HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 26, 20127-20135, June 30, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/26/20127    most recent M909580199v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Li, P.-X. Articles by Klamut, H. J. Search for Related Content PubMed PubMed Citation Articles by Li, P.-X. Articles by Klamut, H. J. Social Bookmarking                      What's this?

Placental Transforming Growth Factor- Is a Downstream Mediator of the Growth Arrest and Apoptotic Response of Tumor Cells to DNA Damage and p53 Overexpression^*

Pei-Xiang Li^§, Jeffrey Wong^§, Ayeda Ayed^§¶, Duc Ngo^§, Anthony M. Brade^§, Cheryl Arrowsmith^§¶, Richard C. Austin^**, and Henry J. Klamut^§

From the Divisions of  Experimental Therapeutics and ^¶ Molecular and Structural Biology, Ontario Cancer Institute, Princess Margaret Hospital, University Health Network, and the Departments of ^§ Medical Biophysics and  Radiation Oncology, University of Toronto, Toronto, Ontario M5G 2M9 and ^** Hamilton Civic Hospitals Research Centre and McMaster University, Hamilton, Ontario L8V 1C3, Canada

Received for publication, December 3, 1999, and in revised form, April 7, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The p53 tumor suppressor gene and members of the transforming growth factor- (TGF-) superfamily play central roles in signaling cell cycle arrest and apoptosis (programmed cell death) in normal development and differentiation, as well as in carcinogenesis. Here we describe a distantly related member of the TGF- superfamily, designated placental TGF- (PTGF-), that is up-regulated in response to both p53-dependent and -independent apoptotic signaling events arising from DNA damage in human breast cancer cells. PTGF- is normally expressed in placenta and at lower levels in kidney, lung, pancreas, and muscle but could not be detected in any tumor cell line studied. The PTGF- promoter is activated by p53 and contains two p53 binding site motifs. Functional studies demonstrated that one of these p53 binding sites is essential for p53-mediated PTGF- promoter induction and specifically binds recombinant p53 in gel mobility shift assays. PTGF- overexpression from a recombinant adenoviral vector (AdPTGF-) led to an 80% reduction in MDA-MB-468 breast cancer cell viability and a 50-60% reduction in other human breast cancer cell lines studied, including MCF-7 cells, which are resistant to growth inhibition by recombinant wild-type p53. Like p53, PTGF- overexpression was seen to induce both G₁ cell cycle arrest and apoptosis in breast tumor cells. These results provide the first evidence for a direct functional link between p53 and the TGF- superfamily and implicate PTGF- as an important intercellular mediator of p53 function and the cytostatic effects of radiation and chemotherapeutic cancer agents.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

DNA damage arising from exposure to radiation or genotoxic drugs results in the recruitment of DNA repair enzymes and changes in gene expression leading to cell cycle arrest and/or apoptosis (1). The p53 tumor suppressor gene product is an important mediator of the cellular response to DNA damage (2-4) and functions primarily as a transcription factor that binds to a specific consensus sequence in the promoter or intronic regions of target genes to activate their expression (5, 6). The growth arrest function of p53 can be attributed to its ability to directly transactivate the cyclin-dependent kinase inhibitor p21^waf1/cip1 (5, 7), leading to G₁ cell cycle arrest (8), as well as genes such as GADD45 (9), 14-3-3  (10), and B99 (11) involved in G₂ checkpoint control. The p53-dependent apoptotic response (12) is not well understood but appears to also involve direct transactivation of genes such as bax (13), Fas/APO1 (14), KILLER/DR5 (15), the PIG genes (16), IGF-BP3 (17), and PAG608 (18). Increased levels of bax (6), for example, promote the release of cytochrome c from mitochondria, leading to activation of initiator caspase 9 and the apoptotic caspase cascade (19, 20). However, neither bax nor any other apoptotic regulatory gene identified to date has been shown to be indispensable to apoptotic signaling by p53 (21-24). Rather, current evidence points to the existence of multiple p53-dependent apoptotic signaling pathways, some of which function in a cell type-specific manner.

The ability of p53 to directly transactivate genes that regulate cell cycle arrest and apoptosis, the high rate of mutation of the p53 gene in tumor cells (25), and the association between loss of p53 function and radiation resistance (26) together provide strong evidence for an important role for p53 in the response of tumor cells to radiation and chemotherapeutic drugs. However, evidence has also been presented for the existence of p53-independent growth arrest and apoptotic pathways that are responsive to DNA damage in cells deficient for wild-type p53 function. For example, loss of p53 function does not always correlate with increased resistance of tumor cells to ionizing radiation (27), and studies in our laboratory have shown that the response of human breast cancer cell lines to DNA damage arising from incorporation of the purine analog gancyclovir (9-[(1,3-dihydroxy-2-propoxy)methyl]guanine) triphosphate can be highly variable and does not correlate with endogenous p53 gene status (28). This issue is further complicated by evidence for cooperation between p53-dependent and p53-independent apoptotic pathways, leading to accelerated cell death when both pathways are activated simultaneously (29). Evidence for cross-talk between p53-dependent and p53-independent apoptotic pathways suggests that they intersect with each other and that these points of convergence represent important regulatory intermediates in these pathways.

To test this hypothesis, recent efforts in our laboratory have focused on the identification of genes positioned at points of convergence of p53-dependent and p53-independent growth arrest and apoptotic signaling pathways that are responsive to DNA damage. One of the genes identified encodes a 1.2-kb¹ mRNA that is strongly up-regulated by wild-type p53 and to a lesser extent by radiation treatment. Sequence analysis indicated that this gene corresponds to placental transforming growth factor- (PTGF-) (30, 31), a novel member of the transforming growth factor superfamily of proteins involved in the regulation of cell proliferation, differentiation, and apoptosis (32, 33).

