JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M000421200 on April 10, 2000

J. Biol. Chem., Vol. 275, Issue 27, 20806-20813, July 7, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/27/20806    most recent
M000421200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balendran, A.
Right arrow Articles by Alessi, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balendran, A.
Right arrow Articles by Alessi, D. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A 3-Phosphoinositide-dependent Protein Kinase-1 (PDK1) Docking Site Is Required for the Phosphorylation of Protein Kinase Czeta (PKCzeta ) and PKC-related Kinase 2 by PDK1*

Anudharan BalendranDagger §, Ricardo M. Biondi§, Peter C. F. CheungDagger , Antonio CasamayorDagger , Maria Deak, and Dario R. AlessiDagger ||

From the Dagger  MRC Protein Phosphorylation Unit,  Division of Signal Transduction Therapy, MSI/WTB Complex, University of Dundee, Dow Street, Dundee DD1 5EH, Scotland, United Kingdom

Received for publication, January 20, 2000, and in revised form, March 15, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Members of the AGC subfamily of protein kinases including protein kinase B, p70 S6 kinase, and protein kinase C (PKC) isoforms are activated and/or stabilized by phosphorylation of two residues, one that resides in the T-loop of the kinase domain and the other that is located C-terminal to the kinase domain in a region known as the hydrophobic motif. Atypical PKC isoforms, such as PKCzeta , and the PKC-related kinases, like PRK2, are also activated by phosphorylation of their T-loop site but, instead of possessing a phosphorylatable Ser/Thr in their hydrophobic motif, contain an acidic residue. The 3-phosphoinositide-dependent protein kinase (PDK1) activates many members of the AGC subfamily of kinases in vitro, including PKCzeta and PRK2 by phosphorylating the T-loop residue. In the present study we demonstrate that the hydrophobic motifs of PKCzeta and PKCiota , as well as PRK1 and PRK2, interact with the kinase domain of PDK1. Mutation of the conserved residues of the hydrophobic motif of full-length PKCzeta , full-length PRK2, or PRK2 lacking its N-terminal regulatory domain abolishes or significantly reduces the ability of these kinases to interact with PDK1 and to become phosphorylated at their T-loop sites in vivo. Furthermore, overexpression of the hydrophobic motif of PRK2 in cells prevents the T-loop phosphorylation and thus inhibits the activation of PRK2 and PKCzeta . These findings indicate that the hydrophobic motif of PRK2 and PKCzeta acts as a "docking site" enabling the recruitment of PDK1 to these substrates. This is essential for their phosphorylation by PDK1 in cells.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Stimulation of cells with growth factors, phorbol esters, and insulin induces the activation of certain members of the AGC subfamily of protein kinases that include protein kinase B (PKB)1 (1, 2), p70 S6 kinase (p70 S6K) (3, 4), serum and glucocorticoid-induced kinase (SGK), (5-7) and many protein kinase C (PKC) isoforms (8, 9). These kinases mediate many of the cellular effects of agonists that elicit their activation by phosphorylating key regulatory proteins.

Recent work has led to a greater understanding of how these protein kinases are activated in cells. For example, PKB is turned on following the agonist-induced activation of PI 3-kinase which generates the second messenger PtdIns(3,4,5)P3, leading to the recruitment of PKB to the plasma membrane where it becomes activated by phosphorylation of two residues, namely Thr-308 and Ser-473 (2, 10). Thr-308 lies in the T-loop of the kinase domain, and Ser-473 is located C-terminal to the catalytic domain, in a region termed the "hydrophobic motif." Conventional and novel PKC isoforms (8), p70 S6K (11), p90 ribosomal S6 kinase (12), and SGK (5-7) also possess residues lying in equivalent sequence motifs to Thr-308 and Ser-473 of PKB, whose phosphorylation is required for activation and/or stabilization of these kinases in vivo. The residue equivalent to Thr-308 of PKB in the T-loop of the kinase domain lies in a sequence motif comprising Thr-Phe-Cys-Gly-Thr where the underlined Thr residue becomes phosphorylated in response to agonist stimulation of cells. The residue equivalent to Ser-473 of PKB in the hydrophobic motif lies in a consensus sequence Phe-Xaa-Xaa-Phe-Ser/Thr-Phe/Tyr, where Xaa can be any amino acid.

Like other members of the AGC subfamily, the atypical PKC isoforms (PKCzeta , PKCtau /lambda , and PKCiota ) as well as the related PKC isoforms (PRK1 and PRK2) possess a Thr residue lying in a sequence motif identical to Thr-308 of PKB whose phosphorylation is essential for the activation of these kinases (Thr-410 in PKCzeta (13, 14), Thr-774 in PRK1, and Thr-816 in PRK2 (15, 16)). These kinases also possess a hydrophobic motif in which the aromatic residues are conserved, but where the phosphorylatable Ser/Thr is replaced by an acidic residue (Glu-579 in PKCzeta and Asp-978 in PRK2) (9).

The protein kinase termed 3-phosphoinositide-dependent protein kinase-1 (PDK1) plays a central role in activating AGC subfamily members (reviewed in Refs. 17-19). PDK1 phosphorylates the T-loop residue of PKB (20-23), p70 S6K (11, 24), p90RSK (25, 26), SGK (5-7) conventional and novel PKC isoforms (14, 27), atypical PKC isoforms (13, 14, 28), and related PKC isoforms (15, 16).

The kinase domain of PDK1 interacts with a region of PRK2 encompassing its hydrophobic motif termed the PDK1-interacting fragment (PIF) (29). Mutation of the conserved aromatic residues in the PRK2 hydrophobic motif or mutation of the Asp residue to either Ala or Ser greatly weakens the interaction of PIF with PDK1, indicating that PIF binds to PDK1 via these residues (29). Interestingly, PIF prevents PDK1 from phosphorylating p70 S6K (30), in contrast to PKB, whose activation by PDK1 is enhanced by PIF. This suggests that, in order for p70 S6K to become phosphorylated by PDK1, it might need to bind to a region of PDK1 that overlaps with the PIF-interacting site. We recently identified this site as a hydrophobic pocket on the small lobe of the kinase domain of PDK1. Mutation of residues predicted to form part of this pocket (Lys-115, Ile-119, Gln-150, and Leu-155) either abolished or significantly diminished the affinity of PDK1 for PIF (31). Furthermore, PDK1 phosphorylated a synthetic dodecapeptide, corresponding to the sequences surrounding the T-loop site in PKB at a low rate, but a peptide comprising the dodecapeptide fused to the C-terminal 24 residues of PIF (containing the PDK1 binding motif) was a vastly superior substrate (31). These findings raised the possibility that the PIF-binding pocket on the kinase domain of PDK1 acts as a "docking site," enabling it to interact with and enhance the phosphorylation of some substrates. In this study we provide evidence that this is indeed the case for at least two PDK1 substrates, namely PKCzeta and PRK2. We show that PDK1 interacts with these kinases through their hydrophobic motif and that this interaction is required to enable these kinases to become phosphorylated at their T-loop motif in cells.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- The peptide used to assay PRK2 (PRKtide, AKRRRLSSLRA) (32) and the peptides used to raise and affinity-purify the phosphospecific antibodies that recognize PRK2 phosphorylated at Thr-816 and PKCzeta phosphorylated at Thr-410 were synthesized by Dr. G. Blomberg (University of Bristol, UK). The "Selectide" peptide used to assay PKCzeta (AAKIGASFRGHMAKK) (33) was from Calbiochem. Protein G-Sepharose, glutathione-Sepharose, and activated-Sepharose were purchased from Amersham Pharmacia Biotech; protease-inhibitor mixture tablets were from Roche Molecular Biochemicals; tissue culture reagents and microcystin-LR were from Life Technologies, Inc., and secondary antibodies coupled to horseradish peroxidase were from Pierce.

