Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M001929200 on April 12, 2000

J. Biol. Chem., Vol. 275, Issue 29, 21883-21888, July 21, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/29/21883    most recent
M001929200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giannini, A. L.
Right arrow Articles by Kypta, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giannini, A. L.
Right arrow Articles by Kypta, R. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

alpha -Catenin Inhibits beta -Catenin Signaling by Preventing Formation of a beta -Catenin·T-cell Factor·DNA Complex*

Ana L. GianniniDagger , Maria d. M. Vivanco§, and Robert M. KyptaDagger

From the Dagger  Medical Research Council Laboratory for Molecular Cell Biology, University College London, London WC1E 6BT and the § Breakthrough Toby Robins Breast Cancer Research Centre, Institute of Cancer Research, London, SW3 6JB, United Kingdom

Received for publication, March 8, 2000, and in revised form, April 11, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

alpha -Catenin and beta -catenin link cadherins to the cytoskeleton at adherens junctions. beta -Catenin also associates with members of the T-cell factor (Tcf) family of transcription factors, and mutations in beta -catenin lead to activation of Tcf-dependent transcription and increased cell growth. Although the loss of alpha -catenin expression can also promote cell growth, the role of endogenous alpha -catenin in beta -catenin signaling is unclear. Here we show that loss of alpha -catenin expression in a colon cancer cell line correlates with increased Tcf-dependent transcription. The presence of alpha -catenin in colon cancer cell nuclei suggests that it inhibits transcription directly, and, in agreement with this, ectopic expression of alpha -catenin in the nucleus represses Tcf-dependent transcription. Furthermore, recombinant alpha -catenin disrupts the interaction between the beta -catenin·Tcf complex and DNA. We conclude that alpha -catenin inhibits beta -catenin signaling in the nucleus by interfering with the formation of a beta -catenin·Tcf·DNA complex.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

beta -Catenin has two separable functions; it is a component of the Wnt signal transduction pathway that results in axis formation and cell fate choice during embryonic development (1, 2), and it is part of the cadherin cell adhesion complex (3). The central armadillo repeat domain of beta -catenin is necessary for both of these functions, because it directly binds Tcf/LEF-11 family transcription factors to transduce Wnt signals and cadherins to promote cell-cell adhesion.

In the current model of the Wnt signaling pathway, the cytosolic level of beta -catenin is controlled by phosphorylation and ubiquitin-dependent degradation. Wnt signals stabilize beta -catenin, allowing it to associate with Tcf/LEF-1 family members and enter the nucleus to regulate gene expression. beta -Catenin can also enter the nucleus independently, in a manner similar to that of the nuclear transport protein importin-beta (4, 5), suggesting that beta -catenin may be a specific importin for other proteins. Support for this comes from studies of Armadillo (the Drosophila homologue of beta -catenin), which co-imports the transcription factor Teashirt into the nucleus (6). Several tumor types harbor mutations in the genes encoding the tumor suppressor APC or beta -catenin. These mutations result in permanent activation of Wnt target genes because the beta -catenin·Tcf complex is no longer regulated by degradation of beta -catenin (7-9). Importantly, proteins that are not involved in beta -catenin stability can also regulate beta -catenin signaling. NEMO-like kinase, for example, inhibits the interaction between the beta -catenin·Tcf complex and DNA by phosphorylating Tcf/LEF proteins (10).

alpha -Catenin is another protein that can inhibit beta -catenin signaling independently of stabilizing mutations in beta -catenin or APC (11, 12). alpha -Catenin associates directly with beta -catenin (13, 14), linking cadherins to the actin cytoskeleton, an interaction that is essential for strong cell-cell adhesion (15, 16). The expression of alpha -catenin is often reduced during tumor progression (17), and several cancer-derived cell lines have mutations in the alpha -catenin gene (18, 19). Reintroduction of alpha -catenin into such lines reduces cell growth (18) and attenuates tumor formation (19). Although the tumor suppressor function of alpha -catenin is generally believed to result from its promotion of cell-cell adhesion, the possibility that alpha -catenin influences tumor progression by regulating beta -catenin signaling has not been investigated.