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cell Growth and Apoptosis-- Conditions for growth of MDA-MB-468 and MCF-7 human breast cancer cell lines have been described previously (34). HS574.Mg normal human mammary cells and the T47D and SK-BR-3 human breast cancer cell lines were obtained from the ATCC and cultured under conditions recommended by the supplier. Procedures used to treat cells with radiation or recombinant adenoviral vectors and the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay (Sigma) used to monitor cell growth at various times post-treatment have been described previously (34). Western blot analysis of p21^waf1/cip1 protein expression was carried out essentially as described previously (28, 34). For flow cytometry, cells were infected with AdPTGF- or Adgal at 100 pfu/cell, harvested 4 days post-treatment, stained with propidium iodide, and analyzed using an EPICS flow cytometer (Coulter) as described previously (34). Procedures used to identify characteristic morphological (acridine orange and ethidium bromide staining) and biochemical (DNA laddering) features of apoptosis have been described elsewhere (34). Western blot analysis of -catenin cleavage products was carried out essentially as described previously (35).

mRNA Differential Display-- RNA Image kits (GenHunter, Brookline, MA) were used for mRNA differential display analysis of total RNA isolated from control and treated cells using the RNeasy total RNA kit (Qiagen, Chatsworth, CA) essentially as described elsewhere (36). In these experiments, duplicate total RNA samples isolated from untreated, Adp53 (100 pfu/cell)-, and radiation (10 Gy)-treated MDA-MB-468 cells were analyzed using 24 primer combinations (three downstream H-T11(G,A,C) and eight upstream random primers (H-AP1-8) supplied with the RNA Image kit.

Northern Blot Analysis-- Northern blots of total RNA isolated from control and treated cells using the RNeasy total RNA kit (Qiagen, Chatsworth, CA) were prepared essentially as described previously (28). Candidate cDNA fragments that were up-regulated in response to both Adp53 and radiation treatment on duplicate mRNA differential display gels were excised from the dried gel, eluted, reamplified by PCR, gel-purified, radiolabeled, and hybridized to Northern blots as described elsewhere (36). Tissue-specific expression was examined using a commercially available Northern blot prepared from poly(A)⁺ mRNA (2 µg/lane) isolated from adult tissues (CLONTECH).

Sequence Analysis-- cDNA fragments differentially expressed on Northern blots were subcloned into the TA vector system (In Vitrogen) and sequenced using vector-specific primers and a LI-COR model 400 automated sequencer (ACGT Corp., Toronto, Canada).

PTGF- Promoter Constructs and Reporter Gene Assays-- A 997-bp fragment containing 31 bp within the 5'-untranslated region in exon 1 and 966 bp upstream of the predicted transcription start site of the PTGF- gene in MDA-MB-468 cells was cloned upstream of the luciferase gene in the pGL3Basic vector (Promega) and transiently transfected into MDA-MB-468 cells using a calcium phosphate precipitation protocol (37). A CMV-gal reporter plasmid was included in all experiments as a control for transfection efficiency. Luciferase and -galactosidase reporter gene assays were performed on cell extracts prepared 24 h post-treatment with Adp53 (48 h post-transfection) using the Dual-Light Chemiluminescent Reporter Gene Assay System (Tropix, Inc.) and a Lumat LB9507 luminometer (EG & G Berthold). Cell extract protein concentrations were determined using the BCA protein assay (Pierce). PTGF- promoter activities were normalized for total protein concentrations as well as transfection efficiencies based on control CMV-gal promoter activities.

3TP Promoter Assay-- The 3TP-lux promoter-luciferase construct (kindly provided by J. Wrana) containing three consecutive 12-O-tetradecanoylphorbol-13-acetate response elements and a portion of the plasminogen activator inhibitor 1 promoter region has been shown to be induced by various members of the TGF- superfamily (38). The 3TP-lux plasmid was transfected into (Smad4-null) MDA-MB-468 cells in the presence or absence of pCMV5BMADR4, a eukaryotic expression vector encoding the Smad4 gene under the control of a cytomegalovirus (CMV) promoter (also kindly provided by J. Wrana). After 24 h, cells were washed extensively in PBS and treated with either AdPTGF- (50 pfu/cell), Adgal (50 pfu/cell; negative control), or recombinant TGF-1 (Sigma; 10 ng/ml; positive control) in serum-free medium. After an additional 24 h of incubation, cells were harvested, and luciferase activities were determined using the Luciferase Assay system (Promega).

Electrophoretic Mobility Shift Assays (EMSAs)-- A histidine-tagged, truncated (aa 82-360) p53 protein was expressed from the pET-15b plasmid (Novagen) in Escherichia coli (strain BL21 (DE3)) and purified using a one-step Ni²⁺ affinity column yielding a preparation of p53 that was 70-80% pure as determined by SDS-polyacrylamide gel electrophoresis. Complementary, single-stranded oligomers corresponding to the p53 consensus binding site (TTTGGACATGCCCGGGCATGTCCTTT) (39) or p53 binding site 1 (CACAGCCATGCCCGGGCAAGAACTCA) within the PTGF- gene promoter were combined at 50 pmol each and end-labeled with [-³²P]dATP. EMSA binding assays (40) contained annealed oligonucleotide probes and either purified, recombinant p53 or nuclear extracts (40) prepared from MDA-MB-468 cells either untreated or treated 24 h postinfection with a recombinant adenovirus expressing full-length, wild-type p53 protein (Adp53) at a multiplicity of infection (m.o.i.) of 100 pfu/cell. EMSA competition assays were performed over a range of 30-300-fold molar excess of the unlabeled, double-stranded competitor oligonucleotide. Binding reactions were incubated for 15 min at 4 °C and then for 15 min at 25 °C and analyzed by electrophoresis on 5% polyacrylamide gels in 1× TBE buffer at 20 mA for 1 h (41). Gels were dried and exposed to x-ray film for 24 h.

