Originally published In Press as doi:10.1074/jbc.M002066200 on May 3, 2000
J. Biol. Chem., Vol. 275, Issue 28, 20996-21001, July 14, 2000
Inhibition of the Thioredoxin-dependent Activation of
the NADP-malate Dehydrogenase and Cofactor Specificity*
Isabelle
Schepens
,
Kenth
Johansson§,
Paulette
Decottignies
,
Maggaly
Gillibert¶,
Masakazu
Hirasawa
,
David B.
Knaff
, and
Myroslawa
Miginiac-Maslow
**
From the
Institut de Biotechnologie des Plantes, UMR
8618 CNRS, Université de Paris-Sud, Bâtiment 630, Orsay, France, the § Department of Molecular Biology, BMC,
S-751 24 Uppsala, Sweden, the ¶ Laboratoire d'Enzymologie et
Biochimie Structurales, UPR 9063 CNRS, 91198-Gif-sur-Yvette,
France, and the
Department of Chemistry and Biochemistry,
Texas Tech University, Lubbock, Texas 79409-1061
Received for publication, March 13, 2000, and in revised form, April 28, 2000
 |
ABSTRACT |
The chloroplastic NADP-malate dehydrogenase is
activated by reduction of its N- and C-terminal disulfides by reduced
thioredoxin. The activation is inhibited by NADP+,
the oxidized form of the cofactor. Previous studies suggested that the
C-terminal disulfide was involved in this process. Recent structural
data pointed toward a possible direct interaction between the C
terminus of the oxidized enzyme and the cofactor. In the present study,
the relationship between the cofactor specificity for catalysis and for
inhibition of activation has been investigated by changing the cofactor
specificity of the enzyme by substitution of selected residues of the
cofactor-binding site. An NAD-specific thiol-regulated MDH was
engineered. Its activation was inhibited by NAD+ but no
longer by NADP+. These results demonstrate that the
oxidized cofactor is bound at the same site as the reduced cofactor and
support the idea of a direct interaction between the negatively charged
C-terminal end of the enzyme and the positively charged nicotinamide
ring of the cofactor, in agreement with the structural data. The
structural requirements for cofactor specificity are modeled and discussed.
 |
INTRODUCTION |
The chloroplastic NADP-malate dehydrogenase (EC 1.1.1.82) differs
from all the other malate dehydrogenases in its cofactor specificity;
it uses NADPH instead of NADH. It has also an additional remarkable
property; it is activated by reduction through thiol/disulfide interchange via the ferredoxin-thioredoxin system (1), whereas the
other malate dehydrogenases are permanently active. This activation is
specifically inhibited by the oxidized form of the cofactor (2, 3). The
cofactor specificity holds for the inhibitory effect as well;
NADP-MDH1 activation is
inhibited by NADP+ but not by NAD+. Recent
biochemical (4, 5) and structural (6, 7) studies have clarified the
complex activation mechanism of the enzyme. In the oxidized form,
NADP-MDH features two different disulfides per subunit: one at the N
terminus and the other at the C terminus, each situated in sequence
extensions typical for the thiol-regulated forms. The C-terminal bridge
pulls the C-terminal extension toward the active site where it acts as
an internal inhibitor, preventing substrate access to the active site.
Upon reduction, the C-terminal extension is released from the active site (8). The evidence for the exact role of the N-terminal regulatory
disulfide is less clear, but it has been proposed that reduction of
this disulfide induces a conformational change of the protein during
which substrate affinity is optimized.
These results provided some clues for the interpretation of previous
observations made during studies aimed at solving the puzzling
inhibitory effect of NADP+. Of particular importance were
the observations that the inhibition disappeared when the C-terminal
disulfide was reduced or when either of its cysteines was replaced by
site-directed mutagenesis (9) and also when the negative charge of the
penultimate C-terminal glutamate residue was eliminated by a
substitution for a glutamine (5). The last observation suggested an
interaction between the negatively charged penultimate residue and the
positively charged nicotinamide ring of the oxidized cofactor but did
not provide any clue about the high specificity for NADP+
versus NAD+. In particular, it remained unclear
whether the specificity for inhibition and the specificity for
catalysis were related or whether the inhibitory effect of
NADP+ was strictly related to the particular thiol
activation mechanism of the enzyme.
In an attempt to answer these questions, we have performed
site-directed mutagenesis of amino acids at the cofactor-binding site
of NADP-MDH to shift its cofactor specificity from NADPH toward NADH.
The results indicate that the relationship between cofactor specificity
for inhibition and for catalysis characteristic of the wild type enzyme
is also observed in mutants with altered cofactor specificity. The
results are discussed in light of recent structural data.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Pfu DNA polymerase, oligonucleotides,
restriction endonucleases, and T4 DNA ligase were obtained from
Promega, Appligene, and Life Technologies, Inc. DEAE-Sephacel, ACA 44 and Matrex red A chromatographic supports were from Sigma, Sepracor,
and Millipore. The monoQ HR5/5 FPLC column and the radiolabels were
from Amersham Pharmacia Biotech.
