HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 28, 20963-20966, July 14, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/28/20963    most recent C000273200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kawabe, Y.-i. Articles by Enomoto, T. Search for Related Content PubMed PubMed Citation Articles by Kawabe, Y.-i. Articles by Enomoto, T. Social Bookmarking                      What's this?

ACCELERATED PUBLICATION
Covalent Modification of the Werner's Syndrome Gene Product with the Ubiquitin-related Protein, SUMO-1^*

Yoh-ichi Kawabe, Masayuki Seki, Takahiko Seki, Wen-Sheng Wang, Osamu Imamura^§, Yasuhiro Furuichi^§, Hisato Saitoh^¶, and Takemi Enomoto

From the  Molecular Cell Biology Laboratory, Graduate School of Pharmaceutical Sciences, Tohoku University, Aoba, Aramaki, Aoba-ku, Sendai 980-8578, Japan, ^§ AGENE Research Institute, 200 Kajiwara, Kamakura 247, Japan, and ^¶ The Picower Institute for Medical Research, Manhasset, New York 11030

Received for publication, April 20, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

Werner's syndrome is a potential model of accelerated human aging. The gene responsible for Werner's syndrome encodes a protein that has a helicase domain homologous to Escherichia coli RecQ. To identify binding partners that regulate the function in concert with Wrn, we screened for proteins using the yeast two-hybrid system with mouse Wrn as bait and found three. One was a novel protein, and the other two were mouse Ubc9 and SUMO-1. Ubc9 also interacted with the mouse homologue of the Bloom's syndrome gene product, another eukaryotic RecQ-type helicase, but not mouse DNA helicase Q1/RecQL (RecQL1). Deletion experiments indicated that both proteins interacted with the N-terminal segment of Wrn (amino acid 272-514). The interaction between Wrn and SUMO-1 was weaker than that between Wrn and Ubc9. Positive interaction was observed in the heterogeneous combination of Wrn and yeast Ubc9 (yUbc9), as well as yUbc9 and SUMO-1, in the two-hybrid system. The interaction between yUbc9 and SUMO-1 was abolished by deleting the C-terminal Gly residue of SUMO-1, which is reportedly required for the formation of Ubc9-SUMO-1 thioester linkage. The interaction of Wrn and SUMO-1 was also abolished by deleting the Gly residue, indicating that the interaction of Wrn and SUMO-1 is mediated by yUbc9 in the two-hybrid system. Finally, we confirmed by immunoblotting with an anti-SUMO-1 antibody that Wrn was covalently attached with SUMO-1.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

Werner's syndrome (WS),¹ a rare autosomal recessive disorder, is a potential model of accelerated human aging. WS patients prematurely develop a variety of major age-related diseases such as arteriosclerosis, malignant neoplasms, melituria, and cataract and often die before age 50 (1). The gene responsible for WS encodes a protein (Wrn) consisting of 1432 amino acids (2) that has a helicase domain homologous to Escherichia coli RecQ (3). Wrn has been shown to have DNA-dependent ATPase, DNA helicase, and exonuclease activities (4-7). A similar helicase domain exists in helicase Q1/RecQL (RecQL1) (8, 9), Bloom's syndrome gene product (10), Rhusmund-Thomson's syndrome gene product (RecQL4) (11), and RecQL5 (12).

Most of the mutations identified in WRN cause premature termination of translation (13, 14) resulting in impaired nuclear import of the protein, because the nuclear localization signal is located in the carboxyl terminus of Wrn (15). Therefore, the clinical features and cellular phenotypes of most WS patients are due to an absolute lack of Wrn helicase in the nucleus. Cells derived from WS patients show chromosome instability, a shorter life span in in vitro culture (16), and accelerated telomere shortening (17). WS cells have subtle defects in DNA replication, resulting in a reduced frequency of firing of replication origins (18). In addition, a large number of reports have shown that many cellular events including DNA repair, transcription, and apoptosis are affected in WS cells (19-21). Recently the Xenopus laevis Wrn homologue, FFA-1, was identified as a factor for recruiting replication protein A to the pre-replicative foci in a cell-free system (22). In addition, it was reported that Wrn is able to interact with replication protein A, PCNA, and DNA topoisomerase I, suggesting that Wrn plays some role in DNA replication (23-25). Wrn also interacts with p53, and p53-mediated apoptosis is attenuated in WS cells (21, 26). Despite these observations, it is not clear how the dysfunction of Wrn is related to the observed phenotypes of cells derived from WS patients.