We examined beta -catenin signaling in colon cancer cell lines and found that loss of alpha -catenin expression correlated with increased beta -catenin·Tcf-dependent transcription. Furthermore, alpha -catenin was found in cell nuclei, suggesting a role in processes other than cell adhesion. In support of this possibility, ectopic expression of alpha -catenin in the nucleus inhibited beta -catenin·Tcf signaling, and alpha -catenin disrupted the interaction between the beta -catenin·Tcf complex and DNA in vitro.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

DNA Plasmid Constructs-- Tcf cDNAs, TopFlash, and FopFlash reporter DNAs (20) were gifts from Marc van de Wetering and Hans Clevers (Utrecht University, Utrecht, The Netherlands). Human alpha N-catenin cDNA (21) was provided by Christine Petit (Institute Pasteur, Paris, France). Plasmids encoding GST-alpha -catenin constructs (22) and purified GST-alpha -catenin were generously provided by Vania Braga (Medical Research Laboratory for Molecular Cell Biology), with permission from David Rimm (Yale University). GFP-alpha N-catenin cDNA (23) was provided by Ravinder Sehgal and Louis Reichardt (University of California, San Francisco). To make GFP-alpha -NLS, a double-stranded oligonucleotide (MWG Biotech, Germany) encoding the nuclear localization signal from SV40 large T antigen (24) and appropriate restriction sites was ligated into GFP-alpha N-catenin cut with AflII and HindIII. This resulted in the insertion of the sequence AARDPKKKRKV after residue 902 of avian alpha N-catenin, followed by a stop codon. GFP-alpha Delta -NLS was made by deleting internal sequences in GFP-alpha -NLS using XhoI, resulting in a fusion protein containing residues 1-214 of alpha N-catenin followed by the nuclear localization signal.

Cell Culture and Transfections-- HCT116 cells, SW480 cells, RKO cells, and DLD-1b cells were obtained from the Institute of Cancer Research (London, UK). DLD alpha + cells were isolated by collecting and subcloning floating cells from the culture medium of DLD-1b cells. DLD-1 alpha + cells will be characterized fully at a later date. Parental DLD-1 and DLD alpha - cells (25) were kindly provided by Dr. S. T. Suzuki (Institute for Developmental Research, Aichi Human Service Center, Aichi, Japan). HCT116 cells were grown in McCoy's medium with 10% fetal calf serum, all other cells, including COS 7 and Neuro-2A cells, were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum.

Transient transfections were done according to manufacturers protocols using LipofectAMINE Plus reagent (Life Technologies, Inc.) in 6-well Falcon tissue-culture plates (Becton Dickinson), or, for immunocytochemistry, in 2-well Lab-Tek chamber glass slides (Nalge Nunc) precoated with 30 µg/ml collagen for 5 min (Vitrogen 100, Collagen GmbH, Ismaning, Germany). 293 cells were transfected with 1 µg of pMT23 vector or pMT23 beta Amyc, a phosphorylation site mutant of beta -catenin (12), and 0.5 µg of GFP or GFP-alpha Delta -NLS. Neuro-2A cells were transfected in 10-cm plates using either 1.5 µg of p33 Tcf-1 or p45 Tcf-1, 1 µg of GFP-beta -catenin, and 1.5 µg of GFP-alpha -catenin for immune precipitation assays or with 4 µg of p45 Tcf-1 for gel shift assays. For transcription assays each well of a 6-well plate contained 25 ng of RSV beta -galactosidase, 175 ng of pTopFlash (or pFopFlash), 100 ng of p45 Tcf-1 (COS 7 cells only), 100 ng of beta -catenin construct (COS 7 cells only), and 500 ng of each GFP fusion construct. After 24 h cells were either harvested for preparation of extracts (except for 293 cells, which were harvested after 48 h) or fixed for analysis by fluorescence microscopy.

Preparation and Analysis of Extracts-- Cells were washed in PBS and lysed in modified RIPA buffer (for total extracts) or in Nonidet P-40 lysis buffer (for immune precipitations) as described by Kypta et al. (26). To immune precipitate alpha -catenin·beta -catenin·Tcf complexes nuclear proteins were extracted as follows. Cells were lysed in Nonidet P-40 lysis buffer containing 0.4% Nonidet P-40 and centrifuged for 10 min at 500 × g. The pellet was washed two times in Nonidet P-40 lysis buffer, incubated in Nonidet P-40 lysis buffer containing 400 mM NaCl for 30 min on ice, and centrifuged for 10 min at 15,000 × g. The supernatant was diluted with an equal volume of Nonidet P-40 lysis buffer without NaCl prior to immune precipitation. Immune precipitates were collected using polyclonal anti-pan cadherin (Sigma), anti-alpha -catenin (26), or anti-beta -catenin (26) antibodies. Western blots were probed using anti-alpha -catenin (Zymed Laboratories Inc., clone 7A4), anti-pan cadherin (Sigma, clone CH-19), anti-beta -catenin (Transduction Labs, clone 14), anti-vinculin (Sigma, clone 11-5), anti-cyclin D1 (Santa Cruz, clone A12), anti-Tcf-1 clone 7H3 (27), or anti-Tcf-4 clone 6H5 (28) antibodies, followed by horseradish peroxidase-conjugated anti-mouse antibody at 1:3000 (Jackson), and developed using ECL (Amersham Pharmacia Biotech). For transcription assays, cells were washed twice in ice-cold PBS, collected by scraping in ice-cold PBS containing 1 mM magnesium chloride and 0.1 mM calcium chloride, pelleted by centrifugation, and processed for luciferase and beta -galactosidase activities according to Vivanco et al. (29).