Recombinant Adenoviral Vectors-- A PTGF- minigene consisting of the 1.2-kb PTGF- cDNA cloned from MDA-MB-468 cells and CMV promoter and bovine growth hormone polyadenylation sequences cassette derived from the pRc/CMV vector (Invitrogen) was cloned into the pE1Sp1B adenoviral shuttle vector (42) to generate pE1Sp1B-CMVPTGF-. A recombinant adenoviral (Ad) vector expressing the PTGF- minigene was generated by co-transfection of pE1Sp1B-CMVPTGF- and pJM17 into 293 cells essentially as described elsewhere (42). Recombinant adenoviral plaques were clonally expanded and tested for integration of the PTGF- minigene by PCR using gene-specific primers, as well as by restriction fragment analysis of recombinant adenoviral DNA. Sequence analysis verified the integrity of the PTGF- minigene. A recombinant adenoviral vector expressing -galactosidase from a CMV promoter (Adgal) was kindly provided by Dr. F. Graham (McMaster University, Hamilton, Canada). Procedures used in the growth and maintenance of recombinant adenoviral stocks have been described elsewhere (34).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The PTGF- Gene Is Up-regulated upon Activation of Either p53-dependent or p53-independent DNA Damage-signaling Pathways-- The molecular events associated with the early stages of p53-dependent and p53-independent apoptotic signaling have not been well defined, but they appear to involve distinct pathways that can intersect and cooperate with each other (29, 43). This led us to postulate that key regulators of these apoptotic pathways might be coordinately regulated in response to death-promoting agents that specifically activate these signaling pathways. To explore this possibility, the mRNA differential display technique (45) was used to examine changes in gene expression in human MDA-MB-468 breast cancer cells associated with either wild-type p53 overexpression or radiation treatment. MDA-MB-468 cells express high levels of mutant p53 (273^Arg-His) (46) and undergo rapid and complete p53-dependent growth arrest and apoptosis following transduction with an adenoviral vector expressing wild-type p53 (Adp53; 100 pfu/cell) or p53-independent growth arrest and apoptosis following treatment with ionizing radiation (10 Gy) in the absence of functional p53 (Fig. 1a). Differential display analysis led to the identification of several candidate genes that are similarly up- or down-regulated in response to each of these apoptotic stimuli (Fig. 1b). One of these genes was shown by Northern blot analysis to correspond to a 1.2-kb mRNA that is strongly up-regulated in response to wild-type p53 overexpression and to a lesser extent by radiation treatment (Fig. 1c). Further analysis demonstrated that this gene is also induced by cisplatin and doxorubicin but not by serum withdrawal or treatment with retinoic acid (Fig. 1c). These results suggested that this gene is uniquely positioned at a convergence point of p53-dependent and -independent apoptotic pathways that are specifically responsive to DNA-damaging agents (47).

View larger version (80K): [in this window] [in a new window]   Fig. 1.   PTGF- gene expression is induced in response to either WT p53 overexpression or radiation treatment. a, DNA ladder formation characteristic of apoptosis in MDA-MB-468 cells at 36-48 h post-treatment with an adenoviral vector expressing wild-type p53 (Adp53; 100 pfu/cell) or radiation (Rad; 10 Gy). U, untreated control. B, MDA-MB-468 cells treated with an adenoviral vector expressing -galactosidase (Adgal, 100 pfu/cell). M, 1-kb molecular size marker. b, mRNA differential display analysis for transcriptional changes common to both Adp53 and radiation treatment. Lanes A-D correspond to 4 of 24 primer sets examined in total RNA extracted from MDA-MB-468 cells 36 h post-treatment with either Adp53 (100 pfu/cell; lane 2) or radiation (10 Gy; lane 3) relative to an untreated control (lane 1). The arrowhead indicates a 250-bp cDNA fragment that when cloned and sequenced was found to be homologous to the PTGF- gene. c, Northern blot analysis demonstrating that the PTGF- gene encodes an mRNA that is strongly up-regulated in MDA-MB-468 cells by 36 h post-treatment with Adp53 (6-h exposure) and to a lesser extent by treatment with radiation (Rad; 10 Gy), cisplatin (Cis; 5 µg/ml), and doxorubicin (Dox; 1.0 µg/ml) (3-day exposures). No induction was seen following treatment with retinoic acid (Ret; 1 µM) or serum withdrawal (Ser). U, untreated control. Blots were stripped and rehybridized with radiolabeled glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA as a loading control (lower panel).

