 |
INTRODUCTION |
The human immunodeficiency virus
(HIV)1 transactivator Tat is
an 86-101-amino acid protein that is a potent transcriptional activator of expression of all HIV proteins, including Tat itself. Tat
expression is essential for HIV viral replication, because Tat
defective viruses are unable to replicate or express viral proteins
efficiently (1, 2). The Tat-responsive region of the HIV LTR has been
mapped to an element immediately downstream of the transcription start
site (3, 4). Tat is unusual in that it is targetted to the promoter by
binding to a 59-nucleotide stem-loop structure in the nascent RNA
called the transactivation-responsive (TAR) element, which is found at
the 5' end of all HIV viral RNAs (5-8). Although Tat has been
demonstrated to have effects on transcriptional initiation (9), it
differs from conventional activators in that its primary effect appears
to be on transcriptional elongation (9-11). In the absence of Tat,
short prematurely terminated RNA transcripts are produced, but Tat
appears to modify RNA polymerase II to a form that elongates more
efficiently (12).
Recently a mechanism has been established to explain how Tat promotes
transcriptional elongation. Phosphorylation of the C-terminal domain of
RNA polymerase II by cellular kinases marks the transition from an
initiation complex to an efficiently elongating polymerase complex, and
a primary role of Tat appears to be to recruit such kinases. Tat
targets two cyclin-dependent kinases, cdk7, the kinase component of TFIIH, and cdk9, the kinase component of positive transcription elongation factor b (pTEFb), which together are proposed
to hyperphosphorylate RNA polymerase II (reviewed in Refs. 13 and 14).
Tat, through its activation domain, interacts with the general
transcription factor, TFIIH (15), and stimulates the phosphorylation of
the C-terminal domain of RNA polymerase II by its kinase component,
cdk7 (16, 17). Similarly, the activation domain of Tat interacts with
the cyclin T component of pTEFb, forming a complex with high affinity
for the TAR element and recruiting the cdk9 component of pTEFb, which
can phosphorylate RNA polymerase II (18-20). It is therefore proposed
that Tat stimulates hyperphosphorylation of RNA polymerase II by
recruiting cdk7 and cdk9 and thus creates a highly efficient and
processive RNA polymerase II complex.
However, Tat has been shown to interact with a wide range of cellular
proteins, and it is unclear how these interactions fit into the above
model of Tat transactivation. For example, Tat is found complexed to
components of the basal machinery such as the core RNA polymerase II
itself (21, 22), the TATA-binding protein (TBP) subunit of TFIID (23,
24), and the TFIID associated factor, TAFII55 (25).
Replication of the HIV virus is regulated by both viral and cellular
proteins, and Tat also functions in concert with cellular transcription
factors, which bind to and activate the HIV LTR. For example, the core
region of the HIV LTR contains three SP1-binding sites. Tat, via its
basic domain, interacts with SP1 (26), and this interaction has been
shown to enhance phosphorylation of SP1 by double-stranded
DNA-dependent protein kinase (DNA-PK) (27). The
phosphorylation of SP1 has been correlated to enhanced HIV LTR
function. The enhancer region of the HIV LTR contains binding sites for
transcription factors such as NF-KB, nuclear factor of activated T
cells, and activator protein 1. This region includes a tandem NF-KB
repeat, which is essential for viral replication and gene expression
(28). Maximal activation of the HIV LTR results from the co-operative
actions of Tat and the NF-KB proteins, which bind to these elements
(29). In contrast the transcription factor nuclear factor of activated T cells, which has been shown to compete with NF-KB for occupancy of
these sites, interacts directly with the N-terminal region of Tat and
represses Tat activation of the HIV LTR (30). Furthermore, Tat via its
basic domain has been shown to interact with the transcriptional coactivators p300 and CREB-binding protein (31, 32), which may serve to
complex Tat with the basal transcription machinery. These coactivators
are also associated with histone acetylation and chromatin remodelling.
Other cellular cofactors may also interact with Tat and mediate
interactions with the transcription machinery or enhancer complex. In
fact, there are presently several other cellular proteins of unknown
function that have been isolated as Tat interactors (33-36).
We used the yeast two-hybrid system to screen for cellular proteins in
CD28 activated T cells that might interact with Tat and modulate its
function. There is recent evidence that Tat may modify T cell gene
expression through the CD28 costimulatory receptor signaling pathway
(37, 38), and therefore CD28 activated cells may have unique
Tat-interacting proteins. We isolated a transcriptional cofactor known
as PC4 (positive cofactor 4) in
this screen. We have demonstrated a specific interaction between Tat
and PC4 and identified the regions of the proteins involved. In
addition we have shown a functional consequence of this interaction on
transcription from the HIV LTR.
| |
EXPERIMENTAL PROCEDURES |
Plasmids--
Yeast two-hybrid plasmids, pEG202, pSH18-34,
pJG4-5 and the yeast strain EGY48 were donated by Dr. R. Brent and
have been described previously (39). Tat (amino acids 1-86) was
amplified by PCR from the clone pCDM-Tat (40) and ligated into pEG202 in frame and C-terminal to the LexA DNA-binding domain, using EcoRI and XhoI sites generated in the PCR,
forming pEG-Tat86. Similarly, Tat86 was ligated into pGEX-4T-1
(Amersham Pharmacia Biotech), in frame with the bacterial glutathione
S-transferase (GST) gene to generate the plasmid pGEX-Tat86.
The deletion constructs GST-Tat 1-48, 49-86, and 1-57 were generated
similarly, by cloning the respective PCR products into pGEX-4T-1.
GST-Tat Basic and Tat 1-57Basic were generated using PCR products
amplified from pDex-Tat K/R (50-57)G, which has been described
previously (41). pGEX-Myb was provided by Dr. T. Gonda and has been
described previously (pGEX2TK-NRD2, 42).
PC4 cDNA was released from the library vector pJG4.5 by digestion
with EcoRI and XhoI and ligated into the
eukaryotic expression vector pSG5 (Stratagene) to generate SG5-PC4. PC4
was amplified by PCR and cloned into pSG5 in the reverse orientation to
generate SG5-
PC4. The N-terminal 1-62 amino acids and C-terminal
63-127 amino acids of PC4 (see Fig. 1) were amplified by PCR from
pJG-PC4 and ligated into RcCMV (Invitrogen) to generate the constructs CMV-PC4NT and CMV-PC4CT, respectively. Tat86 was amplified by PCR from
pCDM-Tat and ligated into RcCMV in frame and N-terminal to a synthetic
influenza hemagglutinin (HA) tag using HindIII and
SacII sites generated by the PCR to produce the construct CMV-TatHA. PC4 was amplified from pJG-PC4 and ligated into RcCMV in
frame and N-terminal to a synthetic c-Myc tag to produce the construct
CMV-PC4Myc. The PC4 bacterial expression plasmid pet11a PC4WT and
derivatives have been described previously (43). Lysine mutants were
generated using the following oligonucleotides: K23E/K26E (GGAATTCCATATGGACGAAAA GTTAGA GAGGAAAA) and K24E/K28E
(GGAATTCCATATGGACAAAGAGTTAAAGAGGGAAA). The bacterial expression
plasmids pBAD-PC4, 43-127, 31-127, and 1-62 (see Fig. 1) were
generated by cloning the respective PCR products into
pBAD/Myc-HisB (Invitrogen) N-terminal and inframe with the
Myc-His tag.