The pUC9 and pETmdh vectors described in Ref. 10 were used
in the mutagenesis strategy. Escherichia coli DH5
F' from
Life Technologies, Inc. was used to produce high yields of pET and pUC
vectors. E. coli BL21 (DE3) strain (hsdS gal
(
c Its 857 ind1 Sam7 nin lacUV5-T7 gene 1)) was used
for the production of wild type and mutant NADP-MDHs encoded by
recombinant pET vectors (11). Bacteria were grown at 37 °C on Luria
broth medium supplemented with ampicillin 50 µM when the
bacteria carried pET or pUC plasmid.
Site-directed Mutagenesis of NADP-MDH cDNA and DNA
Sequencing--
PCR site-directed mutagenesis strategy was used to
introduce the G84D, the S85I/R87Q/S88A, and the G84D/S85I/R87Q/S88A
mutations into the wild type sorghum NADP-MDH cDNA sequence
(GenBankTM accession number X53453; Ref. 12). The
following oligonucleotides were used: G,
GAAGTTACTTGATTCAGAGAGATCGTTTCA; G-rev,
TGAAACGATCTCTCTGAATCAAGTAACTTC; SRS,
GAAGTTACTTGGTATAGAGCAAGCATTTCAAGCTCTCG; SRS-rev,
CGAGAGCTTGAAATGCTTGCTCTATACCAAGTAACTTC; GSRS,
GAAGTTACTTGATATAGAGCAAGCATTTCA; GSRS-rev,
TGAATTGCTTGCTCTATATCAAGTAACTTC; NheI-rev, CCTGCTTTGAGTGCTAGCTGGCACTTTGCTC; and Near-up,
CACAACGGTTTCCCTCTAGAAATAATTTTG. Mutagenic bases are in bold. The
Near-up oligonucleotide hybridizes to the pET plasmid 50 base pairs
from the 5' end of the MDH cDNA.
Three PCR steps were necessary to obtain the mutated fragments: 1) a
first PCR reaction using either the G-rev, SRS-rev, or GSRS-rev and the
Near-up oligonucleotides with the pETmdh vector as a
template for the G84D and the S85I/R87Q/S88A mutants or with the
S85I/R87Q/S88A mutated pETmdh vector as a template for the G84D/S85I/R87Q/S88A mutant. 2) A second PCR reaction using the G, SRS,
or GSRS and the NheI-rev oligonucleotides was performed either with the pETmdh vector as a template for the G86D and
the S85I/R87Q/S88A mutants or with the S85I/R87Q/S88A mutated
pETmdh vector as a template for the G84D/S85I/R87Q/S88A
mutant; the PCR products were seperated on 1% agarose gel
electrophoresis and eluted. 3) In a third PCR reaction the 400-base
pair fragment obtained from the first PCR and the 400-base pair
fragment obtained from the second PCR were combined by a PCR reaction
and amplified using the Near-up and the NheI-rev
oligonucleotides. This third reaction gave a 800-base pair NADP-MDH
cDNA fragment containing the mutation and was digested with the
NcoI and NheI restriction endonucleases. The
whole cDNA bearing the mutation was then obtained by exchanging the
NcoI-NheI fragment of wild type MDH cDNA
cloned in pUC9 for the fragment obtained by PCR. The
NcoI-BamHI fragment of the mutated MDH cDNA
was transferred to a pET vector for production of the modified protein.
The sequence of every mutated cDNA was checked after each cloning
step using the method of Sanger et al. (Ref. 13; T7
sequencing kit; Amersham Pharmacia Biotech).
Mutant Protein Production and Purification--
Procedures for
expression of the mutated NADP-MDH cDNA in pET and preparation of
soluble protein extracts from transformed BL21 E. coli were
the same as described previously (10). Purification of the mutants
consisted of ammonium sulfate fractionation between 35 and 60%
saturation in 20 mM sodium phosphate, 1 mM
EDTA, pH 7.2 buffer (PE buffer) followed by a dialysis overnight
against 100 volumes of PE buffer. The fractionated extract was then
loaded on a DEAE-Sephacel column (25 × 3 cm), washed extensively
with PE buffer, and eluted with a linear gradient (2 × 250 ml) of
0-0.6 M NaCl in PE buffer. For the S85I/R87Q/S88A and G86D
mutants, the active fractions were pooled and directly loaded on a
Matrex Red A column (15 × 1.5 cm). After washing with PE buffer,
the enzyme was eluted from the affinity column with a linear gradient (2 × 250ml) 0-3 M NaCl in PE for the S85I/R87Q/S88A
mutant or 0-2 M in PE for the G84D mutant. Fractions
enriched in NADP-MDH protein were pooled, dialyzed overnight against
100 volumes of PE buffer, and concentrated on an Amicon ultrafiltration
cell, using a YM10 membrane. The concentrated extracts of the G86D and G84D/S85I/R87Q/S88A mutants were further purified on an ACA44 size
exclusion column (2.5 × 40 cm) and eluted with a 100 mM sodium phosphate buffer, pH 7.2, 1 mM EDTA.
Active fractions were concentrated to 1-1.5 mg/ml on an Amicon
ultrafiltration cell, using a YM10 membrane. For all three mutants, a
final purification step was performed on an FPLC Mono Q ion exchange
column. After loading the protein, elution was achieved with a 30-min
linear gradient of 30 to 65% buffer B or 30 to 70% buffer B or
0-100% buffer B in buffer A, respectively for the G84D, the
G84D/S85I/R87Q/S88A, and the S85I/R87Q/S88A mutants (buffer A: 30 mM Tris-HCl, pH 7.9; buffer B: 30 mM Tris-HCl,
pH 7.9, 0.5 M NaCl) at a flow rate of 0.5 ml/min. The
active fractions were then dialyzed in PE and concentrated to 1 mg/ml
on an Amicon Centricon concentrator 30. Their purity was checked by
vertical SDS-polyacrylamide gel electrophoresis following the method of
Schäger and Von Jagow (14). The protein bands were visualized by
Coomassie Brilliant Blue staining. Recombinant WT enzyme was produced
in E. coli and purified as described previously (10).
Activation Kinetics, Enzyme Activity Assays, and Kinetic
Parameter Determinations--
The enzymes were activated at 25 °C
in 100 mM Tris-HCl, pH 7.9 buffer, with 20 µM
E. coli thioredoxin reduced by 10 mM
dithiothreitol. Activity was measured on activated aliquots at 30 °C
by following the decrease in absorbance at 340 nm in a standard assay
mixture (1 ml) containing 100 mM Tris-HCl, pH 7.9, 780 µM oxaloacetate, and 140 µM NADPH or 140 µM NADH. The kinetic parameters were determined on
preactivated enzymes by varying the concentration of each substrate in
the assay mixture.
The activation kinetics were determined by measuring the activity of
aliquots taken at different time intervals after the addition of the
activation medium to the enzyme. For cofactor inhibition tests, the
activation medium was supplemented either with 1 mM
NAD+ or with 1 mM NADP+.
Disulfide Redox Potentials Determinations--
The redox
potentials of the disulfides of the WT and S85I/R87Q/S88A mutated
NADP-MDH have been determined as described in Ref. 15.
Oxidation-reduction equilibration was done using mixtures of oxidized
and reduced dithiothreitol and catalytic amounts of thioredoxin from
E. coli, and the activity of MDH samples pre-equilibrated at
defined redox potentials was assayed on aliquots as described above.
Molecular Graphics--
To investigate the interactions between
NAD+ and the mutated residues in the Sorghum MDH, a
hypothetical model was made. This was done using the coordinates of
both the apo-form of Sorghum NADP-dependent MDH (Protein
Data Bank code 7mdh) and coordinates of the holo-form of
NAD-dependent Thermus flavus MDH (Protein Data
Bank code 1bmd). To find an approximate orientation of the
NAD+ in the Sorghum structure, the two structures were
superposed using the molecular graphics program O (16). Further, the
residues corresponding to the mutations in the Sorghum MDH were
exchanged and positioned according to the positions of the
corresponding residues in the T. flavus structure. This was
also done using program O. Fig. 3 was drawn using the programs
Molscript (17) and Raster3D (18).
 |
RESULTS |
Choice of Mutations--
A number of studies designed to reverse
the catalytic specificity of dehydrogenases toward their cofactor have
already been performed. Most of them consisted of a reversal from NAD
to NADP (for reviews see Refs. 19 and 20). Based on these studies and
on sequence comparison between NAD- and NADP-dependent
malate or lactate dehydrogenases (21, 22), we have chosen to mutate four amino acids located at the putative nucleotide-binding site of
NADP-MDH. These residues are conserved among
NADPH-dependent malate dehydrogenases but are replaced by a
different set of conserved residues in NAD-dependent malate
dehydrogenases (Fig. 1). The study by
Nishiyama et al. (21) was particularly useful as a model for
cofactor specificity because it presented data for the enzyme that is
the closest in primary structure to the chloroplastic NADP-MDH, namely
the NAD-MDH from T. flavus. This study showed that a total
reversal of specificity toward NADPH required the substitution of a
seven-residue loop at the nucleotide-binding site. As a rule, most of
the other studies reached the conclusion that single mutations resulted
in mixed cofactor specificity. Thus, in our first mutant, three amino
acids were substituted at a time (mutant S85I/R87Q/S88A). Because the
cofactor specificity reversal was not perfect, we added a fourth
mutation (mutant G84D/S85I/R87Q/S88A) and checked also the effect of a
single G84D substitution on cofactor specificity for catalysis and for
inhibition of activation. The structural modifications resulting from
mutation of the four residues have been modeled and will be discussed
below (see Fig. 3 under "Discussion")

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Partial amino acid sequence alignment of
malate dehydrogenases cofactor-binding sites (adapted from Ref.
6). The five NADP-MDHs sequences are in the upper
part. The seven sequences in the lower part are
NAD-dependent MDHs. The conserved residues that were chosen
for mutation and their substitutes in NAD-MDH are in
bold.
|
|
The G84D, S85I/R87Q/S88A, and G84D/S85I/R87Q/S88A Mutants Are
Altered in Their Cofactor Specificity--
In the conventional
NADP-MDH purification protocol previously described (10), the Matrex
red A pseudoaffinity column, specific for NADP+-binding
proteins, is the most selective purification step, generally yielding
an almost homogeneous NADP-MDH preparation. This chromatographic material could also be successfully used for purification of the S85I/R87Q/S88A mutant. In contrast, the G84D and G84D/S85I/R87Q/S88A mutants displayed a weaker affinity for this column. The G84D mutant
behaved slightly differently from the wild type MDH in eluting earlier
in the salt gradient, and the G84D/S85I/R87Q/S88A mutant did not bind
the Matrex red A at all. The use of Matrex blue A or B supports,
specific for NAD-dependent enzymes, did not improve the
binding, thus additional purification steps were required to purify
these proteins to homogeneity. This suggested that the G to D mutation
is crucial for cofactor binding specificity. To further evaluate the
roles of the different mutated residues in cofactor specificity, the
kinetic parameters of each of the preactivated mutant proteins have
been determined, using either NADH or NADPH as a cofactor (Table
I).
View this table:
[in this window]
[in a new window]
|
Table I
Kinetic parameters of the wild type, S85I/R87Q/S88A, G84D, and
G84D/S85I/R87Q/S88A NADP-MDHs
These parameters were determined on a fully preactivated enzyme by
varying at the same time the concentrations of both substrates
(oxaloacetate and reduced cofactor). At least three independent series
of measurements were performed for each mutant. The values for overall
catalytic efficiency [kcat/(Km
OAA × Km cofactor)] and for the NADPH/NADH
activity ratios have been obtained by using the average
kcat and Km values.
|
|
The S85I/R87Q/S88A mutation yielded a protein exhibiting almost
identical Km for NADH and NADPH. This mutant also exhibited the same kcat values, regardless of
which cofactor was used. The equalization of Km
values for the two cofactors resulted from a 6-fold increase in the
Km for NADPH and a 4-fold decrease in the
Km for NADH. If we compare the overall catalytic
efficiencies, expressed as the ratios
kcat/(Km OAA × Km cofactor), this mutant protein was 85 times less
efficient than the wild type MDH with NADPH but 75 times more efficient
than the wild type MDH with NADH. The G84D mutation also led to a
protein exhibiting similar Km values for both
cofactors. However, the mutation did not modify the
Km for NADPH but lowered the Km
for NADH 10-fold. The overall catalytic efficiency of this mutant
protein was 7-fold higher with NADH than with NADPH, thus its catalytic
efficiency with NADH was equal to the catalytic efficiency of the wild
type protein with NADPH. A total reversal of the cofactor specificity
could be obtained by combining these two mutations in the mutant
G84D/S85I/R87Q/S88A. In this mutant, the Km values
for cofactors and catalytic efficiencies were exactly reversed compared
with the wild type NADP-MDH.
The interaction of the enzyme with its substrate, oxaloacetate, was
also affected by the cofactor specificity of the mutants. Indeed, for
the G84D and G84D/S85I/R87Q/S88A mutant proteins, the
Km for OAA decreased 6- and 200-fold, respectively when NADH was used as cofactor instead of NADPH. For each mutant, the
inhibition by excess OAA was retained, except for the
G84D/S85I/R87Q/S88A mutant for which the inhibitory concentrations of
OAA were shifted toward higher concentrations when NADPH was used as a
cofactor (data not shown) in accordance with the high
Km OAA of this mutant in these conditions.
The G84D, S85I/R87/S88A, and G84D/S85I/R87Q/S88A Mutant Proteins
Are Altered in Their Sensitivities to Inhibition by the Oxidized
Cofactors--
The activation kinetics of the mutant proteins have
been determined in the presence or in the absence of the oxidized
cofactor in the activation medium. Because the aliquot taken for
measuring the activity is small in volume (10 µl), the cofactor is
diluted 100-fold in the reaction medium and does not interfere with the activity measurement. First one can notice that the wild type, the
G84D, S85I/R87Q/S88A, and G84D/S85I/R87Q/S88A mutant proteins exhibited
the same activation kinetics, i.e. each of these proteins was fully activated within 10 min. Obviously, the mutations did not
perturb the activation process. The results of the activation assays in
the presence of either 1 mM NAD+ or 1 mM NADP+ are summarized in Fig.
2. Similar assays have also been done with NADH and NADPH as controls, and the reduced cofactors did not have
any effect on activation kinetics of any of the proteins (data not
shown). In the presence of the oxidized cofactors in the activation
medium, the activation kinetics of the G84D, S85I/R87Q/S88A, and
G84D/S85I/R87Q/S88A mutants differed from those of the wild type
protein with respect of cofactor specificity of the inhibitory effect.
Indeed, the activation of the wild type NADP-MDH was strongly inhibited
by NADP+ but very weakly inhibited by NAD+. In
contrast, the activation of each of the three mutated proteins was
almost insensitive to NADP+ (or even totally insensitive
when the G84D mutation was introduced either alone or in combination
with other amino acid substitutions) but became sensitive to
NAD+. Thus, the cofactor specificity of the inhibition of
the activation has been partially or completely reversed by the
mutations affecting the cofactor specificity for catalysis. The
inhibition results were the same whether the subsequent activity
determinations were done with NADH or with NADPH (data not shown).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Activation kinetics of the wild type
(a), G84D/S85I/R87Q/S88A (b), G84D
(c), and S85I/R87Q/S88A (d) NADP-MDH
with or without the oxidized cofactor present in the activation
medium. The activation was started by adding dithiothreitol
-reduced thioredoxin to the inactive enzyme either in the presence of 1 mM NADP+ ( ) or 1 mM
NAD+ ( ) or without any cofactor ( ). Aliquots (10 µl) were taken out at regular time intervals and injected into a
spectrophotometer cuvette containing the standard reaction medium (780 µM OAA and 140 µM NADPH) for activity
measurements. NADPH oxidation rate was measured as a decrease in
absorbance at 340 nm. For the G84D/S85I/R87Q/S88A mutated protein
(b) with totally reversed cofactor specificity, NADH was
used in the reaction medium instead of NADPH. 100% activity
corresponds respectively to 857 µmol (a), 104 µmol
(b) 205 µmol (c), and 388 µmol (d)
cofactor oxidized/mg protein/min. All of the enzymes are totally
inactive without activation.
|
|
 |
DISCUSSION |
Involvement of the Residues Gly84, Ser85,
Arg87, and Ser88 in Cofactor
Specificity--
All the studies aimed at changing the cofactor
specificity of dehydrogenases reached the conclusion that the
specificity depends on several interactions and that a total reversal
requires the mutation of several residues (19, 20). Compared with the
results of Nishiyama et al. (21), which showed that a
reversed specificity in favor of NADPH required the substitution of a
seven-residue loop in T. flavus NAD-malate dehydrogenase
nucleotide-binding site, our study shows that replacing the residues
Ser85, Arg87, and Ser88 of NADP-MDH
by the corresponding residues of T. flavus NAD-MDH and
residue Gly84 by an aspartate, the most commonly found
residue at this position in the NAD-dependent forms,
yielded a mutant protein G84D/S85I/R87Q/S88A exhibiting a completely
reversed cofactor specificity.
The single G84D mutation resulted in a 10-fold lower
Km for NADH, whereas the Km for
NADPH remained unchanged. This result suggests that the aspartate
residue favors the interaction with NADH but has no effect on NADPH
positioning. In similar studies on some NADH-dependent
dehydrogenases, namely lactate dehydrogenase (Ref. 23; mutation D52S)
or NAD-MDH (Ref. 21; mutation D41G/I42S/A45S), when the homologous
aspartate was mutated into a serine or a glycine, an effect on both
Km and efficiency in NADH use was obtained, whereas
the kinetic parameters for NADPH remained almost unchanged. In the
structure of the NADH-lactate dehydrogenase complex, the aspartate was
shown to hydrogen bond to the 2'- and 3'-OH of the adenosine ribose.
The modeled structure of the mutated NADP-MDH (Fig.
3) suggests that a similar interaction
between the introduced Asp84 and the 2' and 3' hydroxyl of
NAD+ could also occur. Thus, the G84D mutation could
provide a stabilization for NAD+, which would not occur
with NADP+ because of steric hindrance of the phosphate
group. However, studies on other NAD+-dependent
dehydrogenases such as yeast alcohol dehydrogenase I (Ref. 24; mutation
D223S) or glyceraldehyde phosphate dehydrogenase (Ref. 25; mutation
D32A) suggested that the negative charge of aspartate could repel the
2'-phosphate group of the ribose of NADPH. Recent structural studies on
Flaveria NADP-MDH with NADP+ bound (7) also
suggest that substitution of an aspartate residue at position 84 for
the glycine that normally occupies this position in the
NADP-dependent dehydrogenases would introduce sufficient steric hindrance to prevent NADPH binding by the protein. This prediction was not confirmed by our biochemical results. In the G84D
mutant protein the Km for NADPH remained unchanged. This suggests that NADP+ is bound at the active site of the
mutated protein in a different conformation than that shown for
NAD+ in our model (Fig. 3) or adopted by bound
NADP+ in the structure of Flaveria MDH (Protein
Data Bank code 1CIV). It has been reported (19) that the conformation
of bound NAD+ is conserved in dehydrogenases, whereas bound
NADP+ can adopt a variety of conformations.

View larger version (100K):
[in this window]
[in a new window]
|
Fig. 3.
Model of the G84D/S85I/R87Q/S88A mutated
NADP-MDH. The residues corresponding to mutations in the Sorghum
MDH structure (Protein Data Bank code 7mdh), annotated G84D, S85I,
R87Q, and S88A, were positioned according to the corresponding
positions in the T. flavus structure (Protein Data Bank code
1bmd). The NAD (light gray) is taken from the T. flavus structure and has been positioned by superimposing the
T. flavus NAD-MDH and the oxidized Sorghum NADP-MDH
structures. The C-terminal extension is dark gray. Its last
two residues Val389 and Glu388 are represented.
The Glu388 is interacting with the positively charged C4 of
the nicotinamide ring. The catalytic residues His229 and
Asp201 are also represented.
|
|
The S85I/R87Q/S88A mutation caused a 7-fold increase in the
Km for NADPH and a 4-fold decrease in the
Km for NADH. We suggest that the loss of specificity
toward NADPH is linked to the loss of residues able to stabilize the
phosphate group, either by hydrogen bonding (serine residues) or by
electrostatic interaction (arginine residue). Several studies on
dehydrogenases have previously demonstrated similar effects linked to
the mutation of the arginine of the cofactor-binding site. This
arginine is considered to be the only largely conserved structural
feature in NADP-dependent dehydrogenases (19). Indeed, on
the basis of structural and mutagenesis data, an equivalent arginine
residue of the dual coenzyme specificity glucose-6-phosphate
dehydrogenase was shown to be involved in binding NADP+ but
not NAD+ via the adenosine 2'-phosphate (26). The
replacement of this arginine yielded a protein with a
Km for NADPH that was increased by a factor of 750, whereas its Km for NADH was decreased by a factor of
7. Another study on a nonhomologous dehydrogenase, glutathione
reductase (27), showed that two arginine residues could be very
important for NADPH specificity through the binding of the 2'-phosphate
group of NADPH. The mutation of these arginines yielded a protein with
a 15-fold increased Km for NADPH and a 4-fold
decreased Km for NADH. On the other hand, several
studies have shown that the serines belonging to the cofactor-binding
sites of oxidoreductases were also involved in the cofactor specificity
probably through hydrogen bonding to the adenosine 2'-phosphate of the
cofactor. For example, a S212D mutation of cinnamyl alcohol
dehydrogenase showed that this serine residue interacted directly with
the adenosine 2'-phosphate. Indeed, the mutation yielded a protein with
an increased Km for NADPH but with an unchanged
Km for NADH (28). Thus, combining mutations that
stabilize NADH binding with mutations that disfavor the stabilization
of 2'-phosphate of NADPH yields a mutated protein with a cofactor
specificity that is strikingly shifted toward the use of NADH instead
of NADPH.
Cofactor Binding Influences Km for Oxaloacetate--
Another interesting feature of the kinetic parameters of the
G84D, S85I/R87Q/S88A, and G84D/S85I/R87Q/S88A mutated proteins is the
correlation between the Km values for the substrate (OAA) and for the cofactor. Whether the cofactor used is NADH or NADPH,
the mutant with the lowest Km for the cofactor also
exhibits the lowest Km for OAA. For example,
compared with the wild type protein, the G84D mutated protein has a
10-fold lower Km for NADH and also a 10-fold lower
Km for OAA. Similarly, the S85I/R87Q/S88A mutated
protein has a 7-fold higher Km for NADPH and a
6-fold higher Km for OAA. This parallelism is even
more striking in the G84D/S85I/R87Q/S88A mutated protein. A similar
relationship has been reported for T. flavus MDH (20). This
correlation suggests that the binding of the specific cofactor might
facilitate substrate binding and, thus, that binding mechanism might be
sequential, i.e. that the cofactor binds first, allowing
subsequent OAA binding.
Cofactor Specificity Is Correlated with the Specificity of the
Inhibition of Activation--
In the absence of the cofactor in the
activation medium, the classical slow activation kinetics of NADP-MDH
are retained for the mutants having changed cofactor specificity (full
activation within 10 min). When the oxidized cofactor is present in the
activation medium, a parallel between the cofactor catalytic
specificity and its ability to inhibit activation is observed. This
effect is particularly striking with the G84D/S85I/R87Q/S88A mutant
protein (Fig. 2), where cofactor specificity is totally reversed. This result confirms that in the oxidized enzyme, both oxidized and reduced
forms of the cofactor bind to the same site. Previous observations
showing that the inhibitory effect of NADP+ disappeared
upon the elimination of the C-terminal disulfide (9) or the mutation of
the penultimate C-terminal glutamate to a glutamine (5) indicated that
the inhibitory effect was somehow associated with the C-terminal end of
the enzyme and more specifically with the presence of the C-terminal
disulfide. This inhibitory effect could not be accounted for by a
direct effect of the oxidized cofactor on the redox potential of the
C-terminal disulfide given that recent determinations of the redox
potentials of the disulfides of NADP-MDH (15) showed that the oxidized cofactor did not have any significant effect on the redox potential required for the activation of the WT protein. Because it could be
demonstrated that this potential reflects the redox potential of the
most electronegative C-terminal disulfide, one could conclude that
NADP+ binding does not affect the oxidation-reduction
midpoint potential (Em) value of the C-terminal
regulatory disulfide (15). Furthermore, as part of the current study,
we have performed a determination of the redox potential of the
C-terminal disulfide of the S85I/R87Q/S88A mutant and did not find any
difference between the redox potential of the WT enzyme and of the
mutant within the ± 10 mV uncertainty of the measurement (
338
mV for the mutant, versus
330 mV for the WT protein at pH
7; data not shown). In the light of the most recent structural data (6,
7), and of the aforementioned site-directed mutagenesis results, the
effect of the oxidized cofactor can be better explained by its direct
electrostatic interaction with the C-terminal extension and, more
specifically, with its penultimate glutamate residue. Indeed, in the
oxidized form of the enzyme, the C-terminal end is trapped inside the
active site and thus located in close proximity of the positively
charged nicotinamide ring of the cofactor (6, 7). Modeling the
NAD+ position in our totally reversed cofactor specificity
mutant (Fig. 3) suggests an identical situation in the mutant with the C terminus sufficiently close to the positively charged nicotinamide ring of NAD+ to allow the penultimate Glu388
residue to form a direct electrostatic interaction with it. In the
three-dimensional structure of the oxidized NADP+-free
Sorghum enzyme, this penultimate glutamate occupies different positions
in the different subunits of the dimeric enzyme (Protein Data Bank code
7mdh),2 indicating that it is
flexible in the absence of cofactor. In one subunit, both carbonyl
oxygens of the glutamate side chain are hydrogen bonded to the active
site histidine in the same manner as seen in the structure of the
enzyme containing bound NADP+ (7). In the other subunit,
the side chain clearly has a different orientation, pointing more
toward Arg204. This flexibility is probably reduced in the
holo-enzyme where the negatively charged glutamate, in addition to
forming hydrogen bonds to the active site histidine, interacts with the
positive charge of the nicotinamide ring of the cofactor (7). The
interaction with the cofactor would improve the efficiency of binding
of the C-terminal end inside the active site. As a consequence, the
efficiency of inhibition of activation by the oxidized cofactor should
be directly correlated with its correct positioning, hence with its catalytic efficiency.
Our experimental results on the fully reversed cofactor specificity
mutant are in total agreement with this conclusion. However, some
modulation of this conclusion must be introduced in view of the results
obtained with the partially reversed cofactor specificity mutants
S85I/R87Q/S88A and G84D. In these mutants, the cofactor specificity for
inhibition is more pronounced than its catalytic specificity, the
mutant enzymes displaying similar (but not optimal) Km values for both cofactors. It can be hypothesized that in these mutants, the positioning of NADP+ with
respect to the C terminus of the enzyme is such that in contrast to
NAD+, it cannot make a strong interaction with E388. This
hypothesis is supported by the observation of Carugo and Argos (19) on the variability of the conformations that NADP+ can adopt
at its binding sites.
We observed that in the presence of the oxidized cofactor the
activation was drastically slowed down but not totally blocked. However, the maximal activation level was never reached within the time
range of biochemical experiments based on activity measurements (maximum duration, 1 h; data not shown). On the other hand, the effect of NADP+ was assayed recently during preliminary
experiments where the release of the C-terminal end upon reduction was
monitored by NMR (8).3 The
presence of NADP+ did not prevent the release of the
C-terminal end within the time range of NMR data collection (24 h).
This suggests that NADP+ does not prevent the reduction of
the C-terminal disulfide but instead delays the release of the
C-terminal end from the active site.
 |
ACKNOWLEDGEMENTS |
We thank Dr. E. Issakidis-Bourguet,
Professors H. Eklund and J-M. Lancelin for helpful discussions.
 |
FOOTNOTES |
*
This work was supported in part by grant DE-FG03-99ER20346
from the United States Department of Energy (to D. B. K.) and
a joint CNRS/United States National Science Foundation Grant (to D. B. K., M. H., M. M. M., and J.-P.
Jacquot).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
To whom correspondence should be addressed. Tel.: 33-1-69-33-63-39;
Fax: 33-1-69-33-64-23; E-mail: miginiac@ibp.u-psud.fr.
Published, JBC Papers in Press, May 3, 2000, DOI 10.1074/jbc.M002066200
2
K. Johansson, unpublished results.
3
I. Krimm, and J-M. Lancelin, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
NADP-MDH, NADP-malate dehydrogenase;
NAD-MDH, NAD-malate dehydrogenase;
OAA, oxaloacetate;
WT, wild type;
PCR, polymerase chain reaction;
FPLC, fast
protein liquid chromatography.
 |
REFERENCES |
| 1.
|
Ruelland, E.,
and Miginiac-Maslow, M.
(1999)
Trends Plant Sci.
4,
136-141
|
| 2.
|
Ashton, A. R,
and Hatch, M. D.
(1983)
Arch. Biochem. Biophys.
227,
416-424
|
| 3.
|
Scheibe, R.,
and Jacquot, J.-P.
(1983)
Planta
157,
148-153
|
| 4.
|
Ruelland, E.,
Lemaire-Chamley, M.,
Le Marechal, P.,
Issakidis-Bourguet, E.,
Djukic, N.,
and Miginiac-Maslow, M.
(1997)
J. Biol. Chem.
272,
19851-19857
|
| 5.
|
Ruelland, E.,
Johansson, K.,
Decottignies, P.,
Djukic, N.,
and Miginiac-Maslow, M.
(1998)
J. Biol. Chem.
273,
33482-33488
|
| 6.
|
Johansson, K.,
Ramaswamy, S.,
Saarinen, M.,
Lemaire-Chamley, M.,
Issakidis-Bourguet, E.,
Miginiac-Maslow, M.,
and Eklund, H.
(1999)
Biochemistry
38,
4319-4326
|
| 7.
|
Carr, P. D.,
Verger, D.,
Ashton, A. R.,
and Ollis, D. L.
(1999)
Structure
7,
461-475
|
| 8.
|
Krimm, I.,
Goyer, A.,
Issakidis-Bourguet, E.,
Miginiac-Maslow, M.,
and Lancelin, J. M.
(1999)
J. Biol. Chem.
274,
34539-34542
|
| 9.
|
Issakidis, E.,
Saarinen, M.,
Decottignies, P.,
Jacquot, J.-P.,
Cretin, C.,
Gadal, P.,
and Miginiac-Maslow, M.
(1994)
J. Biol. Chem.
269,
3511-3517
|
| 10.
|
Issakidis, E.,
Miginiac-Maslow, M.,
Decottignies, P.,
Jacquot, J.-P.,
Crétin, C.,
and Gadal, P.
(1992)
J. Biol. Chem.
267,
21577-21583
|
| 11.
|
Crétin, C.,
Luchetta, P.,
Joly, C.,
Decottignies, P.,
Lepiniec, L.,
Gadal, P.,
Sallantin, M.,
Huet, J.-C.,
and Pernollet, J.-C.
(1990)
Eur. J. Biochem.
192,
299-303
|
| 12.
|
Studier, F.,
and Moffat, B.
(1986)
J. Mol. Biol.
189,
113-130
|
| 13.
| Sanger F., Nicklen S., and Coulson A. R. (1977) Proc. Natl.
Acad. Sci. U. S. A. 74,
|
| 14.
|
Schäger, H.,
and von Jagow, G.
(1987)
Anal. Biochem.
166,
368-379
|
| 15.
|
Hirasawa, M.,
Ruelland, E.,
Schepens, I.,
Issakidis-Bourguet, E.,
Miginiac-Maslow, M.,
and Knaff, D. B.
(2000)
Biochemistry
39,
3344-3350
|
| 16.
|
Jones, T. A.,
Zou, J. Y.,
Cowan, S. W.,
and Kjeldgaard, M.
(1991)
Acta Crystallogr.
47,
110-119
|
| 17.
|
Kraulis, P. J.
(1991)
J. Appl. Cryst.
24,
946-950
|
| 18.
|
Merritt,
and Bacon.
(1997)
Methods Enzymol.
277,
505-524
|
| 19.
|
Carugo, O.,
and Argos, P.
(1997)
Proteins
28,
10-28
|
| 20.
|
Carugo, O.,
and Argos, P.
(1997)
Proteins
28,
29-40
|
| 21.
|
Nishiyama, M.,
Birktoft, J. J.,
and Beppu, T.
(1993)
J. Biol. Chem.
268,
4656-4660
|
| 22.
|
Goward, C. R.,
and Nicholls, D. J
(1994)
Protein Sci.
10,
1883-1888
|
| 23.
|
Feeney, R.,
Clarke, A. R.,
and Holbrook, J. J.
(1990)
Biochem. Biophys. Res. Commun.
166,
667-672
|
| 24.
|
Fan, F.,
Lorenzen, J. A.,
and Plapp, B. V.
(1991)
Biochemistry
30,
6397-6401
|
| 25.
|
Clermont, S.,
Corbier, C.,
Mely, Y.,
Gerard, D.,
Wonacott, A.,
and Branlant, G.
(1993)
Biochemistry
32,
10178-10184
|
| 26.
|
Levy, H. R.,
Vought, V. E.,
Yin, X.,
and Adams, M. J.
(1996)
Arch. Biochem. Biophys.
326,
145-151
|
| 27.
|
Scrutton, N. S.,
Berry, A.,
and Perham, R. N.
(1990)
Nature
343,
38-43
|
| 28.
|
Lauvergeat, V.,
Kennedy, K.,
Feuillet, C.,
McKie, J. H.,
Gorrichon, L.,
Baltas, M.,
Boudet, A. M.,
Grima-Pettenati, J.,
and Douglas, K. T.
(1995)
Biochemistry
34,
12426-12434
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Watanabe, T. Kodaki, and K. Makino
Complete Reversal of Coenzyme Specificity of Xylitol Dehydrogenase and Increase of Thermostability by the Introduction of Structural Zinc
J. Biol. Chem.,
March 18, 2005;
280(11):
10340 - 10349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Lemaire, A. Quesada, F. Merchan, J. M. Corral, M. I. Igeno, E. Keryer, E. Issakidis-Bourguet, M. Hirasawa, D. B. Knaff, and M. Miginiac-Maslow
NADP-Malate Dehydrogenase from Unicellular Green Alga Chlamydomonas reinhardtii. A First Step toward Redox Regulation?
Plant Physiology,
February 1, 2005;
137(2):
514 - 521.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Schepens, E. Ruelland, M. Miginiac-Maslow, P. Le Marechal, and P. Decottignies
The Role of Active Site Arginines of Sorghum NADP-Malate Dehydrogenase in Thioredoxin-dependent Activation and Activity
J. Biol. Chem.,
November 10, 2000;
275(46):
35792 - 35798.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.