Sequence analysis of a 250-bp cDNA fragment isolated from the differential display gel indicated that this gene is highly homologous to six independent entries in the GenBank^TM data base corresponding to novel members of the TGF- superfamily: Homo sapiens mRNA for TGF- superfamily protein (GenBank^TM accession no. AB000584) (48); human placental bone morphogenic protein (GenBank^TM accession no. U88323) (31); H. sapiens macrophage-inhibitory cytokine-1 (GenBank^TM accession no. AF019770) (49); human trophoblast mRNA (GenBank^TM accession no. U51731); H. sapiens prostate differentiation factor mRNA (GenBank^TM accession no. AF003934) (50); and H. sapiens prepro-placental TGF- gene (GenBank^TM accession no. AF008303) (30). Based on the high sequence homology between the gene identified in our study and each of these recently described TGF- superfamily members, we concluded that all of these cDNAs probably correspond to a single gene. This gene encodes a 296-amino acid protein containing an amino-terminal hydrophobic domain corresponding to a putative signal sequence, a potential protease cleavage site between aa 177 and 183 consisting of two overlapping dibasic amino acid motifs (RXXRXXR), and a 113-aa carboxyl-terminal domain containing seven positionally conserved cysteine residues that are nearly invariant within the mature regions of all members of the TGF- superfamily (32). Cloning and sequence analysis of reverse transcriptase-PCR products generated by primers corresponding to the full-length 1.2-kb H. sapiens mRNA for TGF- superfamily protein (GenBank^TM accession no. AB000584) confirmed that this gene is induced in MDA-MB-468 cells in response to both Adp53 and radiation treatment (Fig. 2a). Northern blot analysis indicated that this gene is expressed at high levels in placenta, at moderate levels in adult kidney, lung, pancreas, heart, and skeletal muscle, and at low levels in adult brain and liver (Fig. 2b). This tissue-specific profile of expression is almost identical to that reported for the prepro-placental TGF- gene (30), providing further evidence that these cDNAs probably represent the same gene. The existence of larger, cross-hybridizing bands in several of these tissues suggests that this gene is alternatively spliced or that closely related genes are co-expressed in these tissues. Interestingly, no expression was seen in transformed counterparts of some of these normal tissues (e.g. H661 lung cancer cells) or in any human breast cancer cell line examined (Fig. 2c). This may suggest that expression of this novel TGF- superfamily member is not compatible with malignant transformation and/or tumor progression. On the basis of its high levels of expression in placental tissue and its nearly complete homology to the prepro-placental TGF- gene, we subsequently refer to this gene as placental TGF- (PTGF-).

View larger version (35K): [in this window] [in a new window]   Fig. 2.   PTGF- gene expression in normal tissues and tumor cell lines. a, reverse transcriptase-PCR analysis of PTGF- gene expression in MDA-MB-468 cells either untreated (U) or treated with a recombinant adenovirus expressing wild type p53 (Adp53; 100 m.o.i.) or radiation (Rad; 10 Gy). Primers corresponding to the PTGF- gene amplify the expected 1.2-kb fragment in both Adp53- and radiation-treated cells but not in untreated controls. M, DNA size marker. b, multiple-tissue Northern blot analysis of PTGF- gene expression. Highest levels of expression of the 1.2-kb mRNA are seen in placental tissue, with lower levels detected in adult kidney, pancreas, lung, skeletal muscle, and heart. c, Northern blot analysis of PTGF- gene expression in a normal human mammary cell line (HS574.Mg) and normal primary human myoblasts (NMb) as well as a series of human breast (MCF-7, MDA-MB-468, and SK-BR-3), cervical (HeLa), and lung (H661) cancer cell lines. Total RNA extracted from normal human NMb infected with Adp53 (100 m.o.i.) was included as a positive control for PTGF- gene expression. Blots were stripped and rehybridized with radiolabeled glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA as a loading control (lower panel).

The PTGF- Gene Is Directly Trans-activated by p53-- To begin to examine the transcriptional mechanisms that govern the PTGF- gene response to p53-dependent and p53-independent DNA damage signaling events, a 997-bp genomic fragment corresponding to the promoter region and exon 1 of the PTGF- gene (30) in MDA-MB-468 cells was PCR-amplified, cloned, and sequenced (Fig. 3a). Only minor sequence variations were observed relative to the previously published PTGF- promoter sequence (30), and analysis of this sequence against the TFMATRIX transcription factor binding site profile data base identified several candidate regulatory motifs, many of which have been implicated in regulating gene expression during development (51-53), hematopoiesis (54-56), and in cellular responses to cytokines and growth factors (57-59) (Fig. 3a). Also identified were two potential p53 binding sites (39) located at +21 bp (p53 binding site 1) and at 455 bp (p53 binding site 2) relative to the predicted transcription start site for the gene (Fig. 3a). When cloned upstream of the luciferase reporter gene in the pGL3Basic vector and transiently transfected into MDA-MB-468 cells, PTGF- gene promoter activity increased 20-fold (relative to untreated controls) in response to WT p53 overexpression (Fig. 3b). The level of PTGF- promoter induction by WT p53 was equal to or greater than that of the p21^waf1/cip1 promoter (5) included as a positive control in all experiments. PTGF- promoter activity was also seen to be induced in response to radiation treatment, although to levels that were significantly lower (4-fold induction) than those seen following Adp53 infection (Fig. 3b). This pattern is consistent, however, with the relative levels of induction of endogenous PTGF- transcripts following radiation treatment. Together, these observations support the notion that transcription of the PTGF- gene increases in response to Adp53 or radiation treatment of MDA-MB-468 cells and that binding sites for transcription factors that mediate these p53-dependent and p53-independent signaling events are positioned within 966 bp upstream of the first exon of the gene.