The scanning PC4 mutants that replace 6 wild type amino acids with the
sequence AAASAA where constructed using a PCR technique (44). Briefly,
two external primers were designed complementary to the pBad-PC4
plasmid, 5' and 3' to the PC4 insert and containing a BstEII
and XbaI restriction site, respectively. For each mutant two
internal primers were designed. The primer for the 5' product contained
gcg, 6 bases forming a NheI site (gctagc), ggcagc, and 15 bases complementary to the PC4 sequence. The primer for the 3' product
contained cgc, 6 bases forming a NheI site (gctagc), gctgct
and 15 bases complementary to the PC4 sequence. Using the appropriate
external and internal primer, the two products were generated by PCR,
cleaved with BstEII and NheI or NheI
and XbaI, gel purified, and ligated together. The
full-length product was then gel purified and ligated into a
BstEII/XbaI-digested pBad vector. The HIV LTR
reporter construct (pHIVluc) was generated by cloning 
453 to +80 of
the HIV LTR into the HindIII and XhoI sites of
the luciferase reporter pXp1.
cDNA Library Construction--
Jurkat T cells were
stimulated for 9 h with 20 ng/ml PMA, 1 µM calcium
ionophore A23187 (Roche Diagnostics), and a 1:10,000 dilution of
-CD28 ascites (Bristol Myers Squibb). Total RNA was isolated by a
modification of the method of Chomczynski and Sacchi (45). Briefly,
cells were lysed in guanidinium solution (4 M guanidinium
thiocyanate, 25 mM sodium citrate, pH 7, 0.5% sarcosyl, 0.1 M 
-mercaptoethanol), phenol/chloroform extracted,
ethanol precipitated, and dissolved in DEPC-treated water.
Poly(A)+ mRNA was isolated using the Dynabeads mRNA
purification kit (DYNAL), according to the manufacturers instructions.
A cDNA library was prepared by a modification of the method of
Gubler and Hoffman (46). Briefly, oligo(dT) primers incorporating a
XhoI restriction site were hybridized to the mRNA, and
the first strand was synthesized using MMLV reverse transcriptase
(Supercript II, Life Technologies, Inc.) and dNTP mix including
5-methyl-dCTP rather than dCTP. The RNA was removed and second strand
generated using RNaseH and Escherichia coli DNA polymerase
I. The cDNA was blunt-ended using Vent DNA Polymerase and
EcoRI adaptors (Promega) ligated onto the blunt ends. The
cDNA was digested with XhoI, with any internal
XhoI sites being protected by 5-methyl-dCTP incorporation,
and ligated into the vector pJG4.5 at the unique EcoRI and
XhoI restriction sites.
Yeast Two-hybrid Screening--
A yeast two-hybrid screen was
performed as detailed elsewhere (47). Briefly, the yeast strain EGY48
(ura3 trp1 his3 3LexA-operator-LEU2) was
cotransformed by the lithium acetate method, with pEG-Tat86 and the
LacZ reporter pSH18-34, which contains eight LexA operator-binding sites (LexAop). The yeast were then transformed with the
pJG4.5 activated Jurkat T cell cDNA library and plated onto
galactose-containing minimal medium. 74 Leu+ colonies were replica
plated onto -galactosidase assay plates containing galactose or
dextrose as the carbon source. Of these, 17 colonies that demonstrated
-galactosidase activity on galactose- but not dextrose- containing
medium were further characterized. Plasmid DNA was isolated from these
colonies transformed into MC1061 E. coli by electroporation,
and the plasmid DNA was subsequently isolated from ampicillin-resistant
colonies. Rescued library plasmids were transformed back into EGY48
with the Tat86 bait to confirm an interaction and also with unrelated
baits to test for specificity. Clones that specifically interacted with pEG-Tat86 were sequenced using the ABI PRISM Dye terminator Cycle Sequencing protocol (Perkin-Elmer).
Binding Assays--
BL21 E. coli were transformed
with pGEX constructs. Expression of fusion proteins was induced in
exponentially growing bacteria with 0.1 mM
isopropyl-1-thio--D-galactopyranoside for 4 h at 37 °C. GST proteins were purified from cell lysates using
glutathione-Sepharose (Amersham Pharmacia Biotech) according to the
manufacturer's instructions. Protein concentrations were determined by
SDS-PAGE, using bovine serum albumin as a standard.
BL21(DE3) E. coli were transformed with pET11a-PC4 plasmids.
Expression of PC4 proteins was induced as above. Alternatively, TOP10
E. coli were transformed with pBAD-PC4 plasmids and
expression of PC4 proteins induced with 0.02% arabinose. Bacterial
cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 10% glycerol) by
sonication, and cell debris was removed by centrifugation at
13,000 × g. Transfected COS-7 cells were released from
flasks with 0.1 mM EDTA in phosphate-buffered saline and
incubated in lysis buffer for 30 min, and cell debris was removed by
centrifugation at 13,000 × g.
Binding assays were performed for 1 h at 4 °C in lysis buffer
containing 0.1 mg/ml bovine serum albumin using 10 µg of GST proteins
bound to Sepharose beads and 20 µl of cell lysate containing approximately 1 µg of PC4 protein. The Sepharose beads were washed in
lysis buffer, and bound complexes were eluted by boiling in SDS-PAGE
load buffer. Proteins were resolved by SDS-PAGE in 15% polyacrylamide,
transferred to nitrocellulose for 16 h and subjected to Western
analysis using anti-PC4 antibodies (rabbit polyclonal) or anti-Myc
antibodies (monoclonal, 9E10).
Phosphorylation Studies--
Cell lysates containing
approximately 1 µg of PC4 were treated with 10 units alkaline
phosphatase (calf intestinal alkaline phosphatase, New England Biolabs)
in phosphatase buffer (New England Biolabs) for 30 min at 37 °C in a
20-µl reaction. Alternatively, lysates were treated with 1 unit of
casein kinase II (New England Biolabs) in CKII buffer (New England
Biolabs) for 30 min at 30 °C.
Transfections and Luciferase Assays--
Human Jurkat T cells
were cultured in RPMI supplemented with 10% fetal calf serum. Jurkat T
cells (4.5 × 106 cells in 300 µl of RPMI
supplemented with 20% fetal calf serum) were transfected by
electroporation using a Bio-Rad Gene Pulser II at 280 V and a
capacitance of 975 microfarads. In all transfections 5 µg of reporter
plasmid was used, and varying amounts of expression constructs were
equalized by addition of parent plasmids, pSG5, or RcCMV. Cells were
stimulated with a final concentration of 20 ng/ml PMA and 1 µM calcium ionophore at 24 h post transfection. For
HIV LTR transfections, 1 × 105 cells were aliquotted
into 96-well trays before stimulation.
Luciferase assays were performed according to the previously published
method (48). Light emission was measured using a Packard Top Count
Luminescence Counter.
