HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 27, 20324-20336, July 7, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/27/20324    most recent M000572200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Mould, A. P. Articles by Humphries, M. J. Search for Related Content PubMed PubMed Citation Articles by Mould, A. P. Articles by Humphries, M. J. Social Bookmarking                      What's this?

Molecular Basis of Ligand Recognition by Integrin ₅₁

I. SPECIFICITY OF LIGAND BINDING IS DETERMINED BY AMINO ACID SEQUENCES IN THE SECOND AND THIRD NH₂-TERMINAL REPEATS OF THE  SUBUNIT^*

A. Paul Mould, Janet A. Askari, and Martin J. Humphries

From the Wellcome Trust Centre for Cell-Matrix Research, School of Biological Sciences, University of Manchester, Manchester M13 9PT, United Kingdom

Received for publication, January 27, 2000, and in revised form, March 30, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The NH₂-terminal portion (putative ligand-binding domain) of  subunits contains 7 homologous repeats, the last 3 or 4 of which possess divalent cation binding sequences. These repeats are predicted to form a seven-bladed -propeller structure. To map ligand recognition sites on the ₅ subunit we have taken the approach of constructing and expressing _V/₅ chimeras. Although the NH₂-terminal repeats of ₅ and _V are >50% identical at the amino acid level, ₅₁ and _V1 show marked differences in their ligand binding specificities. Thus: (i) although both integrins recognize the Arg-Gly-Asp (RGD) sequence in fibronectin, the interaction of ₅₁ but not of _V1 with fibronectin is strongly dependent on the "synergy" sequence Pro-His-Ser-Arg-Asn; (ii) ₅₁ binds preferentially to RGD peptides in which RGD is followed by Gly-Trp (GW) whereas _V1 has a broader specificity; (iii) only ₅₁ recognizes peptides containing the sequence Arg-Arg-Glu-Thr-Ala-Trp-Ala (RRETAWA). Therefore, amino acid residues involved in ligand recognition by ₅₁ can potentially be identified in gain-of-function experiments by their ability to switch the ligand binding properties of _V1 to those of ₅₁. By introducing appropriate restriction enzyme sites, or using site-directed mutagenesis, parts of the NH₂-terminal repeats of _V were replaced with the corresponding regions of the ₅ subunit. Chimeric subunits were expressed on the surface of Chinese hamster ovary-B2 cells (which lack endogenous ₅) as heterodimers with hamster ₁. Stable cell lines were generated and tested for their ability to attach to ₅₁-selective ligands. Our results demonstrate that: (a) the first three NH₂-terminal repeats contain the amino acid sequences that determine ligand binding specificity and the same repeats include the epitopes of function blocking anti- subunit mAbs; (b) the divalent cation-binding sites (in repeats 4-7) do not confer ₅₁- or _V1-specific ligand recognition; (c) amino acid residues Ala¹⁰⁷-Tyr²²⁶ of ₅ (corresponding approximately to repeats 2 and 3) are sufficient to change all the ligand binding properties of _V1 to those of ₅₁; (d) swapping a small part of a predicted loop region of _V with the corresponding region of ₅ (Asp¹⁵⁴-Ala¹⁵⁹) is sufficient to confer selectivity for RGDGW and the ability to recognize RRETAWA.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Integrins are ,-heterodimeric transmembrane receptors that play central roles in cell adhesion, migration, differentiation, and survival (1). More than 20 distinct integrin heterodimers have been identified, and each integrin recognizes a different set of extracellular matrix or cell-surface proteins. The major sequences recognized by integrins within their ligands have been shown to be short motifs that contain a critical Asp or Glu residue, such as Arg-Gly-Asp (RGD).¹ Analysis of the three-dimensional structures of integrin ligands has revealed that these recognition motifs are displayed in surface-exposed sites (2, 3).

Ligand-binding sites within integrins are less well characterized. Although ligand recognition is known to involve the NH₂-terminal regions of both  and  subunits (4, 5), unresolved questions include (i) what is the precise location of the ligand-binding sites? and (ii) how is the specificity of integrin-ligand binding determined?

The tertiary structure of integrins has not yet been determined; however, high quality structure predictions have been made for the ligand-binding domains of both subunits. These predictions are supported by extensive biochemical analyses (6-9). The NH₂-terminal portion of integrin  subunits has been shown to contain seven homologous repeats, each 60-70 amino acid residues in length. Repeats 4-7 (or in some integrins repeats 5-7) contain putative divalent cation-binding sites (10). The seven NH₂-terminal repeats are predicted to fold cooperatively into a seven-bladed -propeller (11). Each blade of the propeller contains four -strands connected by loops of varying length; these strands are tilted such that the connecting loops are either on the lower or upper surfaces of the propeller. Loops between the first and second, and between the third and fourth -strands lie on the lower surface of the propeller, whereas loops between the second and third -strands, and between the fourth -strand of one blade and first -strand of the next blade lie on the upper surface. The divalent cation-binding sites are predicted to lie on the lower surface of the propeller.

An inserted (I or A) domain of about 200 amino acid residues is present in about one-third of integrin  subunits, lying between repeats 2 and 3. In  subunits that contain an A-domain, this module contains the major sites involved in ligand binding (2, 9, 12-14). Ligands have been shown to interact with the top face of this domain through a metal ion-dependent adhesion site (MIDAS) motif (15-18). Although the A-domain is present in only a subset of  subunits, the region of the  subunit that participates in ligand recognition has been predicted to have a tertiary fold similar to that of an A-domain (19-22). This domain may also interact with ligand through a MIDAS site (19-25).

A large number of studies have investigated the location of ligand-binding sites in  subunits that lack an A-domain but no consensus has emerged. Cross-linking of a peptide from the  chain of fibrinogen to _IIb3 showed that the major site of interaction was in the fifth NH₂-terminal repeat (26). An RGD-containing peptide also cross-linked to _V3 via a site in the divalent cation binding repeats, although some cross-linking was also observed to the second and third repeats (27). In addition, recombinant proteins containing repeats 4-7 of _IIb or ₅ have been shown to possess ligand binding activity (28, 29). In contrast to these findings, the epitopes of function blocking anti- subunit mAbs have been localized to repeats 1-3 (4, 8, 30-36), and mutations in repeats 2-4 of ₃, ₄, ₅, and _IIb have been shown to perturb ligand recognition (6, 33-39).

Integrin ₅₁ is a widely distributed cell surface receptor for fibronectin, and has served as a prototype for the study of integrin-ligand interactions. The central cell-binding domain (CCBD) of fibronectin contains a number of repeated modules termed fibronectin type III repeats. An RGD sequence in the tenth type III repeat is the major binding site for ₅₁ (40, 41); however, ₅₁ differs from other fibronectin-binding integrins, such as those of the _V family, in that ligand recognition is also strongly dependent on binding of a synergy sequence (Pro-His-Ser-Arg-Asn) in the ninth type III repeat (42-44). In addition, although several closely related integrins (such as _V1, _V3, _V5, and _IIb3) recognize the RGD sequence, the nature of the amino acid residues COOH-terminal to RGD has a major effect on the affinity and specificity of integrin binding. For example, ₅₁ shows strong selectivity toward peptides containing the sequence RGDGW, whereas _V integrins bind well to peptides containing the sequences RGDXF or RGDXR (where X is frequently Ser or Thr) (45, 46). In addition, a specific ligand peptide for ₅₁, Arg-Arg-Glu-Thr-Ala-Trp-Ala (RRETAWA), has been isolated from a Cys-X₇-Cys phage display library (47). Although the RRETAWA sequence appears unrelated to RGD, the binding sites for RRETAWA and RGD on ₅₁ are closely overlapping because a peptide containing the RRETAWA sequence acts as a direct competitive inhibitor of RGD binding to ₅₁ (36).

A possible criticism of previous integrin mutagenesis studies is that only a loss of ligand binding was demonstrated, therefore it is possible that these mutations had an indirect effect on ligand recognition by perturbing integrin structure. Here we have taken the approach of constructing and expressing chimeric _V/₅ subunits to determine the regions of ₅ that when introduced into _V cause gain of ligand-binding function. Our results show that replacing the second and third repeats of _V with those of ₅ converts _V1 into a receptor with the same ligand binding specificity as ₅₁. Furthermore, we demonstrate that a short putative loop region connecting the second and third repeats is involved in the binding of RRETAWA and RGDGW-containing peptides. Our findings are consistent with the -propeller model and appear to rule out a direct role for the divalent cation-binding sites in ligand recognition.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Monoclonal Antibodies and Peptides-- MAbs 16 and 11 recognizing the human ₅ subunit, and mAb 13 recognizing the human ₁ subunit were gifts from Dr. K. Yamada (National Institute of Dental Research, NIH, Bethesda, MD). Mouse anti-human ₅ mAbs VC5, P1D6, and SAM-2 were purchased from PharMingen (San Diego, CA), Life Sciences (Paisley, Scotland, United Kingdom), and Monosan (Uden, The Netherlands), respectively. Mouse anti-human ₅ mAbs SAM-1 and JBS5 were from Serotec (Oxford, UK). Mouse anti-human _V mAbs 14D9.F8 and 17E6 were gifts from Dr. S. Goodman (Merck KgaA, Darmstadt, Germany), rat anti-human _V mAb 69.6.5 was purchased from Coulter Electronics (Luton, UK), mouse anti-human mAb P3G8 was purchased from Chemicon (Harrow, UK), and mouse anti-human _V mAb LM142 was a gift from Dr. D. Cheresh (Scripps, La Jolla, CA). All antibodies were used as purified IgG. Rabbit, mouse, and rat IgG were obtained from Sigma (Poole, UK). The synthetic peptides GACRRETAWACGA, GCRGDGWCA, and GCRGDGRCA were obtained from Genosys Biotech Ltd. (Cambridge, UK). Peptides were cyclized using 10% Me₂SO according to published protocols (48), and purified by filtration on Sephadex G-10 (Sigma).

Mutagenesis-- Full-length clones of human _V and ₅ were gifts from D. Cheresh (Scripps Research institute, La Jolla, CA) and K. Yamada (National Institute of Dental Research, NIH, Bethesda, MD), respectively. A 1.3-kilobase BamHI/HindIII fragment of _V was subcloned into pUC118. The following oligonucleotides (listed 5' to 3') were used to introduce restriction enzyme sites into _V by site-directed mutagenesis using the GeneEditor kit (Promega, Southhampton, UK): TTTGATGACAGCTACCTAGGTTATTCTGTGGC (AvrII site), GAGCATCTGTGAGGGCCCATGGGGATAAAATTTTGGC (NcoI site), GGACAGGGATTTTGCCAAGGAGGCTTCAGCATTGATTTTAC (BglI site). The mutations introducing the AvrII and BglI sites were silent; however, the mutation introducing the NcoI site caused changes to the amino acid sequence and so an additional base change was made to convert the amino acid sequence at this site to that of ₅ (S100KQ to A107HG).

The presence of the mutations was verified by restriction enzyme digestion of miniprep DNA (Qiagen) prepared from individual clones. To reconstitute full-length _V the mutated 5' BamHI/HindIII fragment of _V was ligated with a 3' HindIII/XbaI fragment of _V into pCDNA3 cut with BamHI and XbaI. To construct the _V/₅(F1-G232) chimera, a BamHI/AvrII fragment of ₅ was ligated with an AvrII/ApaI fragment of _V into pCDNA3 cut with BamHI and ApaI. To construct the ₅/_V(F1-G223) chimera, a BamHI/AvrII fragment of _V was ligated with an AvrII/XhoI fragment of ₅ into ₅ in pCDNA3 cut with BamHI and XhoI. To construct the _V/₅(A107-G232) chimera, a BamHI/NcoI fragment of _V was ligated with a NcoI/AvrII fragment of ₅ and an AvrII/ApaI fragment of _V into pCDNA3 cut with BamHI and ApaI. To construct the _V/₅(A107-C164) chimera, a BamHI/NcoI fragment of _V was ligated with a NcoI/BglI fragment of ₅ and a BglI/XbaI fragment of _V into pCDNA3 cut with BamHI and XbaI. To construct the _V/₅(C164-G232) chimera, a BamHI/BglI fragment of _V was ligated with a BglI/AvrII fragment of ₅ and an AvrII/ApaI fragment of _V into pCDNA3 cut with BamHI and ApaI. The constructs were verified by DNA sequencing. Chimeras were designated according to the position of the restriction site in the corresponding amino acid sequence.

The following oligonucleotides (listed 5' to 3') were used to exchange amino acid residues within putative loop regions of _V with the corresponding amino acid residues in ₅: CATTGGAGAACTGAGAAGGAGCCGCTGAGCGACCCTGTTGGAACATGC (Met¹¹⁸-Glu¹²³ of _V with Lys¹²⁵-Asp¹³⁰ of ₅); GCTCCATGTAGATCAGATTTTAGTTGGGCTGCTGGACAGGGATTTTGT (Gln¹⁴⁵-Asp¹⁵⁰ of _V with Asp¹⁵⁴-Ala¹⁵⁹ of ₅); GGTGGTCCTGGTAGCTATTTTTGGCAAGGTCAGC (Phe¹⁷⁷- Tyr¹⁷⁸ of _V with Tyr¹⁸⁶-Phe¹⁸⁷ of ₅); CAATTAGCAACTCGGCAGGCATCATCTATTTTTGATGACAG (Thr²¹²-Ala²¹⁵ of V with Gln²²¹-Ser²²⁴ of ₅); AATAACCAATTACAAACTCGGCAGGC and GCATCATCTATTTATGATGACAGCTATTTG (Ala²⁰⁹ and Phe²¹⁷ of _V with Gln²¹⁸ and Tyr²²⁶ of ₅, respectively).

Oligonucleotides were purchased from MWG Biotech (Southampton, UK) or from PE-Applied Biosystems (Warrington, UK). Restriction enzymes were from New England Biolabs (Hitchin, UK) or Roche Molecular Biochemicals (Lewes, UK).

Proteins-- Recombinant fragments of the CCBD of fibronectin were produced as before (49) and purified using DEAE-Sephacel (Amersham Pharmacia Biotech) and hydroxylapatite (Bio-Rad, Hemel Hempstead, UK) chromatography, as described previously (5).

Coupling of Cyclic Peptides to IgG-- Rabbit IgG (3 mg) was dissolved in 1 ml of Dulbecco's PBS without Ca²⁺ and Mg²⁺ (PBS). To this solution, approximately 0.5 mg of bis(sulfosuccinimidyl)suberate (Pierce, Chester, UK) dissolved in 1 ml of PBS was added. The mixture was incubated for 5 min at room temperature, and then cyclic peptide (1-1.5 mg dissolved in 1 ml of PBS) was added. After incubation of the mixture for 5 min at room temperature, unreacted peptide and cross-linker were removed by dialysis against PBS. The dialysate was centrifuged at 13,000 × g for 15 min, and stored in aliquots at 70 °C.

Transfection-- Chinese hamster ovary cells B2 variant (50) (a gift from R. L. Juliano, University of North Carolina, NC) were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 2 mM glutamine, and 1% non-essential amino acids (growth medium). Cells were detached using 0.05% (w/v) trypsin, 0.02% (w/v) EDTA in PBS, and plated overnight into 6-well culture plates (Costar). 2 µg of wild-type _V or chimeric _V/₅ DNA/well was used to transfect the cells using LipofectAMINE PLUS reagent (Life Sciences) according to the manufacturer's instructions. 24 h post-transfection, cells were removed from the wells using Hank's balanced salt solution containing 5 mM EDTA and tested for transient expression of transfected integrin subunits by flow cytometry. 48 h post-transfection, cells were passaged into 75-cm² flasks (Costar) and the medium was supplemented with 0.7 mg/ml G418 (Life Sciences). G418-resistant colonies were harvested after 10-14 days. The cell population was incubated with mAb P3G8 or mAb11, and then with anti-mouse or anti-rat IgG-coated magnetic beads (Dako) to select for cells expressing wild-type or chimeric integrins. Cells were then cloned by limiting dilution to obtain clones with a high level of expression. Chinese hamster ovary-B2 cells transfected with wild-type human ₅ were a gift from Y. Takada (Scripps Research Institute, La Jolla, CA). The reactivity of cloned cells with a panel of anti-₅ and anti-_V mAbs was assessed using flow cytometry, using rat IgG or mouse IgG as controls.

Cell Attachment Assay-- Chinese hamster ovary-B2 cells, or cells transfected with chimeric or wild-type integrins were detached using 0.05% (w/v) trypsin, 0.02% (w/v) EDTA in PBS, washed with 150 mM NaCl, 25 mM HEPES, pH 7.4, 1 mg/ml BSA, resuspended in the same buffer with 1 mM MgCl₂ and 1 mM CaCl₂ (buffer A) to a concentration of 5 × 10⁵/ml, and incubated at 37 °C for 20 min. For experiments examining the effect of anti-₅ or anti-_V mAbs on cell attachment, cells were preincubated with mAbs (10-50 µg/ml) at 37 °C for 20 min. Assays were performed in 96-well microtiter plates (Costar, High Wycombe, UK). Wells were coated for 60 min at room temperature with 100-µl aliquots of ligands diluted with Dulbecco's PBS. Sites on the plastic for nonspecific cell adhesion were then blocked for 40-60 min with 100 µl of 10 mg/ml heat-denatured BSA. The BSA was removed by aspiration and the wells were washed once with buffer A. 100-µl aliquots of the cells were then added to the wells and incubated for 25-30 min at 37 °C in a humidified atmosphere of 5% (v/v) CO₂. To estimate the reference value for 100% attachment, cells in quadruplicate wells coated with poly-L-lysine (Sigma) (500 µg/ml) were fixed immediately by direct addition of 100 µl of 5% (w/v) glutaraldehyde for 30 min at room temperature. Loosely adherent or unbound cells from experimental wells were removed by aspiration, the wells washed once with 200 µl of buffer A, and the remaining bound cells were fixed as described above for reference wells. The fixative was aspirated, the wells were washed twice with 200 µl of PBS, and attached cells were stained with Crystal Violet (Sigma) as described previously (51). The absorbance of each well at 570 nm was then measured using a multiscan enzyme-linked immunosorbent assay reader (Dynatech). Each sample was assayed in quadruplicate, and attachment to BSA (<2% of the total) was subtracted from all measurements. Each experiment shown is representative of at least three separate experiments.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The First Three NH₂-terminal repeats of the  Subunit Determine the Specificity of Ligand Recognition-- To identify the regions of the ₅ subunit that determine the ligand binding specificity of ₅₁, chimeric _V/₅ subunits were generated in which segments of _V were removed and replaced with the corresponding homologous region of ₅. Previous studies have suggested that sites important for ligand recognition by ₅ lie in either NH₂-terminal repeats 1-3 (35, 36) or in the divalent cation binding repeats 4-7 (29). Therefore, initially two chimeras were constructed. The first, _V/₅(F1-G232),² contained repeats 1-3 of ₅ with the remainder of the subunit being _V. The second chimera, ₅/_V(F1-G223), was complementary to the first in that it contained repeats 1-3 of _V with the remainder of the subunit having the sequence of ₅ (Fig. 1). Note that the _V/₅(F1-G232) chimera contains the divalent cation binding sites of _V (in repeats 4-7), while the ₅/_V(F1-G223) chimera contains the divalent cation-binding sites of ₅.

View larger version (24K): [in this window] [in a new window]   Fig. 1.   Schematic representation of integrin V/5 chimeras. The seven NH2-terminal repeats are represented by squares, with the connecting loops represented by short rectangles. The COOH-terminal portion of each subunit is represented by a long rectangle. Chimeras consist of a backbone of V (filled squares and rectangles) or 5 (open squares and rectangles) from which regions have been replaced with the homologous region from the other subunit. In this paper we use the term "repeat" in the sense of structural repeat, each repeat corresponding to one "blade" of the -propeller. The structural repeats are offset relative to the sequence repeats, with the first 14-amino acid residues forming the last part of the seventh structural repeat (11). Not drawn to scale.

Chimeric and wild-type subunits were expressed on the surface of ₅-deficient Chinese hamster ovary cells (B2 variant, Ref. 50). Stably transfected cell lines were obtained by G418 selection and dilution cloning. Using immunoprecipitation of cell lysates (not shown) each wild-type or chimeric  subunit was found to be associated with a ~130-kDa  subunit, which is the expected size for hamster ₁. Since ₃ is not expressed by Chinese hamster ovary cells (52), and no ₅ or ₆ (molecular mass ~90 kDa) was found in association with the  subunits, we concluded that the  subunits formed heterodimers solely with hamster ₁. In agreement with the findings of Takagi and co-workers (53) we found low levels of endogenous _V5 on the Chinese hamster ovary-B2 cells. However, this endogenous receptor mainly recognizes vitronectin, and untransfected cells showed only very low levels of attachment to the ligands used in the current study (see legends to Figs. 2-4).

View larger version (22K): [in this window] [in a new window]   Fig. 2.   Attachment of cells expressing wild-type or chimeric V/5 to recombinant fibronectin fragments. Attachment of CHO-B2 cells expressing V/5(F1-G232) (A), 5/V(F1-G223) (B), wild-type 5 (C), or wild-type V (D) to III6-10 (), III6-10(SPSDN) (), or III6-10KGE (). For cells expressing 5/V(F1-G223) and wild-type V, III6-10 was 3-10 times more potent than III6-10(SPSDN) for promoting half-maximal cell attachment; for cells expressing V/5(F1-G232) and wild-type 5, III6-10 was >100 times more potent than III6-10(SPSDN) for promoting half-maximal cell attachment. Untransfected cells showed little or no attachment to these proteins (<10% at the highest coating concentration, data not shown). The attachment of cells expressing V/5(F1-G232) or wild-type 5 was inhibited >90% by the anti-5 mAb 16; the attachment of cells expressing 5/V(F1-G223) or wild-type V was inhibited >80% by the anti-V mAb 17E6 (data not shown). Chimeric or wild-type subunits were expressed at comparable levels (mean fluorescence intensity values using P3G8 or mAb 11: 45.8, 63.6, 130.6, and 61.8 for V/5(F1-G232), 5/V(F1-G223), wild-type 5, and wild-type V, respectively.

View larger version (20K): [in this window] [in a new window]   Fig. 3.   Attachment of cells expressing wild-type or chimeric V/5 to cyclic RGD peptides. Attachment of CHO-B2 cells expressing V/5(F1-G232) (A), 5/V(F1-G223) (B), wild-type 5 (C), or wild-type V (D) to *CRGDGWC*-IgG conjugate () or *CRGDGRC*-IgG conjugate (). Untransfected cells showed little or no attachment to either conjugate (<10% at the highest coating concentration). The attachment of cells expressing V/5(F1-G232) or wild-type 5 was inhibited >90% by the anti-5 mAb 16; the attachment of cells expressing 5/V(F1-G223) or wild-type V was inhibited >80% by the anti-V mAb 17E6 (data not shown).

View larger version (16K): [in this window] [in a new window]   Fig. 4.   Attachment of cells expressing wild-type or chimeric V/5 to *CRRETAWAC*. Attachment of CHO-B2 cells expressing V/5(F1-G232) (A), 5/V(F1-G223) (B), wild-type 5 (C), or wild-type V (D) to *CRRETAWAC*-IgG conjugate. Untransfected cells showed little or no attachment to this conjugate (<2% at the highest coating concentration). The attachment of cells expressing V/5(F1-G232) or wild-type 5 was inhibited >90% by the anti-5 mAb 16 (data not shown).

Three different tests of ligand recognition specificity were used. (i) The dependence of integrin-fibronectin binding on the presence of the synergy region was examined by comparing the level of cell attachment to a wild-type recombinant fragment of the CCBD (III_6-10) with the level of attachment to the same fragment in which the synergy region is replaced by the corresponding inactive region of the eighth type III repeat (III_6-10(SPSDN)) (49). A recombinant CCBD fragment in which the RGD sequence is mutated to the inactive Lys-Gly-Glu (III_6-10KGE) was used as a negative control (5). (ii) To test for specific recognition of the RGDGW sequence the levels of cell attachment to the cyclic RGD peptides ACRGDGWCG (*CRGDGWC*) and ACRGDGRCG (*CRGDGRC*) were compared. (iii) To assay for recognition of the RRETAWA sequence the ability of cells to attach to the cyclic peptide GACRRETAWACGA (*CRRETAWAC*) was examined. Peptides were coupled to a carrier protein (rabbit IgG) for use in these experiments. In each case, cells expressing similar levels of wild-type ₅ or _V were analyzed in parallel. In addition, to demonstrate that cell attachment was integrin-mediated, the ability of function-blocking anti-₅ or anti-_V mAbs to perturb cell attachment was examined.

The results (Figs. 2-4) showed that cells expressing the _V/₅(F1-G232) chimera exhibited a strong dependence on the presence of the synergy site for adhering to fibronectin, similar to that observed for cells expressing wild-type ₅. Cells expressing _V/₅(F1-G232) showed much higher levels of attachment to the *CRGDGWC* sequence than to *CRGDGRC*, and gained the ability to attach to *CRRETAWAC*, similar to the results obtained with cells expressing wild-type ₅. In contrast, cells expressing ₅/_V(F1-G223) showed only a weak dependence on the presence of the synergy region for attaching to fibronectin, comparable to that observed for cells expressing wild-type _V. Cells expressing this chimera showed approximately equal levels of attachment to *CRGDGWC* and *CRGDGRC*, and lacked the ability to attach to *CRRETAWAC*, similar to the results obtained for cells expressing wild-type _V.

In summary, the results showed that _V/₅(F1-G232)₁ had the same ligand-binding specificity as ₅₁, while ₅/_V(F1-G223)₁ had the same ligand binding specificity as _V1. Hence, ligand binding specificity appears to be determined by sequences within the first three NH₂-terminal repeats of the  subunit. Since the _V/₅(F1-G232) chimera contains the divalent cation-binding sites of _V (in repeats 4-7), and the ₅/_V(F1-G223) chimera contains the divalent cation-binding sites of ₅, it can be concluded that the divalent cation-binding sites do not play a role in determining the ligand binding specificity.

Cells expressing chimeric or wild-type subunits were analyzed for expression of the epitopes of anti-₅ and anti-_V mAbs using flow cytometry (Table I). The results showed that the _V/₅(F1-G232) subunit contained the epitopes of the function-blocking anti-5 mAbs JBS5, SAM-1, SAM-2, 16, and P1D6, lacked the epitopes of function-blocking _V mAbs, but expressed the epitopes of the non-function blocking anti-_V mAbs P3G8 and LM142. Conversely, the ₅/_V(F1-G223) subunit contained the epitopes of the function blocking anti-_V mAbs 14D9.F8, 17E6, and 69.6.5, lacked the epitopes of function blocking ₅ mAbs, but expressed the epitopes of the non-function blocking anti-₅ mAbs 11 and VC5. These results show that the epitopes of function blocking mAbs anti-₅ mAbs lie within the first three NH₂-terminal repeats of ₅; similarly the epitopes of function blocking anti-_V mAbs lie within repeats 1-3 of _V. In contrast, the epitopes of non-function blocking mAbs lie outside the first three repeats. Because the level of epitope expression was similar to that of wild-type _V or wild-type ₅ subunits, it is likely that the chimeras were folded correctly.

View this table: [in this window] [in a new window]   Table I Summary of mAb reactivity with V/5 chimeras CHO-B2 cells stably transfected with the indicated wild-type or chimeric  subunit were analyzed for reactivity with anti-5 and anti-V mAbs by flow cytometry.

Identification of a Minimal Region of the ₅ Subunit That Confers Ligand Binding Specificity-- Since cells expressing the _V/₅(F1-G232) chimera had the same ligand binding properties as cells expressing wild-type ₅, we attempted to narrow down the region of ₅ required to switch ligand binding specificity by constructing _V/₅ chimeras containing smaller segments of ₅ (see Fig. 1). A chimera _V/₅(A107-G232), which contains essentially the second and third repeats of ₅, was expressed at high levels. FACS analysis with a panel of anti-₅ or anti-_V mAbs showed that the _V/₅(A107-G232) chimera retained the epitopes of all the function blocking anti-₅ mAbs tested (Table I), although the binding of JBS5 was decreased compared with the _V/₅(F1-G232) chimera. Chimeras containing only the second or third repeat of ₅ (_V/₅ (A107-C164) and _V/₅(C164-G232)) were expressed at lower levels than _V/₅(A107-G232), and failed to react, or reacted only weakly, with function blocking anti-₅ and _V mAbs (data not shown). Since it could not be demonstrated that these two chimeras were folded correctly, they were not studied further.

Cells expressing the _V/₅(A107-G232) chimera were tested for their ability to attach to ₅₁- or _V1-selective ligands (Fig. 5). The results showed that cells expressing _V/₅(A107-G232) showed a strong dependence on the synergy region for binding to the CCBD of fibronectin, displayed preferential recognition of RGDGW over RGDGR, and possessed the ability to attach to RRETAWA. Therefore, amino acid residues 107-232 of ₅ were found to be sufficient to confer on _V1 the ligand binding specificity of ₅₁. In addition, since the amino acid sequence Asp²²⁷-Gly²³² of ₅ is identical to the corresponding sequence Asp²¹⁸-Gly²²³ in _V, residues that confer ligand binding specificity must be contained within Ala¹⁰⁷-Trp²²⁶ of ₅.

View larger version (9K): [in this window] [in a new window]   Fig. 5.   Attachment of CHO-B2 cells expressing V/5(A107-G232) to recombinant fibronectin fragments or peptide-IgG conjugates. A, cell attachment to III6-10 (), III6-10(SPSDN) (), or III6-10KGE (). B, cell attachment to *CRGDGWC*-IgG conjugate (), *CRGDGRC*-IgG conjugate (). C, cell attachment to *CRRETAWAC*-IgG conjugate. The attachment of cells to each substrate was inhibited >90% by the anti-5 mAb 16 (data not shown). V/5(A107-G232) was expressed at a level similar to that of V/5(F1-G232) (mean fluorescence intensity using P3G8: 65.9).

Identification of a Putative Loop Region of ₅ That Determines Specificity for RGDGW and RRETAWA-- To further narrow down the amino acid residues required to confer on V1 the ligand-binding properties ₅₁, we identified differences in sequence between the Ala¹⁰⁷-Trp²²⁶ region of ₅ and the corresponding region in _V (Fig. 6). Interestingly, many of these sequence differences were observed to occur within putative loop regions, and were confined mainly to the central portions of these loops. Previous data has suggested that loop regions linking -strands 2 and 3 in each repeat (2-3 loops) and  strands 4 and 1 between repeats (4-1 loops) are important for ligand recognition by ₅₁ (5, 35, 36). Hence, using oligonucleotide-directed mutagenesis, we made _V/₅ chimeras containing the following exchanges: Met¹¹⁸-Glu¹²³ of _V with Lys¹²⁵-Asp¹³⁰ of ₅ (_V/₅(K125-D130)), Gln¹⁴⁵-Asp¹⁵⁰ of _V with Asp¹⁵⁴-Ala¹⁵⁹ of ₅ (_V/₅(D154-A159)), Phe¹⁷⁷-Tyr¹⁷⁸ of _V with Tyr¹⁸⁶-Phe¹⁸⁷ of ₅ (_V/₅(Y186-F187)), and Ala²⁰⁹-Phe²¹⁷ of _V with Gln²¹⁸-Tyr²²⁶ of ₅ (_V/₅(Q218-Y226)). We also made a chimera in which both Phe¹⁷⁷-Tyr¹⁷⁸, and Ala²⁰⁹-Phe²¹⁷ of _V were exchanged with Tyr¹⁸⁶-Phe¹⁸⁷ and Gln²¹⁸-Tyr²²⁶ of 5, respectively (_V/₅(F186-Y187, Q218-Y226)). All "loop swapping" chimeras expressed successfully, with the exception of _V/₅(Y186-F187). This latter chimera was expressed only at very low levels, and may therefore have been misfolded. The other chimeras were examined for their reactivity with anti-_V mAbs (Table II). All chimeras expressed the epitopes of the non-function blocking mAbs P3G8 and LM142, and the epitopes of the function blocking mAbs 17E6 and 14D9.F8. However, both _V/₅(K125-D130) and _V/₅(D154-A159) chimeras lacked the epitope of the function-blocking mAb 69.6.5. 

View larger version (23K): [in this window] [in a new window]   Fig. 6.   Alignment of human 5 and V sequences for NH2-terminal repeats 2-4 (R2-R4). Sequences were aligned using Clustal W. Predicted -strands in 5 and V are underlined, and the sequence Ala107-Tyr226 of 5 is shown in bold. Residues in putative loop regions of V between the second and third -strands, and between the fourth and first -strands (shown boxed) were chosen for swapping with the corresponding residues in 5. Assignment of -strands and loops is based on an alignment of the sequence of human 5 with that of human 4 by Irie et al. (6).

View this table: [in this window] [in a new window]   Table II Summary of mAb reactivity of V/5 loop swapping chimeras CHO-B2 cells stably transfected with the chimeric subunit were analyzed for reactivity with anti-V mAbs by flow cytometry. None of the loop swapping chimeras reacted with function-blocking anti-5 mAbs (data not shown).

Cells expressing the loop swapping chimeras were tested for their ability to attach to ₅₁- or _V1-selective ligands. Cells expressing each chimera showed only a weak dependence on the presence of the synergy region for attaching to fibronectin, similar to that observed for cells expressing wild-type _V (Fig. 7, compare Fig. 2D). Hence none of the loop swaps signficantly affected recognition of the synergy sequence. Cells expressing the _V/₅(K125-D130) and _V/₅(Q218-Y226) chimeras showed approximately equal levels of adhesion to *CRGDGWC* and *CRGDGRC*, and failed to attach to *CRRETAWAC*, again similar to the results for cells expressing wild-type _V (Figs. 8 and 9 panels A and C, compare Figs. 3D and 4D). Cells expressing _V/₅(Y186-F187, Q218-Y226) showed slight selectivity for *CRGDGWC* over *CRGDGRC* but failed to attach to *CRRETAWAC* (Figs. 8D and 9D). In striking contrast, cells expressing the _V/₅(D154-A159) chimera showed strong selectivity for *CRGDGWC*, and possessed the ability to attach to *CRRETAWAC*, identical to the results for cells expressing wild-type ₅ (Figs. 8B and 9B, compare Figs. 3C and 4C). Therefore, these results showed that replacing Gln¹⁴⁵-Asp¹⁵⁰ of _V with Asp¹⁵⁴-Ala¹⁵⁹ of ₅ conferred on _V1 two of the ligand binding properties of ₅₁: selectivity for the RGDGW sequence and the ability to recognize RRETAWA.

View larger version (23K): [in this window] [in a new window]   Fig. 7.   Effect of V loop swapping mutations on cell attachment to recombinant fibronectin fragments. Attachment of Chinese hamster ovary-B2 cells expressing V/5(K125-D130) (A), V/5(D154-A159) (B), V/5(Q218-Y226) (C), or V/5(Y186-F187, Q218-Y226) (D) to III6-10 (), III6-10(SPSDN) (), or III6-10KGE (). For each cell line, attachment was inhibited >70% by the anti-V mAb 17E6 (data not shown). Chimeras were expressed at comparable levels (mean fluorescence intensity values using P3G8: 67.4, 65.7, 71.7, and 43.7 for V/5(K125-D130), V/5(D154-A159), V/5(Q218-Y226), and V/5(Y186-F187, Q218-Y226), respectively.

View larger version (20K): [in this window] [in a new window]   Fig. 8.   Effect of V loop swapping mutations on cell attachment to cyclic RGD peptides. Attachment of Chinese hamster ovary-B2 cells expressing V/5(K125-D130) (A), V/5(D154-A159) (B), V/5(Q218-Y226) (C), or V/5(Y186-F187, Q218-Y226) (D) to *CRGDGWC*-IgG conjugate () or *CRGDGRC*-IgG conjugate (). In each case, cell attachment was inhibited >70% by the anti-V mAb 17E6 (data not shown).

View larger version (16K): [in this window] [in a new window]   Fig. 9.   Effect of V loop swapping mutations on cell attachment to *CRRETAWAC*. Attachment of Chinese hamster ovary-B2 cells expressing V/5(K125-D130) (A), V/5(D154-A159) (B), V/5(Q218-Y226) (C), or V/5(Y186-F187, Q218-Y226) (D) to *CRRETAWAC*-IgG conjugate. The attachment of cells expressing V/5(D154-A159) was inhibited >90% by the anti-V mAb 17E6 (data not shown).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In this report we have sought to identify the regions of the integrin  subunit that are involved in ligand recognition using _V/₅ chimeras. Our major findings are as follows: (i) the first three NH₂-terminal repeats contain the epitopes of function blocking anti- subunit mAbs and the amino acid sequences that determine ligand binding specificity; (ii) the divalent cation-binding sites (in repeats 4-7) do not determine the specificity of ligand recognition; (iii) the amino acid sequence Ala¹⁰⁷-Trp²²⁶ of ₅ (corresponding approximately to the second and third repeats) is sufficient to confer on _V1 the ligand binding properties of ₅₁; (iv) swapping a 6-amino acid sequence from a predicted loop region of _V with the corresponding region of ₅ (Asp¹⁵⁴-Ala¹⁵⁹) is sufficient to confer on _V1 selectivity for RGDGW and recognition of RRETAWA.

In this study we observed a close correspondence between the regions of the  subunit involved in determining the specificity of ligand recognition and those that contained the epitopes of function blocking mAbs. This finding supports previous evidence that the epitopes of function blocking mAbs are proximal to sites involved in ligand binding (5, 33-36, 54). In addition, these data lend strong support to the -propeller model, which predicts that the ligand-binding sites lie on the upper face of the -propeller (11). Recently, we have mapped some of the residues that form part of the JBS5, mAb 16, and P1D6 epitopes by substituting residues in human ₅ with the corresponding residues from mouse ₅. Ser⁸⁵ was found to contribute to the JBS5 epitope, Glu¹²⁶ and Leu¹²⁸ to the mAb 16 epitope, and Leu²¹² to the P1D6 epitope (8). All these residues are predicted to lie on the upper face of the -propeller domain. The results of the present study, including decreased binding of JBS5 to the _V/₅(A107-G232) chimera, are in good agreement with these data.

Two loop swapping mutants, _V/₅(K125-D130) and _V/₅(D154-A159), failed to react with the function blocking anti-_V mAb 69.6.5. However, since they did react with two other function blocking anti-