View larger version (38K): [in this window] [in a new window]   Fig. 3.   Regulation of PTGF- gene expression by WT p53. a, sequence analysis of a 966-bp region corresponding to the PTGF- promoter in MDA-MB-468 cells identified a number of transcription factor binding site motifs including two putative p53 binding sites at +21 (p53 binding site 1) and 455 bp (p53 binding site 2) relative to the predicted transcription start site. p53 binding sites 1 and 2 exhibit 85% (17 of 20 nucleotides) and 80% (16 of 20 nucleotides) homology, respectively, to the consensus p53 binding motif shown below. b, a 966-bp genomic fragment corresponding to the PTGF- gene promoter was cloned upstream of the luciferase reporter gene in the pGL3Basic vector and transiently transfected into MDA-MB-468 cells, followed 24 h later by treatment with either Adp53 (p53) or radiation (Rad). Cell extracts were prepared at 0 (untreated; U) and 24 h post-treatment and analyzed for luciferase reporter gene activity (solid bars). PTGF- gene promoter-luciferase constructs containing mutations in either p53 binding site 1 (Mut p53-1; AGctcgaCCC-[ ]-GGGtcgaaaC) or p53 binding site 2 (mut p53-2; AGGgccagGa-[GAG]-AGGgccaaCa) were also tested for their response to Adp53 treatment. The p21waf1/cip1 gene promoter response to Adp53 treatment was also examined (open bars; p21). Luciferase activities (relative light units (RLU) × 103/mg of protein) represent the mean ± S.D. of a minimum of three independent experiments. c, electrophoretic mobility shift analysis of recombinant wild-type p53 binding to PTGF- p53 binding site 1. Binding reactions contained either no nuclear extract (probe alone; P), nuclear extract prepared from either untreated MDA-MB-468 cells (468) or MDA-MB-468 cells 24 h postinfection with an adenoviral vector expressing wild-type p53 (468 + Adp53), or purified recombinant p53 protein (Rec p53). 32P-End-labeled double-stranded oligonucleotide probes correspond to either a consensus p53 binding site (consensus) or PTGF- p53 binding site 1. Unlabeled consensus oligonucleotide was added at 100-fold molar excess in EMSA competition reactions (+ consensus). The arrows indicate the positions of gel-shifted bands corresponding to WT p53-oligonucleotide complexes (upper arrow) or truncated (aa 82-360) recombinant p53 complexes (lower arrow).

To examine whether p53 directly transactivates the PTGF- gene promoter, constructs containing mutations in each of the two putative p53 binding sites were tested for p53 induction relative to the wild-type promoter. As shown in Fig. 3b, mutation of p53 binding site 1 resulted in a 3-4-fold decline in PTGF- promoter activity following Adp53 treatment, although promoter activity was still 5-6-fold higher than untreated controls (Fig. 3b). Mutation of p53 binding site 2, on the other hand, had no effect on the level of induction of PTGF- promoter activity by WT p53 (Fig. 3b). These results suggest that p53 activates PTGF- gene expression in two ways: directly, by binding to p53 binding site 1, and indirectly, perhaps by influencing the binding of one or more as yet unidentified transcription factors to other regions of the PTGF- gene promoter.

Confirmation that site 1 functions as a p53 binding site was provided by EMSAs in which recombinant wild-type p53 protein and MDA-MB-468 cell nuclear extracts were incubated with radiolabeled, double-stranded oligonucleotides corresponding to either PTGF- p53 binding site 1 or a consensus p53 binding site control (Fig. 3c). Binding reactions containing PTGF- p53 binding site 1 generated EMSA bands with mobilities and intensities identical to the consensus p53 binding site control. This was observed with nuclear extracts prepared from MDA-MB-468 cells treated with Adp53 (468 + Adp53; Fig. 3) as well as with purified, recombinant wild type p53 protein (Rec p53). No bands were seen in binding reactions that contained either no protein extract (probe alone; P) or nuclear extracts prepared from untreated MDA-MB-468 cells (468). The increased mobility of bands formed in the presence of recombinant p53 reflects the smaller size of the recombinant p53 protein (aa 82-360) used in these binding reactions as compared with the full-length p53 protein (393 aa) expressed from the adenoviral vector. Further evidence for the specificity of this binding reaction was provided by the observation that band formation could be successfully competed by the addition of a 100-fold molar excess of an unlabeled, double-stranded oligonucleotide corresponding to the consensus p53 binding site (+ consensus; Fig. 3c) to EMSA binding reactions.

Overexpression of PTGF- Has Differential Effects on the Growth of Breast and Other Tumor Cell Lines-- Members of the TGF- superfamily are hormone-like polypeptides that play key roles in a variety of biological processes including cell cycle progression, differentiation, and apoptosis (60). Loss of responsiveness to TGF--mediated growth arrest has been implicated in the development of a variety of human cancers including breast cancer. MDA-MB-468 breast cancer cells are insensitive to TGF-1-mediated growth arrest due to homozygous deletions in both pRb, through which TGF-1 mediates G₁ cell cycle arrest (61), and Smad4 (DPC4), an important mediator of signal transduction by TGF- superfamily members (62). To facilitate an analysis of PTGF- gene function in MDA-MB-468 as well as other tumor and normal cell types, a recombinant adenoviral vector was constructed that contains the full-length 1.2-kb PTGF- cDNA under the control of the strong, constitutively expressed CMV promoter (AdPTGF-). Infection of MDA-MB-468 cells with AdPTGF- (50 pfu/cell) resulted in high levels of PTGF- mRNA expression by 2 days post-treatment (Fig. 5a) and an 80% decline in tumor cell growth relative to untreated controls by 7 days post-treatment, despite the absence of pRb and Smad4 function (Fig. 4a). Treatment with Adp53 resulted in a 94% decline in MDA-MB-468 cell viability under these conditions, consistent with the notion that PTGF- is not the sole downstream mediator of the growth inhibition function of p53. Cell viability declined less than 20% following treatment with Adgal under the same conditions.