Antibodies-- The phospho-specific antibody recognizing PRK2 phosphorylated at Thr-816 (termed T816-P) was raised in sheep against the peptide YGDRTSTFCGTPEF (corresponding to residues 810-823 of the full-length human PRK2), in which the underlined residue is phosphothreonine. The antibody recognizing PKCzeta phosphorylated at Thr-410 was raised in sheep against the peptide GPGDTTSTFCGTPNY (corresponding to residues 403-417 of mouse PKCzeta ) in which the underlined residue is phosphothreonine. The antibodies were affinity-purified on activated-Sepharose covalently coupled to the phosphorylated peptide and then passed through a column of CH-Sepharose coupled to the non-phosphorylated peptide. Antibodies that did not bind to the latter column were selected. The PDK1 antibody used in this study was raised in sheep against the whole PDK1 protein (29). Monoclonal antibody recognizing the Myc epitope was from Roche Molecular Biochemicals, and the monoclonal antibodies recognizing GST and the FLAG epitope as well as the FLAG affinity gel were purchased from Sigma.

General Methods-- Molecular biology techniques were performed using standard protocols. Site-directed mutagenesis was carried out using QuikChange kit (Stratagene) following instructions provided by the manufacturer. DNA constructs used for transfection were purified from bacteria using the Qiagen plasmid Mega kit according to the manufacturer's protocol, and their sequence was verified using an automated DNA sequencer (model 373, Applied Biosystems). Human embryonic kidney 293 cells were cultured on 10-cm diameter dishes in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, and transfections were carried out using a modified calcium phosphate method (34). PDK1 assays described in Fig. 1C were carried out as described previously (29).

Yeast Two-hybrid Screen-- Myc-tagged human PDKI was subcloned into the EcoRI/SalI site of pAS2-1 (CLONTECH) as a Gal4 DNA binding domain fusion. A yeast two-hybrid screen was carried out by cotransforming pAS2-1 PDK1 and a pACT2 human brain cDNA library fused to the Gal4 activation domain (GAD) into the yeast strain Y190. The brain library was purchased from CLONTECH. Transformed yeast cells were incubated for 10 days at 30 °C on SD media supplemented with 25 mM 3-aminotriazole and lacking histidine, leucine, and tryptophan. Approximately 5 × 106 colonies were screened.

Yeast Two-hybrid Analysis-- The wild type PDK1 and the L155E/L155D/L155S-PDK1 mutants subcloned into pAS2-1 vector and the pACT2-PIF vector which encodes the C-terminal 26 amino acids of PRK2 have been described previously (31). Y190 strain yeasts were cotransformed with the indicated combinations of vectors and grown on SD media lacking histidine, uracil, tryptophan, and leucine at 30 °C until appearance of colonies. Yeast colonies were patched onto fresh agar, incubated overnight at 30 °C, and filter lifts taken. Reporter beta -galactosidase activity of the transformants was tested by incubating filters in 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside (X-Gal) at 30 °C for 4 h.

Cloning of PRK2-- A PCR-based strategy was used to prepare an N-terminal flag epitope-tagged cDNA construct encoding residues 501-984 of the human PRK2 (Delta NT-PRK2) using as a template an EST encoding for this region of PRK2 (NCBI accession number AA101793, IMAGE number 550355) obtained from the IMAGE consortium (35). The Delta NT-PRK2 construct was obtained using the 5' primer cgggatccgccaccatggactacaaggacgacgatgacaagggcaaaacatttctcagagctcctc the T7 oligonucleotide as the 3' primer. The resulting PCR fragment was cloned into pCR-Topo 2.1 vector (Invitrogen) and subsequently subcloned as an EcoRI-EcoRI fragment into the pCMV5 vector (36) (to encode expression of FLAG Delta NT-PRK2) and as a BamHI-KpnI fragment into the pEBG-2T vector (37) (to encode for expression of GST-Delta NT-PRK2).

The full-length cDNA encoding N-terminal FLAG epitope-tagged PRK2 (residues 1-984) was prepared in two stages. First, a PCR using as a template an EST encoding for the N-terminal region of PRK2 (NCBI accession number AA480660, IMAGE number 882160) obtained from the IMAGE consortium (35) was the template with the 5' primer, ggatccgccaccatggactacaaggacgacgatgacaaggcgtccaaccccgaacggggggaga, and the 3' primer, ggagctctgagaaatgtttttgccttgttgctttgaaaaaattttcttttgtctttgaagttttggtcttctttcaata. This incorporates a 5' BamHI site followed by an N-terminal FLAG epitope tag and a 3' SacI site. The resulting PCR fragment was cloned into pCR-Topo vector 2.1 (Invitrogen). In the second stage a triple ligation was set up in which the full-length PRK2 was generated by subcloning into the EcoRI-KpnI sites of the pCMV5 vector (36) the N-terminal EcoRI-SacI fragment, together with the C-terminal SacI-KpnI fragment of PRK2. The resulting full-length PRK2 fragment was then subcloned into the pEBG2T (37) as a BamHI-KpnI fragment to produce a plasmid encoding for the expression of full-length GST-PRK2.

Cloning of PKCzeta -- A PCR-based strategy was used to prepare an N-terminal flag epitope-tagged cDNA construct encoding full-length mouse PKCzeta using as the template a full-length cDNA clone, kindly provided by Walter Kolch (Beatson Institute, Glasgow, UK), and the 5' primer actagtgccaccatggactacaaggacgacgatgacaagcccagcaggacggaccccaagatg and the 3' primer actagttcatggcctcacacggactcctc. This incorporates an N-terminal FLAG and SpeI restriction sites at both ends of the cDNA. The resulting PCR fragment was cloned into the pCR-Topo 2.1 vector (Invitrogen) and subsequently as a SpeI-SpeI fragment into both the pCMV5 vector (36) (for expression of FLAG-PKCzeta ) and the pEBG-2T vector (37) (for expression of GST-PKCzeta ).

Other Plasmids-- The constructs encoding wild type PDK1 (21), the Leu-155 mutants of PDK1 (31), GST-PIF, the mutant GST-F977A-PIF (29), and GST (empty pEBG2T vector) have been described previously. The constructs used to express GST-PRK1-(827-942), GST-PKCiota -(494-587), and GST-PKCzeta -(518-585), in Fig. 1C, were derived from PDK1-interacting clones obtained from a human brain library (see above) and subcloned into the pEBG3X. The construct used to express GST-PRK2-(914-984) in Fig. 6 was subcloned into pEBG2T as described previously (29).

Binding of PKCzeta and PRK2 to Myc-PDK1-- For the data presented in Figs. 2 and 3, 293 cells were cotransfected with 10 µg of the wild type or mutant PDK1 plasmid and 10 µg of either the wild type or mutant PKCzeta or PRK2. 36 h post-transfection the cells were lysed in 0.6 ml of lysis buffer (50 mM Tris-HCl pH 7.5, 1 mM EGTA, 1 mM EDTA, 1% (by mass) Triton X-100, 1 mM sodium orthovanadate, 50 mM sodium fluoride, 5 mM sodium pyrophosphate, 0.27 M sucrose, 1 µM microcystin-LR, 0.1% (by volume) beta -mercaptoethanol, and 1 tablet of protease inhibitor mixture per 50 ml of buffer). The lysates were cleared by centrifugation at 13,000 × g for 10 min at 2 °C, and 0.5 ml of supernatant was incubated for 2 h at 4 °C with 30 µl of glutathione-Sepharose. The beads were washed twice in lysis buffer containing 0.5 M NaCl, followed by two further washes in lysis buffer. The beads were resuspended in 30 µl of buffer containing 100 mM Tris/HCl, pH 6.8, 4% (by mass) SDS, 20% (by volume) glycerol, and 200 mM dithiothreitol and subjected to SDS-polyacrylamide gel electrophoresis. The gels were either stained with Coomassie Blue or analyzed by immunoblotting with either anti-FLAG or anti-Myc antibodies (described below).

Activity and T-loop Phosphorylation of PKCzeta and PRK2-- For experiments shown in Fig. 4 and Fig. 5, 10 µg of either wild type PKCzeta , mutant PKCzeta , wild type PRK2, or mutant PRK2 plasmid was used. In Fig. 6, 2 µg of DNA construct encoding either PRK2 or PKCzeta was cotransfected with 10 µg of DNA construct encoding either GST-PIF, GST-F977A-PIF, or GST. 36 h post-transfection the cells were lysed in 1 ml of lysis buffer. The lysates were centrifuged at 13,000 × g for 10 min at 2 °C, and the protein concentrations of the supernatant were determined by the Bradford method. To immunoprecipitate FLAG epitope-tagged PKCzeta or PRK2, 50 µg of cell lysate protein was incubated with 2 µg of the FLAG antibody conjugated to 5 µl of protein G-Sepharose previously equilibrated in lysis buffer on a platform shaker for 60 min at 2 °C. The beads were then washed twice with 1 ml of lysis buffer containing 0.5 M NaCl and twice with 1 ml of Buffer A (50 mM Tris/HCl, 0.1 mM EGTA, 0.27 M sucrose, and 0.1% (by volume) 2-mercaptoethanol), and the suspension was made up to a volume of 20 µl in Buffer A. To purify GST-PKCzeta and GST-Delta NT-PRK2 from cell lysates, 50 µg of cell lysate protein was incubated with 5 µl of glutathione-Sepharose previously equilibrated in lysis buffer on a platform shaker for 60 min at 2 °C. The beads were then washed in an identical manner to the immunoprecipitates and then made up to a volume of 20 µl in Buffer A containing 25 mM glutathione. A mixture of other assay ingredients (30 µl) was then added to initiate the assay. The concentrations of reagents were 50 mM Tris, pH 7.5, 0.1% (by volume) 2-mercaptoethanol, 0.1 mM EGTA, 10 µM PKI (PKA inhibitor peptide TTYADFIASGRTGRRNAIHD), 100 µM [gamma -32P]ATP (specific activity of ~500,000 cpm/nmol), 10 mM MgAc containing either 50 µM PKCzeta peptide substrate (AAKIGASFRGHMAKK) or 30 µM PRK2 substrate peptide (AKRRRLSSLRA). After 10 min at 30 °C on a platform shaker, the reactions were terminated by pipetting 40 µl of the assay mixture onto 2 × 2-cm squares of phosphocellulose paper. These were washed in 75 mM phosphoric acid, and the amount of 32P-labeled peptide bound to the papers was determined as described previously for the assay of mitogen-activated protein kinase (38). One unit of activity was that amount of kinase that catalyzed the phosphorylation of 1 nmol of substrate in 1 min.

Immunoblotting-- For the Myc and FLAG blots of cell lysate, 5 µg of protein was used. For the T816-P blots, 25 µg of cell lysate protein was used. For the T410-P blots, 150 µg of cell lysate protein was immunoprecipitated using 5 µl of FLAG affinity gel and washed as described above. Cell lysates or immunoprecipitates were made 1% in SDS, subjected to SDS/polyacrylamide gel electrophoresis, and transferred to nitrocellulose. The nitrocellulose membranes were immunoblotted using either the anti-Myc (0.4 µg/ml), anti-FLAG antibodies (0.4 µg/ml) in 50 mM Tris/HCl, pH 7.5, 0.15 M NaCl, 0.5% (by volume) Tween (TBS/Tween), and 10% (by mass) skimmed milk. Immunoblotting with the phosphospecific antibodies (0.5 µg/ml) in the presence of 10 µg/ml phospho or dephospho peptide corresponding to the antigen used to raise the antibody in TBS/Tween containing 10% (by mass) skimmed milk. Detection was performed using horseradish peroxidase-conjugated secondary antibodies and the enhanced chemiluminescence reagent (Amersham Pharmacia Biotech).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

PDK1 Interacts with the Hydrophobic Motif of Atypical and Related PKC Isoforms-- A yeast two-hybrid screen was carried out to identify proteins expressed in human brain that interact with PDK1. From this screen we identified a large number of positive clones that interacted with full-length PDK1 but not with the pleckstrin homology domain of PDK1, which corresponded to the C-terminal fragments of various PKC isoforms (Fig. 1A). These not only included PRK2 (3 positives) but also PRK1 (13 positives), PKCzeta (112 positives), and PKCiota (7 positives). Although each clone was of variable length, they all encompassed the C-terminal Phe-Xaa-Xaa-Phe-(Asp/Glu)-(Phe/Tyr) hydrophobic motif (Fig. 1B). The mutants L155E-PDK1, L155D-PDK1, and L155S-PDK1 which do not interact with the hydrophobic motif of PRK2 (31) were also unable to form a complex with the C-terminal fragments of PRK1, PKCzeta , and PKCiota (Fig. 1A).


View larger version (29K):
[in this window]
[in a new window]
  		Fig. 1.   Interaction of PDK1 and C-terminal fragments of PKC isoforms. A, the yeast strain Y190 was transformed with vectors expressing wild type PDK1 or the indicated PDK1 mutants fused to the Gal4 DNA binding domain (GBD), together with vectors encoding either the C-terminal hydrophobic motif of PRK2-(959-984), PRK1-(827-942), PKCiota -(494-587), and PKCzeta -(518-585), and fused to a Gal4 activation domain (GAD). T-antigen fused to Gal4 activation domain (GAD-TDI) and the Lamin C fused to GDB (GDB-LAM) are negative controls provided by CLONTECH. The yeast were grown overnight at 30 °C, and beta -galactosidase filter lift assays were performed at 30 °C for 4 h. An interaction between GBD-PDK1 and Gal4 activation domain fusion protein induces the expression of beta -galactosidase which is detected as a blue color in the filter lift assay. B, alignment of the hydrophobic motif sequence of PKB with the equivalent region of PRK2, PRK1, PKCiota , and PKCzeta . The aromatic residues in the hydrophobic motif are underlined, and the residue equivalent to Ser-473 of PKB is in boldface. C, 293 cells were transiently transfected with DNA constructs expressing GST fused to the hydrophobic motif fragments of PRK2-(908-984), PRK1-(827-942), PKCiota -(494-587), and PKCzeta -(518-585), and GST itself. 36 h post-transfection the cells were lysed, and the GST fusion proteins were purified by affinity chromatography on glutathione-Sepharose beads as described previously for GST-PIF (29). Each GST fusion protein was incubated for 30 min at 30 °C with GST-PKBalpha in which Ser-473 was mutated to Asp (a standard substrate used to assay PDK1 activity) and MgATP in the presence or absence of phospholipid vesicles containing 10 µM sn-1-stearoyl-2-arachidonoyl-D-PtdIns(3,4,5)P3, and the increase in specific activity of GST-473D-PKBalpha was determined relative to a control incubation in which the GST-473D-PKBalpha fusion protein was omitted as described previously (20). The basal activity of GST-473D-PKBalpha was 3 milliunits/mg. The data shown are the average for three determinations from a single preparation of protein; identical data were also obtained with two other protein preparations. 4 µg of each protein was electrophoresed on a 10% SDS-polyacrylamide gel and either immunoblotted with an antibody raised against the PDK1 protein to detect any endogenous PDK1 associated with the glutathione-Sepharose pull downs or stained with Coomassie Blue. The position of the molecular mass markers, ovalbumin (43 kDa) and carbonic anhydrase (29 kDa), are indicated. As reported previously in 293 cells, two PDK1-immunoreactive bands are observed running at 63 and 66 kDa (29).

In order to confirm by another procedure that the C-terminal regions of PRK1, PKCzeta , PKCiota , and PRK2 interacted with PDK1, these were expressed in mammalian 293 cells as glutathione S-transferase fusion proteins (see Fig. 1C). After their purification on glutathione-Sepharose, they were found to be associated with the endogenous PDK1 that was judged by Western blotting and by their ability to activate PKBalpha in the presence of MgATP and PtdIns(3,4,5)P3 (Fig. 1C). In contrast GST itself was not associated with any endogenous PDK1 when expressed in 293 cells and purified on glutathione-Sepharose or capable of inducing activation of PKBalpha (Fig. 1C). Taken together these results demonstrate that PDK1 directly interacts with the C-terminal regions of PRK1, PKCzeta , PKCiota , and PRK2 with significant affinity.

PDK1 Interacts with the Hydrophobic Motif of PKCzeta -- As reported previously (13, 14), a complex was readily observed between PDK1 and wild type PKCzeta when these enzymes were coexpressed in 293 cells (Fig. 2A). In order to establish whether PDK1 was interacting with the hydrophobic motif of PKCzeta , we mutated the conserved residues of the hydrophobic motif of PKCzeta to Ala and tested whether these mutants were able to interact with wild type PDK1. Mutation of the aromatic residues in the hydrophobic motif of PKCzeta greatly reduced its affinity for PDK1 (Fig. 2A). In contrast, mutation of Glu-579 to Ala, a residue that lies in the equivalent position to Ser-473 of PKBalpha , did not significantly affect the ability of PDK1 to bind PKCzeta (Fig. 2A).


View larger version (47K):
[in this window]
[in a new window]
  		Fig. 2.   PKCzeta C-terminal hydrophobic motif binds to the PIF-binding pocket of PDK1. A, 293 cells were transiently transfected with DNA constructs expressing GST or GST-PDK1 together with constructs expressing either wild type or the indicated mutants of FLAG-PKCzeta . B, 293 cells were transfected with DNA constructs expressing GST-PKCzeta together with wild type or indicated mutants of Myc-PDK1. 36 h post-transfection the cells were lysed, and GST fusion protein was purified by affinity chromatography on glutathione-Sepharose beads. 2 µg of each protein was electrophoresed on a 10% SDS-polyacrylamide gel, stained with Coomassie Blue, and immunoblotted using an anti-FLAG antibody to detect FLAG-PKCzeta that copurified with GST-PDK1 (A) or an anti-Myc antibody to detect Myc-PDK1 that copurified with GST-PKCzeta (B). Wild type and mutant forms of FLAG-PKCzeta did not copurify with GST alone (not shown). To establish that the wild type and mutant PKCzeta and PDK1 were expressed at a similar level, 10 µg of total cell lysate was electrophoresed on a 10% SDS-polyacrylamide gel and immunoblotted using the indicated antibodies. Duplicates of each condition are shown. Similar results were obtained in three separate experiments. The sequence of the hydrophobic motif of PKCzeta is shown (residues 573-581); Glu-579 lies at the equivalent position to Ser-473 in PKBalpha . The residues that were mutated are underlined.

In order to establish whether PKCzeta interacted with the PIF-binding pocket in the kinase domain of PDK1, we tested whether mutation of Leu-155 in the kinase domain of PDK1 affected the binding of PKCzeta to PDK1. In Fig. 2B we demonstrate that mutation of Leu-155 to Ser, Asp, Glu, or Ala prevented the interaction of PDK1 with PKCzeta , suggesting that the binding of PKCzeta to PDK1 is mediated through the PIF-binding pocket on PDK1.

PDK1 Also Interacts with the Hydrophobic Motif of PRK2-- Full-length PRK2 (Fig. 3A) and a PRK2 mutant that lacks the auto-inhibitory N-terminal domain (Delta NT-PRK2, Fig. 3B) were capable of forming a stable interaction with wild type PDK1 when both enzymes were coexpressed in 293 cells, but they did not interact with PDK1 mutants in which Leu-155 was mutated to Ser, Asp, Glu, or Ala. Furthermore, mutation to Ala of the residue equivalent to Glu-579 of PKCzeta in the hydrophobic motif of Delta NT-PRK2 (Asp-978) or the preceding conserved residue (Phe-977) also prevented the interaction of these enzymes with PDK1 (Fig. 3C).


View larger version (54K):
[in this window]
[in a new window]
  		Fig. 3.   PRK2 C-terminal hydrophobic motif binds to the PIF-binding pocket of PDK1. A and B, 293 cells were transiently transfected with DNA constructs expressing wild type (wt) FLAG-PRK2 (A) or FLAG-Delta NT-PRK2 (B) together with constructs expressing either wild type or the indicated mutants of GST-PDK1. C, 293 cells were transfected with DNA constructs expressing either GST, wild type, or indicated mutants of GST-Delta NT-PRK2 together with wild type Myc-PDK1. Binding is analyzed as described in the legend to Fig. 2. Duplicates of each condition are shown. Similar results were obtained in at least two separate experiments. The sequence of PRK2 C-terminal residues 972-980 comprising the hydrophobic motif is shown; Asp-978 lies at the equivalent position to Ser-473 in PKBalpha . The residues that were mutated are underlined.

Disruption of the Hydrophobic Motif of PKCzeta Inhibits Its Phosphorylation-- We prepared phospho-specific antibodies that only recognize PKCzeta phosphorylated at Thr-410 (termed T410-P antibody), the site of PDK1 phosphorylation. These antibodies recognized wild type PKCzeta expressed in 293 cells, and their specificity for Thr-410-phosphorylated PKCzeta was established by the fact that recognition was abolished by preincubating the antibody with the phosphopeptide immunogen but not the dephospho form of this peptide (Fig. 4A). Furthermore, a mutant form of FLAG-PKCzeta in which Thr-410 was changed to an Ala was not recognized by the T410-P antibody and, as reported previously (13), possessed virtually no activity (Fig. 4A). It should be noted that wild type PKCzeta expressed in 293 cells was highly active when isolated from non-serum-starved cells. Furthermore, serum starvation of cells failed to reduce PKCzeta activity, and stimulation of serum-starved cells with IGF1 under conditions that activate PI 3-kinase and PKB did not induce any increase in PKCzeta activity or phosphorylation at its T-loop. It therefore appears PKCzeta expressed in 293 cells is constitutively phosphorylated at its T-loop residue.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 4.   Disruption of the hydrophobic motif of PKCzeta inhibits phosphorylation of Thr-410. 293 cells were transfected with constructs expressing FLAG epitope-tagged wild type (WT) or the indicated mutants of PKCzeta . 36 h post-transfection the cells were lysed, PKCzeta immunoprecipitated, and either assayed for activity or subjected to immunoblotting with the T410-P antibody as described under "Experimental Procedures." Cell lysates were also subjected to immunoblotting with the FLAG antibody. Each experiment was carried out using three separate dishes of cells for each condition. PKCzeta was immunoprecipitated in triplicate from each dish and assayed. The activities shown are the average ± S.D. for the three dishes of cells. Similar results were obtained in three separate experiments performed on different days.

In order to investigate the role of the hydrophobic motif of PKCzeta in mediating phosphorylation of Thr-410, we tested the effect of mutating Phe-578, Glu-579, and Tyr-580 in the hydrophobic motif of PKCzeta to Ala on the ability of PKCzeta to become phosphorylated at its T-loop residue. The wild type and mutant forms of PKCzeta were expressed in 293 cells to similar levels (Fig. 4B). The F578A-PKCzeta mutant possessed 8% and Y580A-PKCzeta mutants possessed 18% of the specific activity of the wild type PKCzeta . Consistent with the inability of these mutants to interact with PDK1 (Fig. 2), they were barely phosphorylated at Thr-410 compared with the wild type kinase (Fig. 4B). In contrast, the E579A-PKCzeta mutant possessed significantly higher specific activity (55% of the wild type PKCzeta ) and was phosphorylated at Thr-410 to a similar extent as the wild type enzyme (Fig. 4B), consistent with the ability of this mutant to interact with PDK1 (Fig. 2).

The Hydrophobic Motif of PRK2 Is Required for Phosphorylation of PRK2-- Full-length PRK2 or Delta NT-PRK2 were expressed in 293 cells. The specific activity of full-length PRK2 was ~10-fold lower than Delta NT-PRK2 (Fig. 5A). As reported previously (32), incubation of full-length PRK2 with cardiolipin (25 µg/ml) increased its specific activity 5-fold, but this lipid did not further enhance the activity of Delta NT-PRK2 (data not shown). We prepared phospho-specific antibodies that only recognize PRK2 phosphorylated at Thr-816, the site of PDK1 phosphorylation (termed the T816-P antibody). This antibody recognized full-length PRK2 or Delta NT-PRK2 similarly, indicating that these proteins were phosphorylated equivalently at Thr-816 (Fig. 5B, middle panel). Incubation of the T816-P antibody with the phosphorylated phosphopeptide immunogen used to raise the antibody (Fig. 5A, bottom panel), but not with the dephosphorylated peptide (Fig. 5A, middle panel), vastly reduced its ability to recognize full-length PRK2 or Delta NT-PRK2. Furthermore, a mutant form of Delta NT-PRK2 in which Thr-816 was changed to Ala was inactive (Fig. 5A) and was not recognized by the T816-P antibody (Fig. 5B).


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 5.   Disruption of the hydrophobic motif of PRK2 inhibits phosphorylation of Thr-816. 293 cells were transfected with constructs expressing FLAG epitope tagged full-length (FL) PRK2, a mutant of PRK2 lacking the N-terminal regulatory domain (Delta NT) (A and B), or the indicated hydrophobic motif mutants of GST-Delta NT-PRK2 (C). 36 h post-transfection the cells were lysed, and PRK2 was immunoprecipitated and assayed for activity. Cell lysates were also subjected to immunoblotting with the T816-P antibody or the FLAG antibody. Each experiment was carried out using three separate dishes of cells for each condition. PRK2 was immunoprecipitated in triplicate from each dish and assayed. The activities shown are the average ± S.D. for the three dishes of cells. Similar results were obtained in three separate experiments performed on different days.

To study the role of the hydrophobic motif of PRK2 in mediating the phosphorylation of Thr-816 in PRK2, Phe-977, Glu-978, and Tyr-979 in the hydrophobic motif of Delta NT-PRK2 were individually mutated to Ala. The F977A-Delta NT-PRK2 mutant was completely inactive, and no phosphorylation at Thr-816 was detected. The D978A-Delta NT-PRK2 and Y979A-Delta NT-PRK2 mutants were also significantly less active possessing only ~20% of the activity of the wild type enzyme and were phosphorylated at Thr-816 to a markedly lower extent than Delta NT-PRK2 (Fig. 5C).

Overexpression of GST-PIF in Cells Prevents Phosphorylation and Activation of PKCzeta and PRK2-- PDK1 binds with submicromolar affinity to a region of PRK2 encompassing its hydrophobic motif, termed the PDK1-interacting fragment (PIF) (29). The data presented thus far suggested that PDK1 when complexed to PIF would be unable to interact with and phosphorylate PKCzeta and PRK2. In order to test this hypothesis, PKCzeta , full-length PRK2, and Delta NT-PRK2 were transfected into 293 cells together with constructs encoding either GST-PIF, a mutant form of GST-PIF that interacts with PDK1 very weakly (GST-F977A-PIF (29)), or GST by itself. The wild type GST-PIF, the mutant GST-PIF, and GST were expressed at similar levels and were present at a much higher concentration than the endogenous PDK1, PKCzeta , or PRK2 (data not shown). Expression of GST-PIF with PKCzeta (Fig. 6A), full-length PRK2 (Fig. 6B), or Delta NT-PRK2 (Fig. 6C) greatly reduced the specific activity of these kinases, and their phosphorylation at the T-loop site compared with that observed when PKCzeta and PRK2 were coexpressed with either GST or GST-F977A-PIF.


View larger version (24K):
[in this window]
[in a new window]
  		Fig. 6.   PIF inhibits the activation and phosphorylation of PKCzeta and PRK2. 293 cells were cotransfected with constructs expressing the FLAG-tagged wild type PKCzeta (A), full-length PRK2 (B), or Delta NT-PRK2 (C) with either GST-PIF, GST-F977A-PIF, or GST. 36 h post-transfection the cells were lysed, and PKCzeta or PRK2 was immunoprecipitated and assayed for activity. FLAG, T410-P, and T816-P immunoblots were carried out as described under "Experimental Procedures." Each experiment was carried out using three separate dishes of cells for each condition. PKCzeta /PRK2 was immunoprecipitated in triplicate from each dish and assayed. The activities shown are the average ± S.D. for the three dishes of cells. Similar results were obtained in three separate experiments performed on different days.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The hydrophobic motif of PRK2 (termed PIF) has previously been shown to interact directly with a pocket on the small lobe of the kinase domain of PDK1, termed the PIF-binding pocket (31). This suggested that the hydrophobic motif of PRK2 acts as a site where PDK1 binds prior to phosphorylating the T-loop site. In this paper, we demonstrate that C-terminal fragments of atypical PKC isoforms (PKCzeta and PKCiota ) and the PKC-related kinases (PRK1 and PRK2) are capable of interacting with wild type PDK1 but not with mutant forms of PDK1 in which the conserved Leu-155, located in the PIF-binding pocket of PDK1 (31), has been altered. We demonstrate that mutation of the conserved aromatic residues of the hydrophobic motif of PKCzeta and PRK2 not only reduces the affinity of these kinases for PDK1 but also inhibits the phosphorylation of PKCzeta and PRK2 at their T-loop residue in cells. Furthermore, we observe that the activity of wild type and mutant PKCzeta and PRK2 in cells correlates well with the degree of phosphorylation of these proteins at their T-loop motif (Figs. 4 and 5). This is consistent with previous studies suggesting that phosphorylation of these residues in PKCzeta (13, 14, 28), PRK1, and PRK2 (15, 16) activates these kinases. Our findings indicate that the hydrophobic motifs of atypical and related PKC isoforms are likely to be acting as PDK1 docking sites analogous to those present in other kinases that are components of distinct kinase cascades such as mitogen-activated protein kinases, CDK2, and c-Jun N-terminal kinase (reviewed in Ref. 39).

The interaction of full-length PRK2, Delta NT-PRK2 (Fig. 3), or PIF itself (29) with PDK1 also requires an Asp residue (Asp-978) in the hydrophobic motif, at the position equivalent to Ser-473 of PKBalpha . Thus mutation of this residue to Ala greatly reduces affinity for PDK1. Consistent with this finding, the mutant D978A-PRK2 does not become phosphorylated at its T-loop when expressed in cells (Fig. 6). This confirms that Asp-978 is required for the recognition and phosphorylation of PRK2 by PDK1 in vivo. In contrast, mutation of the equivalent residue in the hydrophobic motif of PKCzeta (Glu-579) to Ala does not affect the interaction of PKCzeta with PDK1 significantly (Fig. 2). Consistent with this observation a mutant E579A-PKCzeta expressed in 293 cells is still phosphorylated at its T-loop to a similar extent as the wild type enzyme (Fig. 5). Thus, for PKCzeta , it appears that the aromatic residues of the hydrophobic motif are the key determinants that mediate binding to PDK1 (Fig. 2). In contrast, the aromatic residues and the acidic residue of the hydrophobic motif are both needed for the interaction of PRK2 with PDK1.

The E579A-PKCzeta mutant possesses only marginally lower specific activity than the wild type protein (Fig. 5), indicating that a negative charge at this position is not critical for maximal activity. This is consistent with the finding that this mutation does not impair the ability to interact with PDK1. Phosphorylation of the hydrophobic motif of conventional PKC isoforms rather than activating these kinases serves to stabilize these enzymes in an active conformation (9, 40). It is possible that the conserved Glu-579 residue in the hydrophobic motif of PKCzeta would play a similar role. Consistent with this idea, we find that the mutant E579A-PKCzeta is significantly less stable than wild type PKCzeta when heated. For example incubation of wild type PKCzeta at 42 °C for 2 min reduces its activity by 50%, whereas the activity of the E579A-PKCzeta mutant is reduced by over 80% under these conditions (data not shown).

PRK1 and PRK2 interact with activated members of the Rho GTPase family, which may activate and/or control the cellular location of these enzymes (15, 41-45). Full-length PRK1 and PRK2 possess a low specific activity that can be increased over 5-fold by the proteolysis of the N-terminal regulatory domain or by the interaction of PRK1 and PRK2 with acidic phospholipids such as cardiolipin (32, 46-48) and PtdIns(3,4,5)P3 (49). Rho complexed to GTP interacts with the N-terminal regulatory region of PRK1 and PRK2 (41), and recently the structure of Rho bound to this region of PRK1 has been solved (50). Thus far, no physiological substrates for the PRKs have been identified. However, PRK1 has been implicated in growth factor-induced cytoskeletal rearrangements (42), and PRK1 complexed to RhoB has recently been proposed to have a key role in regulating endocytic trafficking of the epidermal growth factor receptor (51).