COS-7 cells were cultured in RPMI supplemented with 10% fetal calf
serum. COS cells were released from flasks with trypsin, washed in
phosphate-buffered saline, and resuspended in 0.8 ml of
phosphate-buffered saline. Cells were transfected by electroporation at
280 V and a capacitance of 500 microfarads. COS cells were transfected
with a total of 20 µg of expression plasmids.
Coimmunoprecipitation--
Transfected COS cells (1 × 106) were lysed 48 h post transfection in 0.4 ml of
lysis buffer (25 mM Tris, pH 7.4, 150 mM NaCl, 10% glycerol, 1% Nonidet P-40) containing protease inhibitors (10 µg/ml leupeptin, 2 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin). Lysates were precleared for 1 h by incubation
with 50 µl of 50% Sepharose CL4B slurry. Proteins were
immunoprecipitated for 16 h with 100 µl of 50%
anti-HA-Sepharose slurry. After washing in lysis buffer, proteins were
subjected to SDS-PAGE and analyzed by Western blotting. Proteins were
detected using ECL (Amersham Pharmacia Biotech) and visualized by
autoradiography. Alternatively, for quantitation proteins were
visualized using the Fuji luminescent image analyzer (LAS-1000 plus)
and quantitated using the Fuji Image Gauge software.
| |
RESULTS |
Tat Interacts with the Coactivator PC4--
The yeast two-hybrid
system was used to screen for Tat-interacting proteins expressed in
activated Jurkat T cells. A Tat bait construct (pEG-Tat86) was
generated in the vector pEG202 to produce a fusion protein comprising
the first 86 amino acids of HIV Tat as a C-terminal fusion to a LexA
DNA-binding domain. The bait was targeted to LexA DNA-binding sites
upstream of the endogenous LEU2 gene in the yeast strain EGY48
(ura3 trp1 his3 3LexA-operator-LEU2) and also
upstream LexA DNA-binding sites of the LacZ reporter construct,
pSH18-34. Target proteins encoded by a cDNA library were expressed
as fusion proteins to an "acid blob" activation domain under the
control of a GAL1 promoter. Interaction of the bait and a target
protein activated the endogenous LEU2 gene, detected by growth of yeast
on leucine-deficient medium and activation of the LacZ reporter, which
was visualized by a -galactosidase assay.
A cDNA library was generated in the vector pJG4.5 from Jurkat T
cells activated with PMA, calcium ionophore and an anti-CD28 antibody.
This expression library was screened for proteins that interacted with
the Tat86 bait. Three distinct clones were detected that interacted
with the Tat86 bait but did not interact with several nonrelated baits,
including a Drosophila bicoid protein bait and baits
generated from human c-Rel cDNA. The cDNAs encoding the
interacting proteins were recovered from the yeast and sequenced. A
clone that represented a particularly strong Tat interactor as assessed
by -galactosidase activity was found to be a full-length cDNA
clone of the previously characterized transcriptional coactivator, PC4 (Refs. 49 and 43 and Fig. 1). PC4 is
a 127-amino acid bipartite protein (Fig. 1). The N-terminal region of
PC4 (amino acids 1-62) contains two serine-enriched acidic (SEAC)
domains (43, 49), whereas the C-terminal region of the protein (amino acids 63-127) contains a single-stranded DNA-binding motif (50). A
lysine-rich region, which may be involved in the nonsequence specific
binding of PC4 to double-stranded DNA, is situated between the 2 SEAC
domains in the N-terminal region of the protein (50). PC4 has been
demonstrated to function as a coactivator for a range of
transcriptional activators in in vitro transcription
systems. It has been suggested that PC4 may act as an adaptor type
molecule linking activators with the preinitiation complex because PC4 has been shown to interact with both transcription factors and components of the basal transcription machinery (e.g.
TFIIA). Therefore, PC4 is a candidate for a Tat coactivator involved in the interaction of Tat with the basal transcription machinery.
View larger version (39K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic representation of PC4. The
SEAC, lysine-rich (K-rich), and single-stranded DNA-binding
regions (SSDNA binding) are indicated. The PC4 and PC4Myc
tagged deletion mutants used in this study are illustrated. The amino
acid numbers that define the protein domains are shown above. The
protein sequence of amino acids 23-62 is indicated below. The scanning
mutant constucts used in this study are indicated. Lysine residues that
are mutated to glutamic acid residues are indicated by
asterisks.
|
|
A Specific Protein Interaction between Tat and PC4 Can Be
Demonstrated in Vitro--
To confirm the interaction between Tat and
PC4, binding assays were performed between a GST-Tat protein expressed
in bacteria and subsequently immobilized on glutathione-Sepharose beads
and a bacterially expressed PC4 protein. Western analysis of E. coli lysates using an anti-PC4 antibody revealed a 16-kDa protein
(Fig. 2A, lane 1).
This PC4 protein bound to the GST-Tat fusion protein (Fig.
2A, lane 3) but did not bind to a GST protein
alone or to a GST-Myb fusion protein (Fig. 2A, lanes
2 and 4, respectively). The presence of GST fusion
proteins in the binding studies was confirmed by reprobing the blot
with an anti-GST antibody (Fig. 2A, lower
panel).
View larger version (31K):
[in this window]
[in a new window]
|
Fig. 2.
PC4 interacts with Tat in
vitro. A, lysates prepared from bacterial
cells expressing PC4 protein were incubated with GST (lane
2), GST-Tat (lane 3), and GST-Myb (lane 4).
Bound proteins were resolved by SDS-PAGE and subjected to Western
blotting using an anti-PC4 antibody (upper panel). Blots
were reprobed with an anti-GST antibody (lower panel).
Lane 1 represents one-tenth of the input protein.
B, COS cell lysate was incubated with GST (lane
2) and GST-Tat (lane 3). Bound proteins were resolved
by SDS-PAGE and detected by Western blot analysis with an anti-PC4
antibody. Lane 1 represents one-tenth of the input
protein.
|
|
To determine whether Tat could also interact with endogenous cellular
PC4, binding assays were performed between GST-Tat fusion protein
immobilized on glutathione-Sepharose and COS cell lysates. Cell lysates
were incubated with GST alone or GST-Tat protein. Western analysis of
the COS cell lysate with an anti-PC4 antibody revealed a single 16-kDa
protein (Fig. 2B, lane 1). This protein bound to
GST-Tat (Fig. 2B, lane 3) but not to the GST
control (lane 2). These experiments show that Tat can
interact with both bacterially expressed and endogenous COS cell PC4
in vitro and confirm the interaction detected in the yeast
two-hybrid system.
Modification of PC4 Levels Affects Tat-mediated Activation of the
HIV LTR--
To determine whether the PC4-Tat interaction has a
functional consequence on Tat transactivation of the HIV LTR, transient transfection assays were carried out in Jurkat T cells. Human Jurkat T
cells were cotransfected with an HIV LTR luciferase reporter and with
increasing amounts of a PC4 expression plasmid (SG5-PC4), with or
without a Tat expression plasmid (pCDM-Tat). Cells were either
unstimulated or stimulated for 8 h with PMA and calcium ionophore
to mimic T cell activation. PMA and calcium ionophore stimulation of
the transfected Jurkat T cells resulted in a low level of activation of
the HIV LTR. Transfection of increasing amounts of the PC4 expression
plasmid had no activating effect on the HIV LTR in either unstimulated
or stimulated cells in the absence of Tat (Fig.