View larger version (14K): [in this window] [in a new window]   Fig. 4.   Effects of PTGF- overexpression on human breast cancer cell viability. a, changes in MDA-MB-468 cell viability, expressed as percentage of untreated controls, are shown at 1, 3, 5, and 7 days post-treatment with a recombinant adenoviral vector (50 pfu/cell) expressing -galactosidase (shaded triangles), WT p53 (open squares), or PTGF- (closed circles). Values represent the mean ± S.D. of a minimum of five independent observations. b, a comparison of the effects of PTGF- and WT p53 overexpression on viability of several different human breast cancer cell lines and normal controls. Cell viability was measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay on day 7 postinfection with a recombinant adenoviral vector (50 pfu/cell) expressing -galactosidase, WT p53 (open bars), or PTGF- (shaded bars). Shown are the results for the MDA-MB-468, T47D, SK-BR-3, and MCF-7 breast cancer cell lines as well as for normal human mammary (HS574) and human fibroblast (FB) controls. Values are expressed as the percentage of Adgal-treated controls and represent the mean ± S.D. of a minimum of six independent observations.

To explore this question further, the effects of PTGF- overexpression were examined in a number of other human breast cancer cell lines, including MCF-7 cells, which we and others had previously shown to be resistant to WT p53 overexpression (34, 63). As shown in Fig. 4b, treatment of T47D and SK-BR-3 breast cancer cells with AdPTGF- (50 pfu/cell) resulted in 64 and 68% reductions in viability, respectively, relative to Adgal-treated controls. As with MDA-MB-468 cells, Adp53 treatment resulted in significantly greater decreases in T47D and SK-BR-3 cell viability (10 and 29% of Adgal-treated controls, respectively), consistent with the notion that PTGF- is a downstream mediator of p53 function but is not solely responsible for the growth-inhibitory effects of p53. Interestingly, AdPTGF- treatment was seen to reduce MCF-7 cell viability to 44% of Adgal-treated controls, whereas no significant decline in MCF-7 cell viability was seen following treatment with Adp53 under these conditions. These results suggest that, like p53 and other members of the TGF- superfamily, PTGF--mediated growth effects can vary significantly from one tumor cell type to another. Furthermore, the absence of a significant decrease in viability in either HS574.Mg normal mammary cell or normal human skin fibroblasts suggests that PTGF- overexpression may be particularly detrimental to tumor cell growth.

PTGF- Overexpression Can Lead to the Induction of p21^waf1/cip1, G₁ Cell Cycle Arrest, and Apoptosis-- To begin to explore the mechanism by which PTGF- overexpression can lead to decreased tumor cell viability, MDA-MB-468 and MCF-7 breast cancer cells were transduced with AdPTGF- and examined for established indicators of cell cycle arrest and apoptosis. Northern blot analysis verified that high levels of PTGF- mRNA persist for up to 4 days postinfection in MDA-MB-468 and MCF-7 cells treated with AdPTGF- (Fig. 5a). To investigate whether PTGF- can activate signal transduction pathways common to other members of the TGF- superfamily, MDA-MB-468 cells were transfected with a 3TP-lux reporter plasmid in the presence or absence of a second plasmid encoding wild-type Smad4 under the control of a constitutive viral (CMV) promoter. The 3TP-lux reporter has been previously shown to be responsive to Smad signaling initiated by members of the TGF- superfamily (38). Treatment of MDA-MB-468 cells with Adgal (50 pfu/cell), AdPTGF- (50 pfu/cell), or recombinant TGF-1 (10 ng/ml) resulted in no significant increases in 3TP-lux reporter activity in the absence of the Smad4 expression plasmid. However, cells co-transfected with the Smad4 expression plasmid exhibited 15- and 12-fold increases in 3TP-lux reporter activities following treatment with AdPTGF- and recombinant TGF-1, respectively, relative to Smad4-deficient cells treated under the same conditions (Fig. 5b). This represented a 5-6-fold increase over the levels of 3TP-lux induction in untreated cells expressing Smad4, demonstrating that, like TGF-1, PTGF- can induce 3TP-lux reporter activity in a Smad4-dependent manner.

View larger version (53K): [in this window] [in a new window]   Fig. 5.   Overexpression of PTGF- alone can induce G1 cell cycle arrest and apoptosis in human breast cancer cells. a, Northern blot analysis demonstrating that high levels of recombinant PTGF- mRNA are expressed in MDA-MB-468 and MCF-7 cells at 48-96 h postinfection (100 m.o.i.) with a recombinant adenoviral vector expressing PTGF- from a CMV promoter (AdPTGF-). M, mock-infected control; V, Adgal (100 m.o.i.)-infected control at 72 h post-treatment. Blots were stripped and rehybridized with a GAPDH cDNA probe as a loading control. b, 3TP promoter induction in untreated MDA-MB-468 cells (none) or 24 h post-treatment with Adgal (negative control; 50 pfu/cell), AdPTGF- (50 pfu/cell), or recombinant TGF-1 (positive control; 10 ng/ml) in serum-free medium. Fold induction reflects the ratio of luciferase activity measured in the presence and absence of a Smad4 expression plasmid co-transfected with the 3TP promoter plasmid as described under "Experimental Procedures." No significant differences in 3TP promoter activity were observed in the absence of the Smad4 expression plasmid under any treatment condition examined. c, flow cytometric analysis showing the relative proportions of MCF-7 cells in the G1, S, and G2/M phases of the cell cycle at 4 days post-treatment with either AdPTGF- or Adgal at 100 m.o.i. relative to an untreated control. The increased G1/S ratio in AdPTGF--treated cells (G1 arrest) represents both an increase in the percentage of the total cell population in G1 as well as a decrease in the S phase of the cell cycle. No G1 arrest was seen in MDA-MB-468 cells treated under the same conditions (not shown). d, Western blot analysis of p21waf1/cip1 levels in protein extracts prepared from MDA-MB-468 and MCF-7 cells at 0, 24, and 48 h postinfection with AdPTGF- (100 m.o.i.) or at 48 h postinfection with Adgal (100 m.o.i.). The arrows indicate the single band detected by the p21waf1/cip1-specific antibody. e, protein extracts isolated from MDA-MB-468 and MCF-7 cells at time 0 and 1-5 days postinfection with AdPTGF- at 100 m.o.i. were examined by Western blot analysis for cleavage of -catenin. The 60-kDa -catenin cleavage product (arrow) became evident by 2 days postinfection in both cell lines. No -catenin cleavage products were detected in mock-infected or Adgal-infected controls (not shown).