Recent work has indicated that the interaction of PRK1 and PRK2 with Rho-GTP may enable these kinases to bind to PDK1 and so become phosphorylated at their T-loop residue (15). In contrast to this study, we were unable to demonstrate enhanced association of PDK1 with either full-length PRK2 or Delta NT-PRK2 or any increase in their phosphorylation at Thr-816 when these forms of PRK2 were cotransfected with a constitutively activated form of Rho (data not shown). It is possible that 293 cells already contain high levels of Rho-GTP, which could account for the high degree of T-loop phosphorylation of wild type PRK2 observed in our experiments. We were unable to reduce the level of Thr-816 phosphorylation of either full-length PRK2 or Delta NT-PRK2 in cells even after prolonged serum starvation of cells (data not shown). Furthermore, incubation of full-length PRK2 or Delta NT-PRK2 with very high levels of either protein phosphatase 1 or protein phosphatase 2A1 did not result in dephosphorylation of Thr-816 (or inactivation of the kinase). This suggests that once Thr-816 is phosphorylated by PDK1, it becomes buried in the protein and is thus inaccessible to protein phosphatases. A possible model is that when full-length PRK2 interacts with Rho-GTP through its N-terminal domain, it becomes capable of binding to PDK1 and is therefore phosphorylated at its T-loop. The phosphorylation of this residue results in a conformational change in which Thr-816 becomes inaccessible to protein phosphatases. It should be noted that the full-length PRK2 phosphorylated at Thr-816 is still capable of interacting with PDK1 in the absence of Rho-GTP (see Fig. 3).

Full-length PRK2 even when phosphorylated at Thr-816, in the absence of lipids such as cardiolipin, exists in a low activity conformation. It is likely that either lipids or regulatory proteins or PRK2 substrates will need to interact with the auto-inhibitory non-catalytic N-terminal domain of PRK2 to enable activation of PRK2 in cells.

The overexpression of GST-PIF in cells prevented PDK1 from phosphorylating PKCzeta and PRK2 (Fig. 6) and p70 S6K (30) at their T-loop site, but mutant forms of PIF that interacted weakly with PDK1 were much less effective at inhibiting the phosphorylation of PKCzeta or PRK2 in cells (Fig. 6) as well as p70 S6K (30). These observations suggest that substrates for PDK1 such as p70 S6K, PKCzeta , and PRK2 need to interact with PDK1 at a site that overlaps with the PIF-binding site, before they can become phosphorylated by PDK1. In contrast, we have not been able to demonstrate that PKB can interact with PDK1 in vitro (29) nor is the phosphorylation of PKB by PDK1 inhibited by the presence of PIF in vitro or in transfected 293 cells that have been stimulated with IGF1 (30). Because PKB and PDK1 both interact with 3-phosphoinositides via their pleckstrin homology domains, it is possible that this lipid second messenger is the primary mechanism for colocalizing these molecules at the plasma membrane, hence allowing PDK1 to phosphorylate PKB. In contrast, substrates of PDK1 that do not exhibit a high affinity interaction with 3-phosphoinositides, such as p70 S6K and atypical and related PKC isoforms, may actually need to form tight complexes with PDK1, before they can become phosphorylated.

Although it has been reported that PKCzeta can be activated directly in vitro through its interaction with acidic phospholipids including PtdIns(3,4,5)P3 (52), there is a growing consensus that the activation of PI 3-kinase induces a moderate (2-3-fold) activation of PKCzeta (53-55) that is mediated by the phosphorylation of PKCzeta at its T-loop site by PDK1. PtdIns(3,4,5)P3 may enhance the rate of phosphorylation of this site (13, 14, 28). PKCzeta has been suggested to play a role in regulating many cellular processes. However, the evidence for this is weak and largely based on overexpression of wild type PKCzeta or catalytically inactive forms of this kinase. For example it has been reported that a catalytically inactive mutant of PKCzeta when overexpressed in cells antagonizes the ability of agonists to activate p70 S6K (56), as well as other PKC isoforms (57). The results presented in this paper suggest that the overexpression of inactive forms of PKCzeta or other atypical or related PKC isoforms in cells is likely to prevent PDK1 from interacting with and phosphorylating many of its protein kinase substrates. Thus great caution should be drawn in interpreting the results of such experiments.

    ACKNOWLEDGEMENTS

We thank Walter Kolch for the PKCzeta cDNA construct; Anne Ridley for providing the Rho construct; J. Leitch for preparation of sheep antibodies; Nick Helps for DNA sequencing; Andrew Paterson for preparation of His-PDK1 baculovirus; and Agnieszka Kieloch for culture of 293 cells.

    FOOTNOTES

* This work was supported by Diabetes UK (to D. R. A.), the UK Medical Research Council (to D. R. A.), AstraZeneca, Boehringer Ingleheim, Novo-Nordisk, Pfizer, and Smith Kline Beecham Laboratories.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Both authors made an equal contribution to this study.

|| To whom correspondence should be addressed. Tel.: 44 1382 344241; Fax 44 1382 223778; E-mail: dralessi@bad.dundee.ac.uk.