3A).
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3.
Modulation of PC4 levels affects Tat-mediated
activation of the HIV LTR. A, Jurkat T cells were
cotransfected with 5 µg of a reporter plasmid containing the HIV LTR
with increasing amounts of a PC4 expression plasmid in the absence and
presence of Tat expression plasmid (5 µg), as indicated.
Transfections were supplemented with the parent plasmid pSG5 to a total
of 20 µg of DNA. Cells were either unstimulated ( ) or stimulated
with 20 ng/ml PMA and 1 µM calcium ionophore for 8 h
( ). Luciferase activity was measured using the Packard Top Count
Luminescence Counter and is depicted in counts per second
(CPS). Columns represent the means, and
error bars are the standard error of five replicate assays.
The average fold inductions are indicated below.
B, Jurkat T cells were cotransfected with 5 µg of HIV LTR
reporter plasmid with increasing amounts of a PC4 antisense expression
plasmid in the absence and presence of 5 µg of Tat expression
plasmid, as indicated. Assays were conducted as in A. C, Jurkat T cells were cotransfected with 5 µg of HIV LTR
reporter plasmid, 5 µg of Tat expression plasmid, and PC4 sense and
antisense expression constructs as indicated. Assays were conducted as
in A. D, lysates were prepared from COS cells
cotransfected with PC4Myc, antisense PC4, and TatHA expression plasmids
as indicated. Lysates were subjected to SDS-PAGE and Western blot
analysis with an anti-Myc antibody (Ab; upper
panel). The blot was reprobed with an anti-HA antibody
(lower panel).
|
|
Cotransfection of a Tat expression plasmid with the HIV LTR reporter
lead to a large increase in transcription in either unstimulated (42-fold) or stimulated (118-fold) cells (Fig. 3A).
Transfection of increasing amounts of the PC4 expression plasmid
resulted in a further increase in activity in both stimulated and
unstimulated cells in a dose-dependent manner, usually in
the order of 2-3-fold stimulation (Fig. 3A).
To confirm the involvement of PC4 in Tat-mediated activation of the HIV
LTR, the effect of expression of an antisense PC4 expression plasmid
was examined. Jurkat T cells were transfected with the HIV LTR reporter
and increasing amounts of the antisense PC4 expression plasmid
(SG5-PC4), with or without Tat. Transfection of the antisense
plasmid had no effect on the HIV LTR in the absence of Tat in either
unstimulated or stimulated cells (Fig. 3B). This is in
agreement with the lack of effect of PC4 overexpression on the HIV LTR
in the absence of Tat (Fig. 3A). However, transfection of
increasing amounts of antisense PC4 plasmid reduced the
Tat-dependent activation of the HIV LTR promoter in a
dose-dependent manner (Fig. 3B).
PC4 sense and antisense plasmids were also cotransfected into Jurkat T
cells to determine whether antisense PC4 expression could reverse the
effect of overexpression of PC4 on Tat activation of the HIV LTR. As
before, transfection of an antisense PC4 plasmid reduced Tat activation
of the HIV LTR in both stimulated and nonstimulated cells by 2-3-fold
(Fig. 3C). PC4 (sense) expression enhanced Tat-mediated activation of the HIV LTR as described above, and this induction was
reduced in a dose-dependent manner by cotransfection of
increasing amounts of antisense PC4 plasmid, back to approximately the
levels seen with Tat alone (Fig. 3C).
To confirm that transfection of the antisense PC4 plasmid is able to
reduce the level of PC4 protein in cells, protein expression was
examined in antisense or control transfected COS cells. Cells were
transfected with CMV vector (Fig. 3D, lane 1), a
PC4-Myc tagged expression plasmid (lane 2), or PC4-Myc in
the presence of antisense PC4 plasmid (lane 3), and lysates
were prepared and analyzed by Western blotting. PC4-Myc protein
expression was detected in cells transfected with the PC4-Myc
expression vector using an anti-Myc antibody (Fig. 3D,
upper panel, lane 2). PC4-Myc protein expression
levels were reduced by cotransfection of antisense PC4 (Fig.
3D, lane 3). As expected, PC4-Myc expression was
not detected in the control transfected cells (lane 1). To
control for transfection efficiency and protein loading, all cells were also cotransfected with a Tat-HA tagged expression plasmid, and the
Western blot was reprobed with an anti-HA antibody (Fig. 3D, lower panel). Protein expression was visualized using the
Fuji luminescent image analyzer (LAS-1000 plus) and quantitated using the Fuji Image Gauge software. Antisense PC4 expression reduced PC4-Myc
expression levels to 23% of the control lane after normalization against Tat-HA expression levels. The ability of PC4 to enhance Tat-mediated HIV LTR activity and the ability of antisense PC4 to
reduce it demonstrate a functional link between Tat and PC4 and a role
for PC4 in Tat-mediated activation of the HIV LTR.
Phosphorylation of PC4 Inhibits Interaction with Tat Both in Vitro
and in Vivo--
PC4 can be phosphorylated by casein kinase II (CKII)
on a number of serine residues (51) primarily situated in the first SEAC domain in the N-terminal region of the protein. The majority of
the protein in the cell appears to be in the phosphorylated form (51).
The phosphorylated and unphosphorylated proteins display different
mobilities under SDS-PAGE conditions (51). Upon transfection of a
PC4-Myc expression construct into COS cells, two bands were detected
upon Western analysis that may represent differentially phosphorylated
forms of the protein. The phosphorylation status of a Myc-tagged PC4
protein expressed in COS cells and the effect of phosphorylation on
interactions with Tat were therefore examined.
COS cells transfected with the PC4-Myc construct were lysed in the
absence (Fig. 4A, lane
1) or presence (lane 2) of the phosphatase inhibitor
sodium orthovanadate (NaV). In the absence of NaV, two proteins of 23 and 26 kDa were detected using an anti-Myc antibody, whereas in the
presence of NaV only the slower mobility 26-kDa protein was detected,
suggesting that this protein is a phosphorylated form of PC4. The
26-kDa form could be converted to the 23-kDa form upon incubation with
alkaline phosphatase (Fig. 4A, lane 4), whereas
no change was seen upon incubation with alkaline phosphatase buffer
alone (compare lanes 1 and 3). Furthermore, only
the 26-kDa protein was detected upon incubation of the extracts with
CKII (Fig. 4A, lane 6), whereas no change was
seen upon incubation with CKII buffer alone (lane 5). We
also tested whether bacterially expressed PC4 could be phosphorylated
by CKII. In bacterial cell lysates expressing PC4-Myc, a 23-kDa
protein, was detected (Fig. 4A, lane 7), as well
as smaller degradation products. This protein is unaffected by
incubation in CKII buffer (Fig. 4A, lane 8), but
upon incubation with CKII, a shift to the 26-kDa protein is seen
(lane 9). The PC4-Myc degradation products, which are most likely N-terminal deletions (the Myc tag is on the C terminus), are not
affected by incubation with CKII (Fig. 4A, lane
9). This is not unexpected because phosphorylation by CKII has
been shown to be largely restricted to the N-terminal 1-22 amino acids
of the PC4 protein (51). Therefore, it appears that the 23-kDa protein
is an unphosphorylated form of PC4-Myc, whereas the 26-kDa protein
corresponds to PC4-Myc phosphorylated by CKII. The anti-PC4 antibody
used in experiments in Fig. 2 (A and B)
cross-reacts only weakly with the phosphorylated protein, therefore
explaining the detection of only one protein band in extracts of COS
cells (data not shown). Similarly lysates used in the experiment in Fig. 3D were prepared in the presence of sodium
orthovanadate, and therefore only a single band presumably representing
phosphorylated PC4-Myc was detected.
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
CKII-phosphorylated PC4 does not interact
with Tat. A, COS cells were transfected with a PC4Myc
expression construct and lysates prepared in the absence (lane
1) or presence (lane 2) of sodium orthovanadate
(NaV). Lysates (NaV) were incubated with
alkaline phosphatase buffer (lane 3), alkaline phosphatase
(lane 4), CKII buffer (lane 5), and CKII
(lane 6). Lysates were prepared from bacterial cells
expressing PC4Myc (lane 7) and incubated with CKII buffer
(lane 8) and CKII (lane 9). Proteins were
resolved by SDS-PAGE and detected with an anti-Myc antibody. The
unphosphorylated (PC4Myc) and phosphorylated (PC4-P-Myc) proteins are
indicated. B, lysates prepared from bacterial cells
expressing PC4Myc protein were incubated with GST (lane 2),
GST-Tat (lane 3), and GST-Myb (lane 4). Lysates
were incubated with CKII (lane 5) and then with GST
(lane 6), GST-Tat (lane 7) and GST-Myb
(lane 8). Bound proteins were resolved by SDS-PAGE and
detected by Western blotting with an anti-Myc antibody. Lanes
1 and 5 represent one-tenth of the input protein.
C, COS cells were transfected with Tat-HA and PC4Myc
expression plasmids (lanes 1 and 3) or PC4Myc
alone (lanes 2 and 4). Lysates were
immunoprecipitated (IP) with an anti-HA antibody, and the
immunoprecipitates were subjected to SDS-PAGE and Western blot analysis
with an anti-Myc antibody to detect bound PC4Myc protein (upper
panel). Lanes 1 and 2 represent one-tenth of
the input lysate. The blot was reprobed with an anti-HA antibody to
detect Tat-HA protein (lower panel).
|
|
Binding studies were conducted to determine whether the phosphorylation
status of PC4 affects its interactions with Tat. Bacterial cell lysates
containing unphosphorylated PC4-Myc protein (Fig. 4B,
lane 1) or PC4-Myc phosphorylated by CKII (Fig.
4B, lane 5) were incubated with GST-Tat
immobilized on glutathione-Sepharose. Unphosphorylated PC4-Myc bound to
GST-Tat (Fig. 4B, lane 3) but did not bind to GST
or GST-Myb as described above (lanes 2 and 4,
respectively). In contrast, PC4-Myc phosphorylated by CKII did not bind
to GST-Tat (Fig. 4B, lane 7) or to the GST and
GST-Myb negative controls (lanes 6 and 8,
respectively). It should be noted that the PC4-Myc degradation products
that were treated with CKII but do not become phosphorylated still bind
to GST-Tat (Fig. 4B, lane 7).
Next we investigated whether the phosphorylation status of PC4 affects
its interaction with Tat in cells. COS cells were transfected with the
PC4-Myc contruct in the presence or absence of a HA-tagged Tat (Tat-HA)
expression construct. Proteins were immunoprecipitated from COS cell
lysates with an anti-HA antibody (12CA5) coupled to Sepharose beads. To
determine whether PC4-Myc could bind to Tat-HA in vivo,
12CA5 immunoprecipitates were probed with the anti-Myc antibody.
Western analysis revealed the presence of both the unphosphorylated (23 kDa) and phosphorylated (26 kDa) forms of PC4-Myc in lysates from COS
cells cotransfected with PC4-Myc and Tat-HA (Fig. 4C,
lane 1) and from COS cells transfected with PC4-Myc alone
(Fig. 4C, lane 2). Neither of these protein bands were present in mock transfected COS cells (data not shown). The unphosphorylated PC4-Myc protein was coimmunoprecipitated with the
Tat-HA protein (Fig. 4C, lane 3) but not
immunoprecipitated in the absence of Tat-HA (Fig. 4C,
lane 4). However, the phosphorylated PC4-Myc protein did not
coimmunoprecipitate with Tat-HA. Therefore, a specific interaction
between unphosphorylated PC4-Myc and Tat-HA, but not phosphorylated
PC4-Myc was detected in vivo. Analysis of the blot with
anti-HA antibodies confirmed the presence of a 21-kDa Tat-HA protein in
only the Tat transfected lysates and immunoprecipitated with the
anti-HA-Sepharose (Fig. 4C, lanes 1 and
3). Taken together these experiments show that
unphosphorylated but not phosphorylated PC4 interacts with Tat both
in vivo and in vitro.
The Basic Domain of Tat Is Involved in the Interaction with
PC4--
To investigate which region of Tat is involved in the
interaction with PC4, binding studies were conducted between GST-Tat mutant proteins immobilized on glutathione-Sepharose and bacterial lysates containing a PC4-Myc tagged protein. Constructs were used that
express GST fusion proteins of the one exon form of Tat (GST-Tat 1-72), the activation domain of Tat (GST-Tat 1-48), and the
C-terminal region of Tat containing the basic TAR binding domain
(GST-Tat 49-86). Expression of the 23-kDa PC4-Myc protein was detected by Western analysis using an anti-Myc antibody (Fig.
5A, lane 1). The
PC4-Myc protein bound to Tat 1-72 (lane 3) and Tat 49-86 (lane 5). However, the PC4 protein did not bind to Tat 1-48
(Fig. 5A, lane 4) or to Tat 1-72 with the basic
domain mutated (Tat Basic, lane 6). As expected PC4 did not bind to the
GST protein alone. To confirm that the GST-Tat fusion proteins were
expressed and used in approximately equal amounts in the binding
studies, the blot was reprobed with an anti-GST antibody (Fig.
5A, lower panel).
View larger version (37K):
[in this window]
[in a new window]
|
Fig. 5.
PC4 interacts with the basic domain of
Tat. A, lysates prepared from bacterial cells
expressing PC4Myc protein were incubated with GST (lane 2),
GST-Tat 1-72 (lane 3), GST-Tat 1-48 (lane 4),
GST-Tat 49-86 (lane 5), and GST-Tat Basic mutant
(lane 6). Bound proteins were resolved by SDS-PAGE and
detected by Western analysis using an anti-Myc antibody (Ab;
upper panel). Blots were reprobed with an anti-GST antibody
(lower panel). Lane 1 represents one-tenth of the
input protein. B, lysates were incubated with GST
(lane 2), GST-Tat 1-72 (lane 3), GST-Tat 1-57
(lane 4), and GST-Tat 1-57 basic mutant (lane 5)
and analyzed as in A.
|
|
To confirm that the basic region of Tat was involved in the interaction
with PC4, constructs were generated to express a GST fusion protein of
Tat 1-57. This construct contains the activation domain (1-48), which
did not interact with Tat as well as the basic TAR binding domain
(49-57). As a control, GST-Tat 1-57 basic that has the basic domain
mutated to alanine residues was also examined. As expected PC4
interacted with the wild type GST-Tat 1-72 protein but not to GST
alone (Fig. 5B, lanes 3 and 2,
respectively). Furthermore, an interaction was detected between PC4 and
GST-Tat 1-57 but not the GST-Tat 1-57 basic control protein
(lanes 4 and 5). As before, Western analysis of
the blot confirmed that the GST fusion proteins were present in the
binding studies (Fig. 5B, lower panel).
Therefore, the interaction between PC4 and Tat involves the TAR binding
basic domain of Tat.
Identification of Regions of PC4 Important for Tat
Interaction--
To determine which regions of PC4 are important in
the interaction with Tat, binding assays were performed between GST-Tat fusion protein immobilized on glutathione-Sepharose beads and PC4 wild
type or mutant proteins (Fig. 1). Expression of PC4 wild type protein
(Fig. 6A, lane 1)
and PC4 22-127 (lane 5) was detected by Western analysis
using an anti-PC4 antibody. The anti-PC4 antibody did not cross-react
efficiently with PC4 31-127 or PC4 43-127 (data not shown), so it was
necessary to generate PC4-Myc fusion proteins. Expression of PC4-Myc
(lane 9), PC4 31-127Myc (lane 13), and PC4
43-127Myc (lane 17) was confirmed by Western analysis using
an anti-Myc antibody. Bands corresponding to the expected size of each
protein as well as smaller degradation products were seen in each
case.
View larger version (37K):
[in this window]
[in a new window]
|
Fig. 6.
Definition of the region of PC4 that
interacts with Tat. A, lysates were prepared from
bacterial cells expressing PC4 (lanes 1-4), PC4 22-127
(lanes 5-8), PC4Myc (lanes 9-12), PC4
31-127Myc (lanes 13-16), and PC4 43-127Myc (lanes
17-20). Lysates were incubated with GST, GST-Tat, and GST-Myb as
indicated. Bound proteins were resolved by SDS-PAGE and subjected to
Western analysis using an anti-PC4 antibody (Ab, lanes
1-8) or an anti-Myc antibody (lanes 9-20). One-tenth
of the input protein is represented in lane 1. B,
lysates were prepared from bacterial cells expressing PC4Myc
(lanes 1-4), PC4 1-62Myc (lanes 5-8), and PC4
1-91 (lanes 9-12). Lysates were incubated with GST,
GST-Tat, and GST-Myb as indicated. Bound proteins were resolved by
SDS-PAGE and analyzed by Western blotting using an anti-Myc antibody
(lanes 1-8) or an anti-PC4 antibody (lanes
9-12). One-tenth of the input protein is represented in
lane 1. C, lysates were prepared from bacterial
cells expressing PC4Myc wild type protein (WT) or PC4Myc
mutant (mut) proteins as indicated. Lysates were incubated
with GST or GST-Tat proteins as indicated. Bound proteins were resolved
by SDS-PAGE and analyzed by Western blotting using an anti-Myc
antibody. One-tenth of the input protein is represented in lane
1. D, lysates were prepared from bacterial cells
expressing PC4 22-127 (lanes 1-4), PC4 22-127 K23E/K26E
(lanes 5-8), and PC4 22-127 K24/28E (lanes
9-12). Lysates were incubated with GST, GST-Tat, and GST-Myb as
indicated. Bound proteins were resolved by SDS-PAGE and analyzed by
Western blotting using an anti-PC4 antibody. One-tenth of the input
protein is represented in lane 1.
|
|
Bacterial cell lysates containing wild type PC4 or mutant proteins were
incubated with GST alone, GST-Tat, or GST-Myb as a control. Both the
wild type PC4 protein and PC4 22-127 bound to GST-Tat (Fig.
6A, lanes 3 and 7, respectively) but
not to GST alone or GST-Myb. PC4-Myc bound to GST-Tat (Fig.
6A, lane 11), but not to GST or GST-Myb
(e.g. lanes 10 and 12, respectively) as expected. In contrast, PC4 31-127Myc bound to GST-Tat only very
weakly (Fig. 6A, lane 15) and PC4 43-127 did not
bind to GST-Tat (lane 19). These data suggest that the first
SEAC domain contained in amino acids 1-21 is not required for
interactions with Tat, whereas removing the lysine-rich region impairs
the interaction with Tat. As in previous binding experiments, all blots
were reprobed with an anti-GST antibody to confirm the presence of GST
fusion proteins in the binding studies (data not shown).
To further define the Tat-interacting region of PC4, mutants were
generated deleting the C-terminal region of the protein. Expression of
PC4-Myc protein (Fig. 6B, lane 1) and PC4
1-62Myc (lane 5) was detected using an anti-Myc antibody.
PC4 1-91 (lane 9) was detected using an anti-PC4 antibody.
PC4-Myc interacted with GST-Tat (Fig. 6B, lane 3)
but not GST or GST-Myb (lanes 2 and 4) as expected. PC4 1-62Myc did
not interact with GST-Tat (Fig. 6B, lane 7),
whereas PC4 1-91 was still able to bind to GST-Tat (lane
11). In summary, these experiments imply that the Tat-binding
domain of PC4 lies between amino acids 22 and 91.
To further identify the residues important in the interaction with Tat,
scanning mutants were generated in which the region between amino acids
23 and 58 were mutated 6 residues at a time to the sequence AAASAA. In
this way the following mutants were generated: PC4 mut23-28, PC4
mut29-34, PC4 mut35-40, PC4 mut 41-46, PC4 mut 47-52, and PC4 mut
53-58 (Fig. 1). Expression of PC4-Myc (Fig. 6C, lane
1), PC4 mut23-28Myc (lane 4), PC4 mut29-34Myc
(lane 7), PC4 mut35-40Myc (lane 10), PC4
mut41-46Myc (lane 13), PC4 mut47-52Myc (lane
16), and PC4 mut53-58Myc (lane 19) was confirmed by
Western analysis using an anti-Myc antibody. Of these mutants, PC4
mut23-28Myc and PC4 mut35-40Myc, which have the lysine motifs mutated
(Fig. 1), did not bind to GST-Tat (Fig. 6C, lanes 6 and 12). All remaining mutants interacted with GST-Tat
but not with GST, as was seen with the wild type protein (Fig.
6C). Therefore, mutation of either of the two lysine motifs
between amino acids 22 and 43 inhibited interactions with Tat.
To confirm the importance of intact lysine motifs for the interaction
with Tat, further mutants were examined in which only lysine residues
were mutated. Expression of PC4 22-127 protein (Fig. 6D,
lane 1), PC4 22-127 K23E/K26E (lane 5) and PC4
22-127 K24/28E (lane 9) was detected using an anti-PC4
antibody. As before PC4 22-127 bound to GST-Tat (Fig. 6D,
lane 3) but not to GST or GST-Myb (lanes 2 and
4). In contrast, PC4 22-127 K23E/K26E and PC4 22-127
K24/28E did not bind to GST-Tat (Fig. 6D, lanes 7 and 11, respectively).
Taken together these results suggests that the lysine-rich motifs of
PC4 between amino acids 22 and 43 are important for the interaction
with Tat, whereas the first SEAC domain of PC4 contained in amino acids
1-21 and the C-terminal 91-127 amino acids are not required for the interaction.
Expression of the PC4 C-terminal Domain Activates the HIV LTR in
the Absence of Tat--
Neither the N-terminal or C-terminal region of
PC4 alone interact with Tat. Therefore, these regions of the protein
were used in transfection studies to test the specificity of the
coactivator function of PC4 with Tat. The scanning mutants PC4
mut23-40 and PC4 mut35-40, in which the lysine motifs are mutated to
the sequence AAASAA, were also examined in transfection studies because
these mutants also do not interact with Tat.
Expression constructs were generated containing the N-terminal 1-62
amino acids of PC4 (PC4NT), the C-terminal 63-127 amino acids of PC4
(PC4CT), and the mutants PC4 mut23-28 and PC4 mut35-40. Jurkat T
cells were cotransfected with the HIV LTR luciferase reporter and
increasing amounts of the PC4CT construct with or without Tat
expression plasmid. Cells were either unstimulated or stimulated with
PMA and calcium ionophore.
Overexpression of PC4CT alone lead to activation of the HIV LTR in the
absence of Tat both in unstimulated and stimulated cells in a
dose-dependent manner (Fig.
7A). Tat activated the HIV LTR
in both unstimulated and stimulated cells. However, PC4CT did not
appear to co-operate with Tat activation of the HIV LTR in either
unstimulated or stimulated cells. Transfection of the PC4NT expression
plasmid had no effect on the HIV LTR in the absence or presence of Tat
(Fig. 7B), whereas the wild type PC4 protein enhanced Tat
activation of the HIV LTR as before.
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7.
Functional analysis of PC4 mutants.
A, Jurkat T cells were cotransfected with 5 µg of reporter
plasmid containing the HIV LTR with increasing amounts of PC4-CT
plasmid (amino acids 63-127) in the absence and presence of Tat
expression plasmid as indicated. Cells were either unstimulated ()
or stimulated with PMA and calcium ionophore for 8 h (). Parent
plasmid was added to a total of 30 µg in each transfection.
Luciferase activity was measured using the Packard Top Count
Luminesence counter and is depicted in counts per second
(CPS). Columns represent the means, and
error bars represent the standard error of five replicate
assays. The fold inductions are indicated below. B, Jurkat T
cells were transfected with 5 µg of HIV LTR reporter plasmid in the
presence or absence of 5 µg Tat expression plasmid. Some cells were
cotransfected with 5 µg of PC4 or PC4-NT (amino acids 1-62)
expression plasmid as indicated. Assays were conducted as in
A. C, Jurkat T cells were transfected with 5 µg
of HIV LTR reporter plasmid in the presence or absence of 5 µg of Tat
expression plasmid. Some cells were cotransfected with 5 µg of PC4,
PC4 mut23-28, or PC4 mut35-40 expression plasmid as indicated. Assays
were conducted as in A.
|
|
Finally PC4 mut 23-28 and PC4 mut 35-40, like wild type PC4, had no
activating effect on the HIV LTR in the absence of Tat (Fig.
7C). However, unlike the wild type PC4 protein, these
mutants did not enhance HIV LTR activation in the presence of Tat.
Therefore, in the absence of Tat interaction, mutant PC4 proteins did
not activate Tat-dependent HIV LTR function. The C-terminal region of PC4 alone is a constitutive activator of the HIV LTR but is
unable to enhance Tat-mediated activation of the HIV LTR.
| |
DISCUSSION |
PC4 was identified in this study as a Tat-interacting protein by a
yeast two-hybrid screen of an activated Jurkat T cell library. The
interaction between Tat and PC4 was confirmed both in vitro and also in vivo using GST pull-down experiments and
coimmunoprecipitations. We have shown here that PC4 enhances
Tat-mediated activation of the HIV LTR in vivo. PC4 has been
demonstrated to interact with both components of the basal
transcription machinery such as TFIIA as well as a variety of
activators such as VP16 and GAL4-AH (43, 49), leading to the suggestion
that it may act as an adaptor-type molecule between the transcription
machinery and activators. Therefore, PC4 is a candidate for a Tat
coactivator facilitating interactions between Tat and the transcription
machinery on the HIV LTR.
Several studies have demonstrated coactivator function of PC4 with
activators, such as VP16 and GAL4-AH (43, 49); however, such
experiments have thus far employed in vitro transcription systems. In this study we demonstrate coactivator function for PC4 with
Tat in transient transfection experiments in Jurkat T cells. In these
studies overexpression of PC4 had no activating effect on the HIV LTR
alone but enhanced Tat-mediated activation of the HIV LTR in a
dose-dependent manner. Similarly, antisense PC4 expression
had no effect on the HIV LTR in the absence of Tat but reduced
Tat-mediated activation of the HIV LTR. The lack of an antisense effect
in the absence of Tat serves to demonstrate the specificity of the
antisense result. This was also shown by the ability of antisense PC4
to counter the effects of overexpression of PC4 on Tat-mediated
activation of the HIV LTR and the ability of antisense PC4 to reduce
PC4 expression at the protein level. We therefore conclude that PC4
acts as a coactivator of Tat in vivo. While this study was
in progress, Kannan and Tainsky (52) also demonstrated coactivator
function for PC4 in vivo. PC4 was shown to interact with the
transcription factor, activator protein 2, and regulate its
transcriptional activity in vivo.
In vitro binding studies showed that PC4 interacts with the
basic TAR binding region of Tat. PC4 interacted with the basic region
(amino acids 50-57) when it was presented with the activation domain
(i.e. as Tat 1-57) or with the C-terminal region of Tat (i.e. as Tat 49-86), suggesting that this domain is
sufficient for binding to PC4. The basic domain of Tat is involved in
binding to the TAR RNA structure (5, 53) and therefore is important for
targeting Tat to the promoter region of the HIV LTR. The basic region
was also shown to be involved in interactions with cellular proteins,
such as the activator SP1 (26) and the transcriptional coactivator
CREB-binding protein/p300 (31, 32). How interactions between these
cellular proteins and the basic domain of Tat affect the Tat-TAR
interaction has not been addressed. Further studies are required to
determine whether PC4 can interact with the Tat-TAR complex or whether
the PC4-Tat and Tat-TAR complexes form independently. PC4 has been
shown to interact with both double-stranded DNA and single-stranded DNA
(50), but the possibility exists that PC4 can also interact with RNA.
The region of PC4 between amino acids 22 and 91 was shown to be
involved in the interaction with Tat. Deletion of the first 21 amino
acids does not abolish binding, but deletion of the first 43 amino
acids or mutation of the lysine-rich region between amino acids 22 and
31 abolishes binding, suggesting that the integrity of amino acids
22-43 are required for interaction with Tat. On the other hand, PC4
1-62 does not bind to Tat as would be expected if the binding
determinants are located between amino acids 22 and 43. There are
several possible explanations for these results. First, it is possible
that the truncated PC4 1-62 does not fold correctly to generate the
Tat-interacting domain. Second, there may be a complex interaction
region combining amino acids 22-43 and a second determinant lying
between amino acids 62 and 91. Although we cannot rule out the
possibility that mutation of the lysine residues may alter the
structure of the protein, it is clear using several different types of
mutants that the lysine motifs of PC4 are required for the interaction
with Tat. Functional studies showed a correlation between the ability
of PC4 proteins to interact with Tat and their ability to function as a
coactivator. Specifically, PC4 mutants in which the lysine motifs were
disrupted failed to display coactivator function with Tat in our
transient transfection studies. Further work involving determining the
structure of the N-terminal region of PC4 may be required to define the role of the lysine motifs in the interaction between PC4 and Tat.
PC4 is a bipartite protein containing a regulatory N-terminal domain
and a single-stranded DNA-binding C-terminal domain (50). In our
transfection assay, the N-terminal 1-62 amino acids of PC4, which
cannot bind to Tat, did not retain coactivator function. This is in
agreement with previous in vitro experiments using the
GAL4-AH activator (50). Suprisingly, the C-terminal domain of PC4
(amino acids 63-127), to which single-stranded DNA binding activity
has been attributed, acted as a constitutive activator in our in
vivo system. This is in contrast to in vitro studies that have shown the C-terminal domain of PC4 to be either inactive (50)
or in fact to act as an inhibitor of transcription (54). However, this
region of PC4 did not co-operate with Tat in activating the HIV LTR,
which is in agreement with the lack of interaction between the
C-terminal domain and Tat in our binding studies. The C-terminal domain
of PC4 can bind with high affinity to single-stranded DNA in
vitro (50), and this may relate to the constitutive activity observed with expression of the C-terminal domain of PC4. The crystal
structure of the PC4 C-terminal domain has now been determined and
revealed that this domain forms dimers containing two single-stranded DNA-binding channels (55). Furthermore, PC4 C-terminal domain dimers
bind with high affinity to two opposing unpaired DNA strands such as
formed by internally melted duplexes and are able to destabilize dsDNA
(56). This has led to the suggestion that PC4 may play a role in
promoter opening during transcription. Further studies are required to
determine whether the activity displayed by the C-terminal region of
PC4 on the HIV LTR in vivo is due to its single-stranded DNA
binding properties and if in fact this region is involved in promoter opening.
The single-stranded DNA binding properties of PC4 are displayed only by
the truncated C-terminal domain of the protein (amino acids 63-127) or
phosphorylated full-length PC4 (50). PC4 can be phosphorylated by CKII
on serine residues situated primarily in the first SEAC domain in the
N-terminal region of the protein (51), and this has been suggested to
cause a conformational change in the protein exposing the C-terminal
single-stranded DNA-binding region (50). When the C-terminal region of
the protein is expressed alone, it is no longer controlled by
phosphorylation of the N-terminal regulatory domain and would therefore
be permanently able to bind single-stranded DNA. The constitutive
activator function displayed by the C-terminal region of the protein in
our studies may therefore be a consequence of this lack of regulation
of the single-stranded DNA binding activity of PC4. Further studies are needed to determine whether such activity is also displayed by the
full-length protein in which the C-terminal single-stranded DNA-binding
region is exposed by phosphorylation.
Although phosphorylation regulates the single-stranded DNA binding
activity of PC4, it also appears to control interactions between PC4
and a variety activators. In vitro studies have demonstrated that phosphorylation of PC4 by CKII inhibits interactions with the
viral activator VP16 and also inhibits coactivator function (51).
Phosphorylation of PC4 also abolishes coactivator function of PC4 with
GAL4-AH in vitro (43). Similarly, Tat interacts with only
the unphosphorylated form of PC4 both in vitro and also in
coimmunoprecipitation experiments. This suggests that the interaction between Tat and PC4 is similar to that demonstrated for other activators. In contrast, the transcription factor NF-Y interacts with
PC4 irrespective of its phosphorylation status, via the C-terminal domain of PC4 (57).
A model for Tat transactivation of the HIV LTR has been suggested in
which Tat is able to recruit the cellular kinases cdk7 (TFIIH) and cdk9
(pTEFb) to hyperphosphorylate RNA polymerase II, converting it to a
highly processive form (reviewed in Refs. 13 and 14). How the
interaction between Tat and PC4 fits with this model remains to be
determined. However, in vitro studies have shown that TFIIH
can phosphorylate PC4 within the preinitiation complex, and this is
coupled with release of PC4 from the complex and promoter clearance
(58). From this work, Malik et al. (58) proposed a two-step
model for PC4 coactivator function in which PC4 is involved in
formation of the preinitiation complex through interactions with the
basal machinery and transcription factors. PC4 then requires
phosphorylation and subsequenct release from the transcription complex
before promoter clearance and elongation can occur efficiently (58). It
could be speculated then that PC4 is involved initially in the
formation of the preinitiation complex through interactions with Tat
and the basal machinery and/or other transcription factors. As eluded
to earlier, determining whether the Tat-PC4 complex forms
co-operatively or independently to the Tat-TAR complex may shed light
on the exact role PC4 plays. Subsequently, recruitment of cdk7 by Tat,
which enhances the phosphorylation of the C-terminal domain of RNA
polymerase II, may also promote phosphorylation of PC4 and release of
PC4 from the preinitiation complex. Phosphorylation of both of these
proteins may then enhance promoter clearance and elongation. It is
possible that once released the phosphorylated PC4 protein may then
have a role in opening of the promoter through its single-stranded
DNA-binding domain. Because PC4 is a potential phosphorylation target,
it may be the subject of regulation by signal transduction pathways. We
can find no evidence of changes in absolute levels of PC4 in Jurkat T
cells in response to PMA/calcium ionophore or CD28 activation. It is,
however, possible that modification of PC4 could occur in response to
these signals.
In this study we have shown that PC4 and Tat interact and that PC4 can
enhance Tat-mediated activation of the HIV LTR. Furthermore, our data
suggest a complex interaction between the basic domain of Tat and the
region of PC4 between amino acids 22 and 91. The lysine motifs within
this region of PC4 are required for the interaction. PC4 may facilitate
interactions between Tat and the transcription machinery or the
enhancer complex, and it is possible that these interactions are
controlled by PC4 phosphorylation.
,
TOP
ABSTRACT
INTRODUCTION
To whom correspondence should be addressed: Div. of
Biochemistry and Molecular Biology, John Curtin School of Medical
Research, ANU, ACT, Australia 2601. Tel.: 61-262799690; Fax:
61-262490415; E-mail: frances.shannon@anu.edu.au.