TGF- inhibits epithelial cell growth by causing growth arrest at the G₁ phase of the cell cycle, at least in part by up-regulating cyclin-dependent kinase inhibitors like p21^waf1/cip1 (64). TGF- has also been shown to induce apoptosis in a variety of cancer cell lines including MCF-7 cells (65, 66). Flow cytometric analysis demonstrated that PTGF- does signal G₁ cell cycle arrest in MCF-7 cells, as evidenced by an increase in the G₁/S ratio from 1.1 in untreated cells to 21.8 following AdPTGF- treatment (Fig. 5c). G₁ arrest was not evident in MDA-MB-468 cells following AdPTGF- treatment (data not shown), a finding consistent with the absence of pRb and/or Smad4 function in these cells. To determine whether increased p21^waf1/cip1 levels are associated with PTGF--mediated G₁ arrest, Western blots of MDA-MB-468 and MCF-7 cell extracts prepared at 0, 24, and 48 h post-treatment with AdPTGF- were probed with a p21^waf1/cip1-specific antibody. As shown in Fig. 5d, AdPTGF- treatment was seen to increase p21^waf1/cip1 protein levels in both MDA-MB-468 and MCF-7 cells by 48 h postinfection, consistent with studies showing that TGF- can induce p21^waf1/cip1 gene expression in a p53-independent manner (67). No increase in p21^waf1/cip1 protein was seen following infection of either cell line with a control (Adgal) adenovirus under the same conditions. MDA-MB-468 and MCF-7 cells were also examined for changes characteristic of apoptosis following AdPTGF- treatment. 60-kDa -catenin cleavage products associated with caspase 3 activation were evident in both cell lines as early as 2 days post-treatment with AdPTGF- and appeared to increase over the 5-day period studied (Fig. 5e). Acridine orange/ethidium bromide staining confirmed that treatment of MDA-MB-468 cells with AdPTGF- results in morphological changes (e.g. nuclear condensation and fragmentation) characteristic of apoptotic cell death (data not shown). Taken together, these results are consistent with a role for PTGF- as a downstream mediator of the p53-dependent and p53-independent growth arrest and apoptotic response of cells to DNA damage.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Mutations in genes that mediate growth arrest and apoptosis in response to DNA damage contribute to carcinogenesis and the development of resistance to genotoxic anticancer agents (68). The p53 tumor suppressor gene plays a central role in signaling growth arrest and apoptosis in response to DNA damage, primarily through its ability to activate the expression of downstream target genes such as p21^waf1/cip1 and bax. However, cells deficient in p53 function can still invoke a growth arrest and apoptotic response following DNA damage, pointing to the existence of one or more parallel, p53-independent signaling pathways. Cell-specific variations in the activating thresholds for different death-promoting agents, along with evidence for cross-talk between different apoptotic signaling pathways (29, 69), have led to the notion that apoptotic thresholds are determined, at least in part, by the expression of key regulatory proteins positioned at points of intersection or convergence of different signaling pathways (70, 71). In a search for genes that are transcriptionally responsive to disparate death-promoting stimuli, we have identified the gene encoding placental transforming growth factor- (PTGF-) as a downstream target of both p53-dependent and p53-independent DNA damage pathways. Nucleotide and amino acid sequence alignments suggest that PTGF- is a novel, distantly related member of the TGF- superfamily of cytokines and appears to be identical to several genes cloned independently in other laboratories on the basis of their high levels of expression in placental or prostate tissues (30, 31, 48, 50), the presence of a secretory signal sequence (48), or an association with macrophage activation (49). The apparent functional diversity and tissue-specific expression of this gene point to an important role for PTGF- in normal tissue development and homeostasis.

In the present study, Northern blot analysis demonstrated that PTGF- gene expression is strongly induced by wild-type p53 and to a lesser extent by radiation and genotoxic chemotherapeutic agents in the absence of wild-type p53. Sequence analysis of the PTGF- gene promoter identified two putative p53 binding site motifs, and mutation of one of these p53 binding motifs was seen to abolish promoter responsiveness to WT p53. Direct binding of WT p53 to this p53 binding site motif was confirmed by EMSA, pointing to a direct role for WT p53 in the activation of PTGF- gene expression. Thus, PTGF- appears to be one of a growing list of p53 target genes, many of which have been shown to play a role in the growth arrest and apoptotic functions of p53.

The absence of detectable levels of PTGF- gene transcripts in a series of seven human breast tumor cell lines as well as in several transformed counterparts of tissues that normally express the gene suggests that PTGF- expression may be incompatible with malignant transformation and/or tumor progression. Support for this view was provided by functional studies that demonstrated that overexpression of PTGF- alone can signal growth arrest and apoptosis of human breast cancer cell lines in vitro. These results are consistent with a role for PTGF- as an important downstream mediator of the cellular response to DNA damage, although the precise contribution of PTGF- to the overall growth arrest and apoptotic response remains to be determined. Previous studies in our laboratory (28, 34) and in others (63) have shown that recombinant WT p53 overexpression can result in differential growth arrest and apoptotic responses in different tumor cell types (e.g. those expressing mutant p53 versus wild type p53). The differential effects of Adp53 on MDA-MB-468 and MCF-7 cell viability illustrate this point. The 80% reduction in MDA-MB-468 cell viability following adenovirus-mediated PTGF- gene transfer is consistent with a role for PTGF- as a downstream mediator of WT p53 function. Furthermore, the greater sensitivity of MCF-7 cells to PTGF- overexpression (>50% decrease in viability) points to a defect in p53-dependent signaling upstream of the PTGF- gene and may account, at least in part, for the resistance of MCF-7 cells to WT p53 overexpression. Analysis of PTGF- effects in several different human breast cancer cell lines indicated that, like p53, the response of individual tumor cell lines to PTGF- can be highly variable. These results are similar to those in studies of other known downstream mediators of p53 function and support the view that activating thresholds for individual death-promoting stimuli can vary significantly from one tumor cell type to another.