Published, JBC Papers in Press, April 10, 2000, DOI 10.1074/jbc.M000421200

    ABBREVIATIONS

The abbreviations used are: PKB, protein kinase B; GST, glutathione S-transferase; SGK, serum and glucocorticoid-induced kinase; PKC, protein kinase C; PRK, PKC-related kinase; p70 S6K, p70 S6 kinase; PDK1, 3-phosphoinositide-dependent protein kinase-1; PIF, PDK1-interacting fragment; PtdIns, phosphatidylinositol; PI 3-kinase, phosphoinositide 3-kinase; PCR, polymerase chain reaction.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Vanhaesebroeck, B., and Alessi, D. R. (2000) Biochem. J. 346, 561-576
2. Coffer, P. J., Jin, J., and Woodgett, J. R. (1998) Biochem. J. 335, 1-13
3. Pullen, N., and Thomas, G. (1997) FEBS Lett. 410, 78-82
4. Proud, C. G. (1996) Trends Biochem. Sci. 21, 181-185
5. Kobayashi, T., and Cohen, P. (1999) Biochem. J. 339, 319-328
6. Kobayashi, T., Deak, M., Morrice, N., and Cohen, P. (1999) Biochem. J. 344, 189-197
7. Park, J., Leong, M. L., Buse, P., Maiyar, A. C., Firestone, G. L., and Hemmings, B. A. (1999) EMBO J. 18, 3024-3033
8. Mellor, H., and Parker, P. J. (1998) Biochem. J. 332, 281-292
9. Parekh, D. B., Ziegler, W., and Parker, P. J. (2000) EMBO J. 19, 496-503
10. Alessi, D. R., and Cohen, P. (1998) Curr. Opin. Genet. & Dev. 8, 55-62
11. Pullen, N., Dennis, P. B., Andjelkovic, M., Dufner, A., Kozma, S. C., Hemmings, B. A., and Thomas, G. (1998) Science 279, 707-710
12. Frodin, M., and Gammeltoft, S. (1999) Mol. Cell. Endocrinol. 151, 65-77
13. Chou, M. M., Hou, W., Johnson, J., Graham, L. K., Lee, M. H., Chen, C. S., Newton, A. C., Schaffhausen, B. S., and Toker, A. (1998) Curr. Biol. 8, 1069-1077
14. Le Good, J. A., Ziegler, W. H., Parekh, D. B., Alessi, D. R., Cohen, P., and Parker, P. J. (1998) Science 281, 2042-2045
15. Flynn, P., Mellor, H., Casamassima, A., and Parker, P. J. (2000) J. Biol. Chem. 275, 11064-11070
16. Dong, L. Q., Landa, L. R., Wick, M. J., Zhu, L., Mukai, H., Ono, Y., and Liu, F. (2000) Proc. Natl. Acad. Sci. U. S. A 97, 5089-5094
17. Weinkove, D., Twardzik, T., Waterfield, M. D., and Leevers, S. J. (1999) Curr. Biol. 9, 1019-1029
18. Peterson, R. T., and Schreiber, S. L. (1999) Curr. Biol. 9, R521-R524
19. Belham, C., Wu, S., and Avruch, J. (1999) Curr. Biol. 9, R93-R96
20. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B., and Cohen, P. (1997) Curr. Biol. 7, 261-269
21. Alessi, D. R., Deak, M., Casamayor, A., Caudwell, F. B., Morrice, N., Norman, D. G., Gaffney, P., Reese, C. B., MacDougall, C. N., Harbison, D., Ashworth, A., and Bownes, M. (1997) Curr. Biol. 7, 776-789
22. Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G. F., Holmes, A. B., Gaffney, P. R., Reese, C. B., McCormick, F., Tempst, P., Coadwell, J., and Hawkins, P. T. (1998) Science 279, 710-714
23. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter, G. F., Holmes, A. B., McCormick, F., and Hawkins, P. T. (1997) Science 277, 567-570
24. Alessi, D. R., Kozlowski, M. T., Weng, Q. P., Morrice, N., and Avruch, J. (1998) Curr. Biol. 8, 69-81
25. Jensen, C. J., Buch, M. B., Krag, T. O., Hemmings, B. A., Gammeltoft, S., and Frodin, M. (1999) J. Biol. Chem. 274, 27168-27176
26. Richards, S. A., Fu, J., Romanelli, A., Shimamura, A., and Blenis, J. (1999) Curr. Biol. 12, 810-820
27. Dutil, E. M., Toker, A., and Newton, A. C. (1998) Curr. Biol. 8, 1366-1375
28. Dong, L. Q., Zhang, R., Langlais, P., He, H., Clark, M., Zhu, L., and Liu, F. (1999) J. Biol. Chem. 274, 8117-8122
29. Balendran, A., Casamayor, A., Deak, M., Paterson, A., Gaffney, P., Currie, R., Downes, C. P., and Alessi, D. R. (1999) Curr. Biol. 9, 393-404
30. Balendran, A., Currie, R. A., Armstrong, C. G., Avruch, J., and Alessi, D. R. (1999) J. Biol. Chem. 274, 37400-37406
31. Biondi, R. M., Cheung, P. C., Casamayor, A., Deak, M., Currie, R. A., and Alessi, D. R. (2000) EMBO J. 19, 979-988
32. Yu, W., Liu, J., Morrice, N. A., and Wettenhall, R. E. H. (1997) J. Biol. Chem. 272, 10030-10034
33. Chen, S. J., Klann, E., Gower, M. C., Powell, C. M., Sessoms, J. S., and Sweatt, J. D. (1993) Biochemistry 32, 1032-1039
34. Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P., and Hemmings, B. A. (1996) EMBO J. 15, 6541-6551
35. Lennon, G., Auffray, C., Polymeropoulos, M., and Soares, M. B. (1996) Genomics 33, 151-152
36. Anderson, S., Davie, D. N., Dahlbäck, H., Jörnvall, H., and Russell, D. W. (1989) J. Biol. Chem. 264, 8222-8229
37. Sanchez, I., Hughes, R. T., Mayer, B. J., Yee, K., Woodgett, J. R., Avruch, J., Kyriakis, J. M., and Zon, L. I. (1994) Nature 372, 794-798
38. Alessi, D. R., Cohen, P., Ashworth, A., Cowley, S., Leevers, S. J., and Marshall, C. J. (1995) Methods Enzymol. 255, 279-290
39. Holland, P. M., and Cooper, J. A. (1999) Curr. Biol. 9, R329-R331
40. Bornancin, F., and Parker, P. J. (1997) J. Biol. Chem. 272, 3544-3549
41. Flynn, P., Mellor, H., Palmer, R., Panayotou, G., and Parker, P. J. (1998) J. Biol. Chem. 273, 2698-2705
42. Vincent, S., and Settleman, J. (1997) Mol. Cell. Biol. 17, 2247-2256
43. Takahashi, M., Mukai, H., Toshimori, M., Miyamoto, M., and Ono, Y. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 11566-11571
44. Mellor, H., Flynn, P., Nobes, C. D., Hall, A., and Parker, P. J. (1998) J. Biol. Chem. 273, 4811-4814
45. Amano, M., Mukai, H., Ono, Y., Chihara, K., Matsui, T., Hamajima, Y., Okawa, K., Iwamatsu, A., and Kaibuchi, K. (1996) Science 271, 648-650
46. Morrice, N. A., Fecondo, J., and Wettenhall, R. E. (1994) FEBS Lett. 351, 171-175
47. Morrice, N. A., Gabrielli, B., Kemp, B. E., and Wettenhall, R. E. (1994) J. Biol. Chem. 269, 20040-20046
48. Mukai, H., Kitagawa, M., Shibata, H., Takanaga, H., Mori, K., Shimakawa, M., Miyahara, M., Hirao, K., and Ono, Y. (1994) Biochem. Biophys. Res. Commun. 204, 348-356
49. Palmer, R. H., Dekker, L. V., Woscholski, R., Le Good, J. A., Gigg, R., and Parker, P. J. (1995) J. Biol. Chem. 270, 22412-22416
50. Maesaki, R., Ihara, K., Shimizu, T., Kuroda, S., Kaibuchi, K., and Hakoshima, T. (1999) Mol. Cell 4, 793-803
51. Gampel, A., Parker, P. J., and Mellor, H. (1999) Curr. Biol. 9, 955-958
52. Nakanishi, H., Brewer, K. A., and Exton, J. H. (1993) J. Biol. Chem. 268, 13-16
53. Standaert, M. L., Bandyopadhyay, G., Perez, L., Price, D., Galloway, L., Poklepovic, A., Sajan, M. P., Cenni, V., Sirri, A., Moscat, J., Toker, A., and Farese, R. V. (1999) J. Biol. Chem. 274, 25308-25316
54. Standaert, M. L., Galloway, L., Karnam, P., Bandyopadhyay, G., Moscat, J., and Farese, R. V. (1997) J. Biol. Chem. 272, 30075-30082
55. Mendez, R., Kollmorgen, G., White, M. F., and Rhoads, R. E. (1997) Mol. Cell. Biol. 17, 5184-5192
56. Romanelli, A., Martin, K. A., Toker, A., and Blenis, J. (1999) Mol. Cell. Biol. 19, 2921-2928
57. Garcia-Paramio, P., Cabrerizo, Y., Bornancin, F., and Parker, P. J. (1998) Biochem. J. 333, 631-636

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page