To obtain further insight into the process in which Wrn is involved, we tried to isolate cDNAs encoding proteins that interacted with mouse Wrn by using the yeast two-hybrid system. We identified the following three mouse proteins: a novel protein (Whip; Werner helicase interacting protein), Ubc9, and SUMO-1. Ubc9 was originally believed to be involved in the conjugation of ubiquitin (27) but now is known to be involved in SUMO-1 conjugation (28-30). We demonstrated a covalent association of Wrn with SUMO-1.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

Yeast Strains-- The yeast strains used were HF7c (MATa, ura3-52, his3-200, ade2-101, lys2-801, trp1-901, leu2-3, 112, gal4-542, gal80-538, LYS2::GAL1-HIS3, URA3::[GAL4 17-mers]3-CYC1-lacZ) and Y190 (MATa, ura3-52, his3-200, lys2-801, ade2-101, trp1-901, leu2-3, 112, gal4D, gal80D, cyhr2, LYS2::GAL1-HIS3-HIS3, URA3::GAL1-GAL1-lacZ).

Plasmids-- The shuttle vectors, pGBT9 and pGAD424, were purchased from CLONTECH. The expression vector, pCMV5-FLAG (pFLAG), was a gift from Dr. S. Hosino, Tokyo University, Japan.

Construction of Plasmids-- We cloned mouse Wrn cDNA encoding a 1401-amino acid protein (31). The Wrn cDNA in pGME-T-Easy vector (Promega) was digested with BglII and SalI and then blunted by treating with Klenow fragment. The bait plasmid, pGBT9-mWRN-F (mWRN), was constructed by inserting the full-length Wrn cDNA in-frame at the blunted SalI site of pGBT9. Variously truncated Wrn cDNA were prepared by PCR using appropriate primers on a plasmid containing the full-length Wrn cDNA and subcloned into pGBT9. All constructs were verified by DNA sequencing. pGBT9-mouse BLM (mBLM), pGBT9-mouse RecQL1 (mQL1), and pGBT9-mouse RecQL1 (mQL1) were constructed as described previously (32, 33). The full-length Wrn cDNA was digested with BglII and SalI and subcloned into pFLAG to generate the N-terminal FLAG-tagged Wrn (pFLAG-mWRN).

Construction of pGBT9-yUBC9 and pGAD424-yUBC9-- Budding yeast genomic UBC9 DNA was amplified by PCR and was inserted into pGEM-T-Easy vector. To obtain yUBC9 cDNA, it is necessary to remove the intron sequence from the genomic DNA. The yUBC9 exon 2 was amplified by PCR on pGEM-T-genomic yUBC9. The exon 2 DNA was linked with the 90-mer linker containing whole exon 1 and a 38-base exon 2 sequence by PCR. The full-length yUBC9 cDNA was cloned into pGEM-T-Easy vector and verified by DNA sequencing. The XhoI fragment of yUBC9 cDNA was inserted into the SalI site of the pGBT9 or pGAD424 vector.

Construction of pGBT9-mSUMO-1, pGBT9-mSUMO-1 G96, and pACT-mSUMO-1 G96-- Full-length mouse SUMO-1 cDNA and the deletion mutant of the C-terminal Gly residue of SUMO-1 (lacking the C-terminal sequence, GHSTV) were amplified by PCR on pACT-mSUMO-1 using primers (pACT-5', GATGATGAAGATACCCCACC and pACT-3', ATTGAGATGGTGCACGATGC or mSUMO-1 GE, GTCTCGAGTCACCCCGTTTGTTCCTG) and digested with XhoI. The XhoI fragment of SUMO-1 constructs was inserted into pGBT9 and pACT vector.

Two-hybrid Screening-- Yeast cells (strain HF7c) containing the bait plasmid pGBT9-mWRN-F were transformed with a mouse lymphoma cDNA library (CLONTECH) for two-hybrid assay using the lithium acetate method. Approximately 2.3 × 10⁶ transformants were selected for growth on SD plates lacking histidine, leucine, and tryptophan. The colonies grown on the SD plates were subsequently analyzed for -galactosidase activity by filter assay, and 50 -galactosidase-positive clones were obtained. By comparing restriction patterns of PCR products, the positive clones were categorized into 3 groups, Whip (20 clones), Ubc9 (29 clones), and SUMO-1 (1 clone). pGBT9-mWRN-F and pACT-WHIP, -UBC9, or -SUMO-1 were transformed into strain Y190, and their interaction was examined.

Recovery of Plasmids from Yeasts and DNA Sequencing-- Plasmids were transformed into E. coli HB101 cells by electroporation, and the cells were grown on ampicillin (+) plates. Ampicillin-resistant clones were streaked on leucine () M9 plates. The pACT plasmids containing Whip, Ubc9, or SUMO-1 were obtained by the standard method from ampicillin-resistant and leucine (+) colonies and then sequenced.

-Galactosidase Liquid Assay-- -Galactosidase activity was assayed according to the CLONTECH manual. The -galactosidase activity was as follows: Miller unit = 1000 × A₄₂₀/(t × V × A₆₀₀), where t = reaction time (min), and V = assay volume (ml).

Cell Culture and DNA Transfection-- 293EBNA cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Cells were grown to 70% confluence in 10-cm dishes and transfected with plasmid DNA using LipofectAMINE (Life Technologies, Inc.).

Immunoprecipitation and Immunoblotting-- Transfected 293EBNA cells were washed once with phosphate-buffered saline, lysed with 4 × radioimmune precipitation buffer (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 4% Nonidet P-40, 2% sodium deoxycholate, 0.4% SDS, 2 mM dithiothreitol), and sonicated on ice. The cell lysate was diluted with dilution buffer (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 2 mM dithiothreitol) supplemented with 20 mM N-ethylmaleimide and COMPLETE protease inhibitor mixture (Roche Molecular Biochemicals) and stood for 20 min on ice. The cell lysate was centrifuged at 14,000 rpm for 30 min at 4 °C. The supernatant was incubated with protein A-Sepharose (Amersham Pharmacia Biotech) for 30 min at 4 °C and centrifuged. The resultant supernatant was incubated for 1.5 h at 4 °C with anti-FLAG M2 affinity gel (Eastman Kodak Co.), which had been preincubated with 1% bovine serum albumin/phosphate-buffered saline. The anti-FLAG M2 affinity gel was precipitated by centrifugation, and the precipitate was washed three times with 1 × radioimmune precipitation buffer and then suspended in SDS sample buffer. Samples were fractionated in 6% SDS polyacrylamide gel. The gel was transferred to a polyvinylidene difluoride membrane (Millipore) and immunoblotted with anti-FLAG (SIGMA) or anti-SUMO-1(Zymed Laboratories Inc.) antibody followed by the secondary antibody, horseradish peroxidase-conjugated anti-mouse IgG (DAKO). Bands were visualized using ECL detection reagents (Amersham Pharmacia Biotech).

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

The yeast two-hybrid system was used to isolate cDNA-encoding polypeptides that interact with mWrn. We screened 2.3 × 10⁶ transformants derived from a mouse lymphoma cDNA library and identified 50 positive clones, which were categorized into 3 different groups, Whip (20 clones), which encodes a novel protein (to be published elsewhere), Ubc9 (29 clones), and SUMO-1 (1 clone). Mouse SUMO-1 is 100% identical to hSUMO-1 at the amino acid level, and 48% identical to Smt3 (SUMO-1 homologue of budding yeast). It has been established that Ubc9 acts to conjugate SUMO-1 to other proteins (28-30). We examined the interaction of Ubc9 with other RecQ family proteins and found that Ubc9 is able to interact with the mouse Bloom's syndrome gene product (Blm) but not mouse RecQL1 or RecQL1 (Fig. 1).

View larger version (54K): [in this window] [in a new window]   Fig. 1.   Interaction of Ubc9 and three mouse RecQ helicase homologues. A, yeast cells (strain HF7c) were transformed with the indicated plasmids and plated on Trp(), Leu() plates. Transformed HF7c cells containing both plasmids were streaked on plates with or without histidine. B, yeast cells (strain Y190) were transformed with the indicated binding domain fusion vector and pACT-mUBC9 and plated on Trp(), Leu() plates. -Galactosidase activity was determined by liquid -galactosidase assay.