Previous studies of the biological and signaling activities of the PTGF- homologues macrophage-inhibitory cytokine (49) and prostate-derived factor (50) demonstrated that this gene encodes a secreted protein that activates signal transduction along the same pathway as other members of the TGF- superfamily. Our observation of Smad4-dependent 3TP promoter activation by PTGF- in MDA-MB-468 cells provided further evidence that PTGF- is secreted from cells and can activate signal transduction pathways common to other TGF- superfamily members. Members of the TGF- superfamily initiate signaling from the cell surface by interacting with distinct serine/threonine kinase receptors (72), which in turn initiate a complex series of downstream signaling events involving phosphorylation of receptor-activated Smad proteins (Smad1, -2, -3, -5, and -9) (73, 74). Smad4 forms heteromeric complexes with receptor-activated Smads to promote their translocation to the nucleus (75, 76), where they can associate with transcriptional coactivators and transactivate TGF--regulated genes (77). The growth-inhibitory function of TGF- is mediated, at least in part, through transcriptional activation of the cyclin-dependent kinase inhibitor p21^waf1/cip1 (78). Consistent with this view, PTGF- was seen to increase p21 protein levels and induce G₁ cell cycle arrest in MCF-7 cells. However, while Smads are required for growth inhibition by TGF-, they are not by themselves sufficient for p21^waf1/cip1 gene induction. Rather, p21^waf1/cip1 gene activation appears to also involve TGF--mediated activation of the Ras/mitogen-activated protein kinase pathway (79). This issue is further complicated by our observation of increased p21^waf1/cip1 protein levels in MDA-MB-468 cells treated with AdPTGF-. Since MDA-MB-468 cells carry a homozygous deletion of the complete Smad4 coding region (80), this suggests that p21^waf1/cip1 induction can occur in the absence of Smad signaling. Whether this involves transcriptional activation through alternative (Smad4-independent) receptor-Smad or Ras/mitogen-activated protein kinase pathways or post-transcriptional mechanisms remains to be determined.

In addition to signaling G₁ cell cycle arrest, TGF- also plays an important role in activating apoptotic signaling pathways in a variety of cell types including cancer cell lines (66). In MCF-7 cells, increased TGF- levels have been associated with the induction of apoptosis in response to several anticancer agents, including tamoxifen (65). Recent evidence suggests that TGF--mediated apoptotic signaling involves up-regulation of connective tissue growth factor, leading to reduced levels of Bcl-2 protein expression (81). Our observation that PTGF- can induce apoptosis in MCF-7 cells is consistent with evidence that PTGF- utilizes signal transduction pathways common to other TGF- superfamily members. However, apoptosis of Smad4-deficient MDA-MB-468 cells treated with AdPTGF- points to the existence of an alternative, Smad4-independent apoptotic signaling pathway. Whether this involves the Ras/mitogen-activated protein kinase pathway or alternative, PTGF--specific signaling pathways remains to be determined (73, 82, 83). In this regard, it is interesting to note that c-Jun N-terminal kinase has been implicated in DNA damage-mediated apoptosis (84) as well as TGF--mediated, Smad4-independent activation of fibronectin synthesis in a human fibrosarcoma cell line (82).

In summary, the PTGF- gene is up-regulated in response to both p53-dependent and p53-independent signaling events arising from DNA damage. The PTGF- gene promoter appears to be directly transactivated by WT p53, and overexpression of PTGF- alone was seen to signal growth arrest and apoptosis in human breast tumor cell lines. These results provide the first evidence for a direct functional link between DNA damage, WT p53, and the TGF- superfamily of cytokines and implicate PTGF- as an important downstream mediator and point of convergence of p53-dependent and p53-independent DNA damage pathways. In addition, secretion of PTGF- provides a novel route through which signals arising from DNA damage can be communicated to neighboring cells. This raises the intriguing possibility that PTGF- contributes to the bystander effect associated with WT p53 gene transfer therapy (44, 85, 86).

	FOOTNOTES

^* This work was supported in part by grants from the Foundation for Gene and Cell Therapy, the Canadian Breast Cancer Foundation, and the Medical Research Council of Canada as well as a Jessie Davidson Medical Research Council Fellowship (to A. M. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Medical Biophysics, University of Toronto, Ontario Cancer Institute, Princess Margaret Hospital, 610 University Ave., Rm. 10-721, Toronto, Ontario M5G 2M9, Canada. Tel.: 416-946-2981; Fax: 416-946-2984; E-mail: hklamut@oci.utoronto.ca.

Published, JBC Papers in Press, April 20, 2000, DOI 10.1074/jbc.M909580199

	ABBREVIATIONS

The abbreviations used are: kb, kilobase(s); TGF-, transforming growth factor-; PTGF-, placental TGF-; pfu, plaque-forming units; bp, base pair(s); CMV, cytomegalovirus; aa, amino acid(s); m.o.i., multiplicity of infection; WT, wild type; Gy, gray; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shif assay.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES