28).


View larger version (37K):
[in this window]
[in a new window]
  		Fig. 4.   Effect of dexamethasone on luciferase mRNA with and without the 3'-UTR of CYP7A1. L35 cells expressing luciferase mRNA with the 3'-UTR of CYP7A1 (hatched columns) or luciferase mRNA without the 3'-UTR (solid columns) were treated with or without 100 µM dexamethasone for the indicated times. Cells were harvested and assayed for luciferase mRNA relative to beta -actin RNA. Each value is the mean of two individual plates of cells. The Northern blots for each time point are shown in the upper panels.

In the absence of dexamethasone, cells stably transfected with the luciferase plasmid without the 3'-UTR contained ~10-fold greater luciferase mRNA compared with cells stably transfected with the luciferase plasmid containing the 3'-UTR (Fig. 4). Moreover, dexamethasone caused a 3-fold increase in luciferase mRNA levels in 24 h but had no effect on the expression of luciferase without the 3'-UTR (Fig. 4). Similar results were obtained in a total of three separate single cell clones (i.e. dexamethasone treatment caused a 2-3-fold increase in the expression of mRNA encoding luciferase with the 3'-UTR, whereas there was no significant change in the level of luciferase mRNA without the 3'-UTR.

Additional experiments showed that dexamethasone did not affect the rate of degradation of the luciferase mRNA containing the 3'-UTR (i.e. following DRB-blocked transcription, the rate of decay was the similar in cells treated with and without dexamethasone; data not shown). These findings are similar to those observed for the endogenous CYP7A1 mRNA (i.e. dexamethasone increased steady-state mRNA levels without altering mRNA decay; Fig. 2). The inability to experimentally observe an effect of dexamethasone on the rate of turnover of mRNAs containing the CYP7A1 3'-UTR might be explained if dexamethasone mRNA stabilization required a labile protein that may have been depleted following transcription arrest.

A Labile Protein Is Required for Dexamethasone to Stabilize mRNA Containing the 3'-UTR of CYP7A1-- To examine the hypothesis that a labile protein is necessary for dexamethasone-induced stabilization of mRNAs containing the CYP7A1 3'-UTR, we developed an experimental approach that would specifically block the transcription of a reporter mRNA with and without the CYP7A1 3'-UTR. A modified version of the TetOff expression system (21) (CLONTECH) was chosen for these experiments. This regulated mammalian expression plasmid system utilizes two plasmids, the TetOff regulator plasmid and the TRE response plasmid. The TetOff plasmid constitutively expresses a doxycycline-controlled transactivator (tTA), a fusion of the wild-type Tet repressor from Escherichia coli to the activation domain of VP16 from herpes simplex virus. A single cell clone of L35 cells stably expressing tTA was obtained and subsequently transfected with a response plasmid (pBI-L) that expressed either ECFP with or ECFP without the CYP7A1 3'-UTR. In addition, luciferase was also expressed from the bidirectional tTA response element.

The following characteristics were consistently observed in three separate single cell clones of L35 cells stably expressing mRNAs encoding ECFP with and without the CYP7A1 3'-UTR. In the absence of dexamethasone, cells expressing ECFP without the 3'-UTR displayed an easily visualized cyan fluorescence (Fig. 5). In marked contrast, cells expressing ECFP containing the 3'-UTR displayed a cyan fluorescence that was barely visible in the absence of dexamethasone (Fig. 5). The level of fluorescence displayed by the cells agreed with the relative level of expression of ECFP mRNA, as shown below. Similar to the results obtained with the luciferase constructs (Fig. 4), in the absence of dexamethasone, the expression of ECFP without the 3'-UTR was >10-fold that of ECFP containing the 3'-UTR. These data further support the conclusion that the 3'-UTR of CYP7A1 confers instability to chimeric mRNAs. Moreover, following treatment of cells with dexamethasone, the intensity of the fluorescence of the cells expressing ECFP without the 3'-UTR did not change, whereas the fluorescence of the cells expressing ECFP containing the 3'-UTR was significantly increased. Treating cells with the tetracycline analogue, doxycycline, decreased the fluorescence of both groups of cells whether or not they were also treated with dexamethasone. These data show that the fluorescence of both groups of cells was blocked by doxycycline and that only the ECFP containing the 3'-UTR of CYP7A1 was increased in cells treated with dexamethasone.


View larger version (43K):
[in this window]
[in a new window]
  		Fig. 5.   Dexamethasone and doxycycline effects on ECFP fluorescence in cells expressing ECFP with and without the CYP7A1 3'-UTR. L35 cells expressing a doxycycline-repressible ECFP with the 3'-UTR of CYP7A1 (ECFP with 3'-UTR) or without the 3'-UTR of CYP7A1 (ECFP without 3'-UTR) were cultured in Dulbecco's modified Eagle's medium with or without dexamethasone (100 µM) and with or without doxycycline-HCl (1 µg/ml) for 24 h. Control cells received ethanol only. Cells were analyzed using an inverted fluorescence microscope (Olympus IX-50) through an ECFP filter.

Multiple mRNAs encoding ECFP containing the 3'-UTR (Fig. 6) corresponded in size to the multiple luciferase mRNAs containing the 3'-UTR (Fig. 4). Moreover, the level of fluorescence displayed by cells expressing ECFP mRNAs agreed closely with the levels of ECFP mRNA expression (Fig. 6). The level of ECFP mRNA containing the 3'-UTR was <10% of the level of mRNA encoding ECFP without the 3'-UTR. Moreover, dexamethasone caused a 3-fold increase in the relative content of mRNA encoding ECFP containing the 3'-UTR (Fig. 6). These data confirm the findings observed with the luciferase chimeras (i.e. the presence of the CYP7A1 3'-UTR is sufficient to confer dexamethasone induction).


View larger version (33K):
[in this window]
[in a new window]
  		Fig. 6.   mRNA levels of ECFP 3'-UTR isolated from L35 ECFP 3'-UTR cells incubated with doxycycline. L35 cells stably expressing ECFP 3'-UTR cells were incubated with 100 µM dexamethasone for 24 h at 37 °C. Doxycycline-HCl (1 µg/ml) was added to the medium, and cells were incubated for the times indicated. Cells were harvested, and poly(A) RNA (5 µg) was isolated and then Northern-blotted and subjected to separate hybridizations with probes for the coding region of ECFP, luciferase, and beta -actin. The abundance of ECFP 3'-UTR and luciferase were corrected for loading differences with beta -actin. Each time point represents the mean ± S.D. of three individual plates of cells. A Northern blot shows one representative lane for each time point. Double exponential analysis were obtained using Sigma Plot for Macintosh.

To examine if dexamethasone affected the stability of the ECFP mRNA containing the 3'-UTR, plasmid-dependent transcription was specifically blocked by adding doxycycline. A rapid decrease in ECFP mRNA displayed a double-exponential decay (Fig. 6). The decrease in ECFP mRNA was specific as demonstrated by the observation that the relative abundance of other mRNAs (e.g. beta -actin) was unchanged throughout the time course of the experiment (Fig. 6). Moreover, it is clear that dexamethasone treatment significantly decreased the rate of degradation of ECFP mRNA containing the 3'-UTR (Fig. 6). In cells treated with dexamethasone, the rate of decay of mRNA encoding ECFP containing the 3'-UTR was ~4-fold slower than the rate of decay without dexamethasone treatment. In contrast, dexamethasone had no effect on the decay of luciferase mRNA (data not shown). These data provide compelling evidence that dexamethasone induces the expression of mRNAs containing the 3'-UTR of rat CYP7A1 by decreasing the rate of mRNA degradation.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Our results support the following conclusions. 1) In the absence of dexamethasone, the rate of degradation of rat CYP7A1 mRNA is relatively rapid (i.e. similar to that of c-myc) (Fig. 2); 2) in its natural context and when added to mRNAs encoding luciferase or ECFP, the rat CYP7A1 3'-UTR acts to decrease expression; 3) the steady-state levels of mRNAs encoding luciferase or ECFP that contain the 3'-UTR of CYP7A1 is increased in L35 cells treated with dexamethasone (Figs. 2, 4-6); 4) dexamethasone increases the levels of mRNA encoding ECFP containing the 3'-UTR of rat CYP7A1 by decreasing its rate of degradation; and 4) a labile protein, which is likely to be an RNA-binding protein, is required for dexamethasone stabilization of mRNAs containing the 3'-UTR of rat CYP7A1.

The Relative Rate of Degradation of CYP7A1 mRNA Is Rapid Due to Instability Elements in the 3'-UTR-- In L35 cells, the rate of decay of CYP7A1 mRNA was similar to that of c-myc (Fig. 2), whose degradation is considered to be rapid (38). We estimated the half-life of CYP7A1 mRNA in L35 cells to be ~30 min. This rate of endogenous CYP7A1 decay is similar to the rapid rate of decay in cells expressing ECFP containing the 3'-UTR and cultured without dexamethasone (half-life = 45.6 min, Fig. 6). In other experimental systems and treatments the half-life of CYP7A1 mRNA varied from 30 min (39) to ~4 h (6, 37, 40). The combined data support the proposal that CYP7A1 mRNA displays a relatively rapid rate of degradation. Our additional finding that irrespective of dexamethasone presence, adding the CYP7A1 3'-UTR to mRNAs encoding both luciferase (Fig. 4) and ECFP (Fig. 6) resulted in markedly lower steady-state expression of these mRNAs. However, without the 3'-UTR there was >10-fold higher expression as compared with mRNAs containing the 3'-UTR. Assuming that the presence of 3'-UTR in the expression vector would not affect transcription, the increased steady-state levels of mRNAs without the CYP7A1 3'-UTR indicates that the 3'-UTR enhances mRNA degradation. These conclusions are consistent with the predictions suggesting that the 3'-UTR of CYP7A1 mRNAs acts to destabilize mRNA (6, 26, 28). It has been reported that the enzymatic activity produced by a chimeric mRNA containing the mouse CYP7A1 3'-UTR was significantly less than that produced by an mRNA without the 3'-UTR (41).

The 3'-UTR of CYP7A1 Is Sufficient to Confer Dexamethasone Induction of mRNA Expression Levels-- The findings that mRNAs encoding either luciferase (Fig. 4) or ECFP (Fig. 6) displayed dexamethasone induction when they contained the 3'-UTR of rat CYP7A1, but no induction without the 3'-UTR, strongly indicate that non-coding sequences play a regulatory role in CYP7A1 expression. However, the 3-fold increase in luciferase (Fig. 4) and ECFP (Fig. 6) mRNA levels by dexamethasone is clearly less than the >20-fold induction of the endogenous CYP7A1 mRNA (Fig. 2). There are several possible explanations for this difference. First, dexamethasone might increase transcription of the endogenous CYP7A1 gene. Using nuclear extracts from L35 cells run-off transcription assays detected no significant increase with dexamethasone (14). An alternative possibility is that the coding region of CYP7A1, which also contains AUUUA elements (Fig. 1), may affect the dexamethasone-mediated stabilization. Finally, it is also possible that differences in the stoichiometric relationships between the mRNA and the factors that may decrease its degradation may account for this decreased induction. Our findings strongly support the conclusion that a labile protein(s) may be necessary for dexamethasone to decrease the degradation of an ECFP mRNA containing the 3'-UTR (Fig. 6). These data imply that the cellular content of this(these) protein(s) relative to the amount of mRNA containing the 3'-UTR of CYP7A1 plays a critical role in dexamethasone-induction of mRNA expression.

A Labile Protein Is Required for Dexamethasone Stabilization of mRNAs Containing the 3'-UTR of Rat CYP7A1-- We were unable to directly measure a dexamethasone-induced stabilization of mRNA decay of either the endogenous CYP7A1 mRNA or the luciferase mRNA containing the 3'-UTR. However, using the tetracycline-regulatable expression vector, we were able to clearly detect a slower rate of degradation of the mRNA encoding ECFP with the CYP7A1 3'-UTR in dexamethasone-treated cells (Fig. 6). These data strongly support the conclusion that the 3'-UTR of CYP7A1 confers dexamethasone induction of mRNA expression by increasing mRNA stability. The requirement for a labile protein for dexamethasone stabilization of CYP7A1 mRNA can explain the unexpected finding that inhibition of protein synthesis by cycloheximide treatment decreased the cellular content of CYP7A1 mRNA (Fig. 3) at a rate that was similar to the decay rate caused by blocking transcription with DRB (Fig. 2).

What Physiologic Functions Provided the Evolutionary Pressure to Conserve AUUUA Elements in the 3'-UTR of the CYP7A1 mRNA?-- Clearly, rapid and regulated changes in mRNA degradation coupled to changes in transcription afford a more immediate change in mRNA expression and, presumably, enzyme activity. Although, to our knowledge, our study is the first to demonstrate a regulated change in CYP7A1 mRNA degradation, there have been several reports providing data that indirectly predicted this possibility. Diurnal changes in CYP7A1 transcription are mediated by DBP, a diurnally regulated transcription factor that binds to 5' sequences in the CYP7A1 promoter and activates transcription (7, 8). This transcriptional variation results in an almost concomitant change in CYP7A1 mRNA levels, leading to the conclusion that due to the presence of instability elements in the 3'-UTR, CYP7A1 mRNA displays rapid turnover (6-8, 20). Changes in CYP7A1 mRNA stability have been proposed to play a role in mediating bile acid repression of CYP7A1 transcription. (7, 40-43). There are two secondary effects of CYP7A1 enzymatic action that may require rapid changes. 1) Bile acids are cytotoxic, and their synthesis may require rapid regulation to prevent excessive accumulation and 2) in the hepatocyte, control of the cellular pool of cholesterol is intimately linked to expression of CYP7A1. The relatively rapid and variable turnover rate of CYP7A1 mRNA may ensure that changes in transcription rapidly invoke changes in the functional expression of this physiologically important enzyme. Additional studies show that the 3'-UTR of rat CYP7A1 mRNA prevents the expression of CYP7A1 in several non-hepatic tissue culture cell lines (RAW 264.1 macrophages and McArdle rat hepatoma cells).2 Removing the 3'-UTR of rat CYP7A1 results in a robust expression. These findings suggest that the factors necessary to stabilize rat CYP7A1 may contribute to its unique tissue (liver) and cell type (parenchymal cells located near efferent venules) (44, 45) expression. Our combined data suggest that regulated degradation of CYP7A1 mRNA compliments the changes in CYP7A1 gene transcription to provide a rapid and complex adaptation of enzyme expression to the metabolic demands of the cell, liver and animal.

    ACKNOWLEDGEMENTS

John Trawick, Don Martin, Casey Slattery, and T. Y. Hui are gratefully acknowledged for their contributions to these studies. We thank John Chiang for the generous gift of the cDNAs encoding the 3'-UTR of rat CYP7A1, David Russell for the cDNA for the coding region of CYP7A1 and Jeff Ross, Jon Miyake, and Xiang-Dong Fu for their helpful and insightful comments.

    FOOTNOTES

* The work was supported by National Institutes of Health Grants HL57974 and HL51648.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger This author is on sabbatical leave from the Institute for Nutrition Research, University of Oslo, Oslo, Norway. Supported by a grant from the Research Council of Norway.

§ To whom correspondence should be addressed: Dept. of Biology, 307 Life Sciences Bldg., 5500 Campanile Dr., San Diego State University, San Diego, CA 92182-4614. Tel.: 619-594-7936; Fax: 619-594-7937; E-mail: rdavis@sunstroke.sdsu.edu.

Published, JBC Papers in Press, April 11, 2000, DOI 10.1074/jbc.M002351200

2 G. L. Moore and R. A. Davis, unpublished data.

    ABBREVIATIONS

The abbreviations used are: CYP7A1, cholesterol-7alpha -hydroxylase; ECFP, enhanced cyan fluorescent protein; DRB, 5,6-dichlorobenzimidazole; PCR, polymerase chain reaction; UTR, untranslated region; tTA, tetracycline trans-activator.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Myant, N. B., and Mitropoulos, K. A. (1977) J. Lipid Res. 18, 135-153
2. Russell, D. W., and Setchell, K. D. (1992) Biochemistry 31, 4737-4749
3. Waxman, D. J. (1992) J. Steroid Biochem. Mol. Biol. 43, 1055-1072
4. Vlahcevic, Z. R., Pandak, W. M., Heuman, D. M., and Hylemon, P. B. (1992) Semin. Liver Dis. 12, 403-419
5. Edwards, P. A., and Davis, R. A. (1996) New Compr. Biochem. 31, 341-362
6. Noshiro, M., Nishimoto, M., and Okuda, K. (1990) J. Biol. Chem. 265, 10036-10041
7. Lavery, D. J., and Schibler, U. (1993) Genes Dev. 7, 1871-1884
8. Lee, Y. H., Alberta, J. A., Gonzalez, F. J., and Waxman, D. J. (1994) J. Biol. Chem. 269, 14681-14689
9. Pandak, W. M., Li, Y. C., Chiang, J. Y., Studer, E. J., Gurley, E. C., Heuman, D. M., Vlahcevic, Z. R., and Hylemon, P. B. (1991) J. Biol. Chem. 266, 3416-3421
10. Shefer, S., Nguyen, L. B., Salen, G., Ness, G. C., Chowdhary, I. R., Lerner, S., Batta, A. K., and Tint, G. S. (1992) J. Lipid Res. 33, 1193-1200
11. Peet, D. J., Turley, S. D., Ma, W., Janowski, B. A., Lobaccaro, J.-M., A., Hammer, R. E., and Mangelsdorf, D. J. (1998) Cell 93, 693-704
12. Hylemon, P. B., Li, Y. C., Chiang, J. Y., Studer, E. J., Gurley, E. C., Heuman, D. M., and Vlahcevic, Z. R. (1992) J. Biol. Chem. 267, 16866-16871
13. Twisk, J., Hoekman, M. F. M., Lehman, E. M., Meijer, P., Mager, W. H., and Princen, H. M. G. (1995) Hepatology 21, 501-510
14. Trawick, J. D., Wang, S.-L., Bell, D., and Davis, R. A. (1997) J. Biol. Chem. 272, 3099-3102
15. Feingold, K. R., Spady, D. K., Pollock, A. S., Moser, A. H., and Grunfeld, C. (1996) J. Lipid Res. 37, 223-228
16. Nitta, M., Ku, S., Brown, C., Okamoto, A. Y., and Shan, B. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 6660-6665
17. Lehmann, J. M., Kliewer, S. A., Moore, L. B., Olivier, B. B., Su, J.-L., Sundseth, S. S., Winegar, D. A., Blanchard, D. E., Spencer, T. A., and Willson, T. M. (1997) J. Biol. Chem. 272, 3137-3140
18. Foti, D., Stroup, D., and Chiang, J. Y. (1998) Biochem. Biophys. Res. Commun. 253, 109-113
19. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science 284, 1362-1365
20. Sundseth, S. S., and Waxman, D. J. (1990) J. Biol. Chem. 265, 15090-15095
21. Gossen, M., and Bujard, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5547-5551
22. Leighton, J. K., Dueland, S., Straka, M. S., Trawick, J., and Davis, R. A. (1991) Mol. Cell. Biol. 11, 2049-2056
23. Trawick, J. D., Lewis, K. D., Dueland, S., Moore, G. L., Simon, F. R., and Davis, R. A. (1996) J. Lipid Res. 37, 24169-24176
24. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159
25. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467
26. Jelinek, D. F., Andersson, S., Slaughter, C. A., and Russell, D. W. (1990) J. Biol. Chem. 265, 8190-8197
27. Thrift, R. N., Drisko, J., Dueland, S., Trawick, J. D., and Davis, R. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9161-9165
28. Jelinek, D. F., and Russell, D. W. (1990) Biochemistry 29, 7781-7785
29. Shaw, G., and Kamen, R. (1986) Cell 46, 659-667
30. Shyu, A.-B., Greenberg, M. E., and Belasco, J. G. (1989) Genes Dev. 3, 60-72
31. Lagnado, C. A., Brown, C. Y., and Goodall, G. J. (1994) Mol. Cell. Biol. 14, 7984-7995
32. Chen, C.-Y., A., Xu, N., and Shyu, A.-B. (1995) Mol. Cell. Biol. 15, 5777-5788
33. Zubiaga, A. M., Belasco, J. G., and Greenberg, M. E. (1995) Mol. Cell. Biol. 15, 2219-2230
34. Chen, C.-Y. A., You, Y., and Shyu, A.-B. (1992) Mol. Cell. Biol. 12, 5748-5757
35. Chen, C.-Y., A., and Shyu, A.-B. (1994) Mol. Cell. Biol. 14, 8471-8482
36. Sehgal, P. B., Darnell, J., J. E., and Tamm, I. (1976) Cell 9, 473-480
37. Andreou, E. R., and Prokipcak, R. D. (1998) Arch. Biochem. Biophys. 357, 137-146
38. Herrick, D. J., and Ross, J. (1994) Mol. Cell. Biol. 14, 2119-2128
39. Pandak, W. M., Stravitz, R. T., Lucas, V., Heuman, D. M., and Chiang, J. Y. (1996) Am. J. Physiol. 270, G401-G410
40. Twisk, J., Lehmann, E. M., and Princen, H. M. G. (1993) Biochem. J. 290, 685-691
41. Agellon, L. B., and Cheema, S. K. (1997) Biochem. J. 328, 393-399
42. Hoekman, M., Rientjes, J., Twisk, J., Planta, R. J., Princen, H., and Mager, W. H. (1993) Gene (Amst.) 130, 217-223
43. Kren, B. T., and Steer, C. J. (1996) FASEB J. 10, 559-573
44. Twisk, J., Hoekman, M. F., Mager, W. H., Moorman, A. F., de, B., P., Scheja, L., Princen, H. M., and Gebhardt, R. (1995) J. Clin. Invest. 95, 1235-1243
45. Massimi, M., Lear, S. R., Huling, S. L., Jones, A. L., and Erickson, S. K. (1998) Hepatology 28, 1064-1072
46. Noshiro, M., and Okuda, K. (1990) FEBS Lett. 268, 137-140
47. Kai, M., Eto, T., Kondo, K., Setoguchi, Y., Higashi, S., Maeda, Y., and Setoguchi, T. (1995) J. Lipid Res. 36, 367-374
48. Crestani, M., Galli, G., and Chiang, J. Y. L. (1993) Arch. Biochem. Biophys. 306, 451-460
49. Tzung, K.-W., Ishimura-Oka, K., Kihara, S., Oka, K., and Chan, L. (1994) Genomic 21, 244-248

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Lipid Res.Home page
E. P. Ratliff, A. Gutierrez, and R. A. Davis
Transgenic expression of CYP7A1 in LDL receptor-deficient mice blocks diet-induced hypercholesterolemia
J. Lipid Res., July 1, 2006; 47(7): 1513 - 1520.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
A. Gutierrez, E. P. Ratliff, A. M. Andres, X. Huang, W. L. McKeehan, and R. A. Davis
Bile Acids Decrease Hepatic Paraoxonase 1 Expression and Plasma High-Density Lipoprotein Levels Via FXR-Mediated Signaling of FGFR4
Arterioscler. Thromb. Vasc. Biol., February 1, 2006; 26(2): 301 - 306.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Onesto, E. Berra, R. Grepin, and G. Pages
Poly(A)-binding Protein-interacting Protein 2, a Strong Regulator of Vascular Endothelial Growth Factor mRNA
J. Biol. Chem., August 13, 2004; 279(33): 34217 - 34226.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
Y. Shao and F. Ismail-Beigi
Control of Na+-K+-ATPase {beta}1-subunit expression: role of 3'-untranslated region
Am J Physiol Cell Physiol, March 1, 2004; 286(3): C580 - C585.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D.-J. Shin, J. A. Campos, G. Gil, and T. F. Osborne
PGC-1{alpha} Activates CYP7A1 and Bile Acid Biosynthesis
J. Biol. Chem., December 12, 2003; 278(50): 50047 - 50052.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Kang, N. J. Spann, T. Y. Hui, and R. A. Davis
ARP-1/COUP-TF II Determines Hepatoma Phenotype by Acting as Both a Transcriptional Repressor of Microsomal Triglyceride Transfer Protein and an Inducer of CYP7A1
J. Biol. Chem., August 15, 2003; 278(33): 30478 - 30486.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
G. Wang, X. Guo, and J. Floros
Human SP-A 3'-UTR variants mediate differential gene expression in basal levels and in response to dexamethasone
Am J Physiol Lung Cell Mol Physiol, May 1, 2003; 284(5): L738 - L748.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
T. Y. Hui, L. M. Olivier, S. Kang, and R. A. Davis
Microsomal triglyceride transfer protein is essential for hepatic secretion of apoB-100 and apoB-48 but not triglyceride
J. Lipid Res., May 1, 2002; 43(5): 785 - 793.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
R. A. Davis, J. H. Miyake, T. Y. Hui, and N. J. Spann
Regulation of cholesterol-7{alpha}-hydroxylase: BAREly missing a SHP
J. Lipid Res., April 1, 2002; 43(4): 533 - 543.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
G. L. Moore and R. A. Davis
Expression of cholesterol-7{alpha}-hydroxylase in murine macrophages prevents cholesterol loading by acetyl-LDL
J. Lipid Res., April 1, 2002; 43(4): 629 - 635.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. Detich, S. Ramchandani, and M. Szyf
A Conserved 3'-Untranslated Element Mediates Growth Regulation of DNA Methyltransferase 1 and Inhibits Its Transforming Activity
J. Biol. Chem., June 29, 2001; 276(27): 24881 - 24890.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/26/19985    most recent
M002351200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baker, D. M.
Right arrow Articles by Davis, R. A.