To map the Wrn domains that bind to Ubc9 and SUMO-1, we generated deletion mutants and assayed transcriptional activity using the two-hybrid system (Fig. 2). The N-terminal fragment (amino acid 1-514) interacted with both Ubc9 and SUMO-1, but the C-terminal fragment (amino acid 514-1401) did not. A higher level of transcriptional activity was observed with the fragment (amino acid 272-514) containing the repeat sequence and the acidic domain. A considerable level of promoter activity was observed with the fragment (amino acid 272-416) lacking the repeat sequence and the acidic domain. Weak promoter activity was detected after introduction of the fragment containing the repeat sequence and the acidic domain of Wrn; however, this fragment caused high background. Thus we concluded that Ubc9 and SUMO-1 interact with the N-terminal segment of Wrn (amino acid 272-514).

View larger version (13K): [in this window] [in a new window]   Fig. 2.   Mapping of the interacting domain of Wrn with Ubc9 or SUMO-1 in the yeast two-hybrid system. Yeast cells (strain Y190) were transformed with the indicated constructs and assayed for -galactosidase activity. -Galactosidase activity was evaluated by liquid -galactosidase assay performed in triplicate. A, B, C, D, and E indicate the exonuclease domain, repeat region, acidic region, helicase domain, and nuclear localization signal, respectively. a.a., amino acid position.

It is worth noting that the transcriptional activity due to the interaction between Ubc9 and Wrn or its fragments is always higher than that due to the interaction between SUMO-1 and each of the corresponding Wrn polypeptides. It is conceivable that the weak interaction between SUMO-1 and Wrn is mediated by yeast Ubc9. Thus, the interaction between Wrn and yUbc9 and that between yUbc9 and SUMO-1 were examined. Weak but significant levels of transcription were observed in both cases (Table I).

View this table: [in this window] [in a new window]   Table I Interaction between Wrn and yUbc9 and between yUbc9 and SUMO-1 A, yeast cells (strain Y190) were transformed with pGBT9-mWRN-F and pACT-mUBC9, pACT-mSUMO-1, pACT-mSUMO-1 G96, or pGAD424-yUBC9 and assayed for -galactosidase activity. B, yeast cells (strain Y190) were transformed with the indicated combination of plasmids and assayed for -galactosidase activity by filter and liquid assays.

It has been reported that on deletion of the conserved C-terminal Gly-Gly residues of hSUMO-1, hUbc9-SUMO-1 thioester linkage in an in vitro reticulocyte system, as well as two-hybrid interaction between hUbc9 and hSUMO-1 in yeast cells, was abolished (29). As expected, the deletion of the C-terminal Gly residue abolished the interaction between mUbc9 and mSUMO-1 in yeast cells, because the amino acids sequences of these protein are the same as those of the human counterparts (Table IB). In addition, the interaction between yUbc9 and SUMO-1 was also abolished by deleting the C-terminal Gly residue of SUMO-1. Thus, if the interaction between Wrn and SUMO-1 is mediated by yUbc9, it is quite possible that the interaction between Wrn and SUMO-1 is abolished by deleting the C-terminal Gly residue. As shown in Table IA, this was the case.

It is interesting to know whether Wrn itself is conjugated with SUMO-1. FLAG-tagged Wrn was expressed in human 293EBNA cells, and immunoprecipitants were prepared using an anti-FLAG antibody. Whole cell extracts and immunoprecipitants were subjected to SDS polyacrylamide gel electrophoresis. As shown in Fig. 3A, several higher molecular weight bands of Wrn were detected, and these bands were proven to indeed be Wrn conjugated with SUMO-1 by Western blotting using an anti-SUMO-1 antibody (Fig. 3B). Among the proteins that have been shown to interact with UBC9 or SUMO-1 by the yeast two hybrid assay, PML, IB, p53, and HIPK2 have been confirmed to be conjugated with SUMO-1 in the cell (35-40). It has been observed that several lysine residues in PML are conjugated with SUMO-1 (41). Thus the existence of several higher molecular weight forms of Wrn should be due to SUMO-1 conjugation at multiple sites.

View larger version (21K): [in this window] [in a new window]   Fig. 3.   Covalent modification of Wrn with SUMO-1. A, the 293EBNA cells were transfected with pFLAG-mWRN (+) or control vector (), and 48 h after transfection, cells were lysed with lysis buffer containing 20 mM N-ethylmaleimide. Whole cell extracts (75 µg) were fractionated by 6% SDS polyacrylamide gel electrophoresis and analyzed by Western blotting with an anti-FLAG or anti-SUMO-1 monoclonal antibody. B, the 293EBNA cells were transfected as in A. The cells were lysed in lysis buffer containing 20 mM N-ethylmaleimide. FLAG-tagged Wrn were immunoprecipitated with anti-FLAG antibody-conjugated agarose beads as described under "Materials and Methods." Immunoprecipitants were fractionated by 6% SDS polyacrylamide gel electrophoresis and analyzed by Western blotting with an anti-FLAG or anti-SUMO-1 monoclonal antibody. W.C.E., whole cell extracts; I.B., immunoblotting; I.P., immunoprecipitation.

A variety of proteins have been shown to interact with either SUMO-1 or Ubc9 or both (summarized in Ref. 29). They are involved in several biological phenomena such as apoptosis (Fas, p53, TNFR1, and IB), viral oncogenesis (adenovirus E1A and papiloma virus E1), transcription (c-Jun, glucocorticoid receptor, E2A, ATF2, p53, and Wilm's tumor gene product), nuclear dot formation (PML), centromere function (Cbf3), nuclear import (RanGAP1 and RanBP2), and maintenance of genome integrity (Rad51, Rad52, p53, poly(ADP-ribose)-polymerase, Wrn, and Blm).

The budding yeast genes involved in the conjugation of Smt3 (budding yeast SUMO-1 homologue), AOS1, UBA2, UBC9, and SMT3, are essential for growth (42). In Schizosaccharomyces pombe, rad31 (AOS1 homologue) gene disruptants (43), hus5 (UBC9 homologue) disruptants (44), and pmt3 (SMT3 homologue) disruptants (45) are viable but very sick and show the same biological defect in the damage-tolerance/S-phase recovery, which is regulated by S-phase checkpoint genes. It must be noted that the WRN/BLM homologue of fission yeast, rqh1 (RecQ homologue 1), belongs to the same damage-tolerance/S-phase recovery pathway (34, 46) as rad31 and hus5, indicating physiological interaction of Wrn/Blm with Ubc9 and SUMO-1. Thus, it seems very likely that the function of Wrn/Blm is controlled by SUMO-1 conjugation in higher eukaryotic cells.

	FOOTNOTES

^* This work was supported by grants-in-aid for scientific research, for scientific research on priority areas from the Ministry of Education, Science, Sports and Culture of Japan, by health sciences research grants from the Ministry of Health and Welfare of Japan, and by a grant from the Mitsubishi Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 81-22-217-6874; Fax: 81-22-217-6873; E-mail: enomoto@mail.pharm.tohoku.ac.jp.

Published, JBC Papers in Press, May 10, 2000, DOI 10.1074/jbc.C000273200

	ABBREVIATIONS

The abbreviations used are: WS, Werner's syndrome; h, human; m, mouse; PCR, polymerase chain reaction; y, yeast; D.B.D., Gal4-DNA binding domain; D.A.D., Gal4-DNA activation domain.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				R. M. Brosh Jr and V. A. Bohr Human premature aging, DNA repair and RecQ helicases Nucleic Acids Res., December 3, 2007; 35(22): 7527 - 7544. [Abstract] [Full Text] [PDF]

				C.-M. Hecker, M. Rabiller, K. Haglund, P. Bayer, and I. Dikic Specification of SUMO1- and SUMO2-interacting Motifs J. Biol. Chem., June 9, 2006; 281(23): 16117 - 16127. [Abstract] [Full Text] [PDF]

				J. G. Marblestone, S. C. Edavettal, Y. Lim, P. Lim, X. Zuo, and T. R. Butt Comparison of SUMO fusion technology with traditional gene fusion systems: Enhanced expression and solubility with SUMO Protein Sci., January 1, 2006; 15(1): 182 - 189. [Abstract] [Full Text] [PDF]

				S. Eladad, T.-Z. Ye, P. Hu, M. Leversha, S. Beresten, M. J. Matunis, and N. A. Ellis Intra-nuclear trafficking of the BLM helicase to DNA damage-induced foci is regulated by SUMO modification Hum. Mol. Genet., May 15, 2005; 14(10): 1351 - 1365. [Abstract] [Full Text] [PDF]

				H. Takahashi, S. Hatakeyama, H. Saitoh, and K. I. Nakayama Noncovalent SUMO-1 Binding Activity of Thymine DNA Glycosylase (TDG) Is Required for Its SUMO-1 Modification and Colocalization with the Promyelocytic Leukemia Protein J. Biol. Chem., February 18, 2005; 280(7): 5611 - 5621. [Abstract] [Full Text] [PDF]

				Y. L. Woods, D. P. Xirodimas, A. R. Prescott, A. Sparks, D. P. Lane, and M. K. Saville p14 Arf Promotes Small Ubiquitin-like Modifier Conjugation of Werners Helicase J. Biol. Chem., November 26, 2004; 279(48): 50157 - 50166. [Abstract] [Full Text] [PDF]

				J. A. Wohlschlegel, E. S. Johnson, S. I. Reed, and J. R. Yates III Global Analysis of Protein Sumoylation in Saccharomyces cerevisiae J. Biol. Chem., October 29, 2004; 279(44): 45662 - 45668. [Abstract] [Full Text] [PDF]

				C. Soustelle, L. Vernis, K. Freon, A. Reynaud-Angelin, R. Chanet, F. Fabre, and M. Heude A New Saccharomyces cerevisiae Strain with a Mutant Smt3-Deconjugating Ulp1 Protein Is Affected in DNA Replication and Requires Srs2 and Homologous Recombination for Its Viability Mol. Cell. Biol., June 15, 2004; 24(12): 5130 - 5143. [Abstract] [Full Text] [PDF]

				C. von Kobbe, N. H. Thoma, B. K. Czyzewski, N. P. Pavletich, and V. A. Bohr Werner Syndrome Protein Contains Three Structure-specific DNA Binding Domains J. Biol. Chem., December 26, 2003; 278(52): 52997 - 53006. [Abstract] [Full Text] [PDF]

				P. L. Opresko, W.-H. Cheng, C. von Kobbe, J. A. Harrigan, and V. A. Bohr Werner syndrome and the function of the Werner protein; what they can teach us about the molecular aging process. Carcinogenesis, May 1, 2003; 24(5): 791 - 802. [Abstract] [Full Text] [PDF]

				G. Blander, N. Zalle, Y. Daniely, J. Taplick, M. D. Gray, and M. Oren DNA Damage-induced Translocation of the Werner Helicase Is Regulated by Acetylation J. Biol. Chem., December 20, 2002; 277(52): 50934 - 50940. [Abstract] [Full Text] [PDF]

				M. Fry The Werner Syndrome Helicase-Nuclease--One Protein, Many Mysteries Sci. Aging Knowl. Environ., April 3, 2002; 2002(13): re2 - 2. [Abstract] [Full Text] [PDF]

				H. Saitoh, M. D. Pizzi, and J. Wang Perturbation of SUMOlation Enzyme Ubc9 by Distinct Domain within Nucleoporin RanBP2/Nup358 J. Biol. Chem., February 8, 2002; 277(7): 4755 - 4763. [Abstract] [Full Text] [PDF]

				P. Mohaghegh and I. D. Hickson DNA helicase deficiencies associated with cancer predisposition and premature ageing disorders Hum. Mol. Genet., April 1, 2001; 10(7): 741 - 746. [Abstract] [Full Text] [PDF]

				Y.-i. Kawabe, D. Branzei, T. Hayashi, H. Suzuki, T. Masuko, F. Onoda, S.-J. Heo, H. Ikeda, A. Shimamoto, Y. Furuichi, et al. A Novel Protein Interacts with the Werner's Syndrome Gene Product Physically and Functionally J. Biol. Chem., June 1, 2001; 276(23): 20364 - 20369. [Abstract] [Full Text] [PDF]

				D. Rangasamy, K. Woytek, S. A. Khan, and V. G. Wilson SUMO-1 Modification of Bovine Papillomavirus E1 Protein Is Required for Intranuclear Accumulation J. Biol. Chem., November 22, 2000; 275(48): 37999 - 38004. [Abstract] [Full Text] [PDF]

				T. Buschmann, D. Lerner, C.-G. Lee, and Z.'e. Ronai The Mdm-2 Amino Terminus Is Required for Mdm2 Binding and SUMO-1 Conjugation by the E2 SUMO-1 Conjugating Enzyme Ubc9 J. Biol. Chem., October 26, 2001; 276(44): 40389 - 40395. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/28/20963    most recent C000273200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kawabe, Y.-i. Articles by Enomoto, T. Search for Related Content PubMed PubMed Citation Articles by Kawabe, Y.-i. Articles by Enomoto, T. Social Bookmarking                      What's this?