Gel Retardation Assays-- Neuro-2A cells transfected with p45 Tcf-1 were extracted in 20 mM Tris, pH 8, 300 mM NaCl, 100 mM NaF, 0.2% Nonidet P-40, 1 mM dithiothreitol, leupeptin, and aprotinin (10 µg/ml). 2 µg of extract (1 µl) was used for each binding reaction. HPSF®-purified double-stranded oligonucleotide probes (MWG Biotech) containing a Tcf-binding site ACTCTGGTACTGGCCCTTTGATCTTTCTGG or a mutated Tcf-binding site ACTCTGGTACTGGCCCGGGGATCTTTCTGG (28) were labeled using T4 polynucleotide kinase (Promega) and radiolabeled ATP (Amersham Pharmacia Biotech). Unincorporated ATP was removed using Micro Bio Spin 30 chromatography columns (Bio-Rad). Each binding reaction (15 µl) contained 10 mM Tris, pH 7.5, 0.5 mM EDTA, 50 mM NaCl, 1 mM MgCl2, 4% glycerol, 0.5 mM dithiothreitol, 1 µg of poly(dI-dC), 1 µg of salmon sperm DNA, and approximately 0.4 ng of radiolabeled DNA probe. The following purified proteins were used: 0.25 µg of histidine-tagged beta -catenin (26), 2 µg of GST-alpha -catenin, 1 µg of N228 (GST fused to alpha -catenin residues 1-228), and 4 µg of C447 (GST fused to the C-terminal 447 residues of alpha -catenin). Cell extract was incubated with the purified proteins in binding buffer for 5 min at room temperature, probe was then added, and the mixture was incubated for 15 min at room temperature. For antibody supershift experiments, 0.5-1 µg of antibody was added, and the incubation was continued for a further 10 min. The antibodies used were anti-Tcf-1 (27), anti-beta -catenin mAb (Transduction Laboratories), and anti-GFP mAb (Roche Molecular Biochemicals). Gel loading buffer (10×: 250 mM Tris, pH 7.5, 0.2% bromphenol blue and 40% glycerol) was added, and the complexes were separated on a nondenaturing 5% polyacrylamide gel (National Diagnostics) in 0.25× TBE and processed for autoradiography.

Immunofluorescence-- Cells expressing GFP fusion proteins were washed in PBS and fixed for 15 min using 3% paraformaldehyde. For immunofluorescence, fixed cells were permeabilized with 0.2% Triton X-100, 150 mM NaCl, 50 mM Tris-Cl, pH 7.6, for 1 min or using cold methanol for 1 min to optimize detection of nuclear antigens, rinsed in PBS, and blocked for 30 min in PBS containing 1% bovine serum albumin (Fraction V, Sigma). Polyclonal anti-alpha -catenin (1:500) and monoclonal anti-beta -catenin (1:250; Transduction Laboratories) were diluted in blocking buffer and added for 2 h. Cells were then washed four times for 10 min in blocking buffer with 0.05% Triton X-100, incubated for 1 h with Texas Red-conjugated (1:400) or fluorescein isothiocyanate-conjugated (1:200) secondary antibodies (Jackson Inc.), and then washed again as above. After staining, slides were mounted in gelvatol. Confocal images were obtained using a laser scanner (MRC 1024, Bio-Rad) attached to a Nikon microscope (Optiphot 2) and processed using Adobe Photoshop.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

alpha -Catenin Is Present in the Nuclei of SW480 and DLD-1 Colon Cancer Cells-- The majority of colon cancer cell lines harbor mutations in APC or in beta -catenin that result in the stabilization of beta -catenin and formation of transcriptionally active beta -catenin·Tcf complexes in the nucleus. Although alpha -catenin in normal cells is found at cell junctions and in the cytoplasm, its localization in colon cancer cells has not been examined in detail. We compared the subcellular localization of the catenins in colon cancer cells by immunocytochemistry (Fig. 1). As expected, beta -catenin was present in the nuclei of SW480 cells (Fig. 1A), HCT116 cells (Fig. 1C), and DLD-1 cells (Fig. 1E), all of which are colon cancer cell lines with mutations in APC or in beta -catenin. beta -Catenin was difficult to detect in RKO colon cancer cells (Fig. 1G), probably because these cells express no cadherin and do not have mutations in APC or beta -catenin (30). Interestingly, in addition to its localization in the plasma membrane and cytoplasm, alpha -catenin was present in the nuclei of SW480 cells (Fig. 1B) and DLD-1 cells (Fig. 1F) but not in the nuclei of HCT116 cells (Fig. 1D) or RKO cells (Fig. 1H). We examined two additional cell lines, DLD alpha - and DLD alpha +. These are clonal variants of DLD-1 cells that form a disordered monolayer in culture; DLD alpha + cells express alpha -catenin (Fig. 2), whereas DLD alpha - cells do not (25). The subcellular distribution of beta -catenin in DLD alpha + (Fig. 1I) and DLD alpha - (Fig. 1K) cells was comparable with that in DLD-1 cells (Fig. 1E), which form an ordered monolayer. Similarly, the distribution of alpha -catenin in DLD alpha + cells (Fig. 1J) resembled that in DLD-1 cells (Fig. 1F). As expected, alpha -catenin was not detected in DLD alpha - cells (Fig. 1L). These results, together with results obtained using other cell lines,2 suggest that the nuclear localization of alpha -catenin is associated with that of beta -catenin. However, other factors must also regulate the nuclear localization of alpha -catenin because it is found predominantly outside the nucleus in HCT116 cells, which contain nuclear beta -catenin. In addition, formation of an ordered epithelial monolayer does not appear to influence the nuclear localization of the catenins, because they were distributed similarly in the membrane, cytoplasm, and nucleus of parental DLD-1 cells and DLD alpha + cells.


View larger version (122K):
[in this window]
[in a new window]
 
Fig. 1.   Localization of catenins in colon cancer cell lines. The localization patterns of beta -catenin (A, C, E, G, I, and K) and alpha -catenin (B, D, F, H, J, and L) were determined by immunocytochemistry using the following cell lines: SW480 (A and B), HCT116 (C and D), DLD-1 (E and F), RKO (G and H), DLD alpha + (I and J), and DLD alpha - (K and L). Scale bar for A-F and I-L, 10.5 µm; scale bar for G and H, 7.9 µm.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2.   Loss of alpha -catenin expression correlates with increased beta -catenin·Tcf transcription activity. A, total extracts from DLD-1b (lane 1), DLD-1 (lane 2), DLD alpha + (lane 3), DLD alpha - (lane 4), and SW480 (lane 5) cells were probed using the antibodies indicated. Intact cadherin molecules were difficult to detect in SW480 cell extracts. The lines on the left indicate positions of molecular mass markers (175 and 83 kDa). B, alpha -catenin immune precipitates from Nonidet P-40 extracts of DLD-1b (lane 1), DLD-1 (lane 2), DLD alpha + (lane 3), DLD alpha - (lane 4), and SW480 (lane 5) cells were probed with the antibodies indicated. The lines on the left indicate positions of molecular mass markers (175 and 83 kDa). C, from left to right, DLD-1b, DLD-1, DLD alpha +, and DLD alpha - cells were transfected with transcription reporter plasmids (pRSV-beta -galactosidase and pTopFlash or pFopFlash) and analyzed 24 h after transfection. Luciferase activities were normalized for transfection efficiency, and fold activation was calculated as the ratio of pTopFlash and pFopFlash luciferase activities. Experiments were repeated in triplicate at least three times. *, p < 0.01 in t test (compared with the activity in each of the cell lines expressing alpha -catenin).

Loss of Endogenous alpha -Catenin in DLD-1 Colon Cancer Cells Results in Increased beta -Catenin·Tcf Transcriptional Activity-- Although alpha -catenin overexpression can inhibit beta -catenin signaling (11, 12, 23), it is unclear whether endogenous alpha -catenin plays a similar role. To determine whether endogenous alpha -catenin influences beta -catenin signaling, we used the DLD cell lines described above. A parental line from a different source was included in this analysis (DLD-1b) to control for clonal differences among the cell lines. Except for DLD alpha - cells, which lack alpha -catenin (Fig. 2A, lane 4), all the DLD cell lines expressed comparable levels of cadherin, beta -catenin, alpha -catenin, and vinculin (Fig. 2A). Compared with the DLD cell lines, SW480 cells expressed similar levels of alpha -catenin and vinculin but less cadherin and more beta -catenin (lane 5). To compare the cadherin-catenin complexes in the DLD cell lines, alpha -catenin immune precipitates from cell extracts were probed for the presence of beta -catenin and cadherin by Western blotting (Fig. 2B). The cell lines that expressed alpha -catenin (lanes 1-3) contained an intact cadherin·beta -catenin·alpha -catenin complex. As expected, anti-alpha -catenin immune precipitates from DLD alpha - cells did not contain cadherin or beta -catenin (lane 4). The amount of cadherin associated with alpha -catenin in SW480 cells (lane 5) reflected the low level of cadherin in these cells.

To compare beta -catenin signaling in the DLD cell lines, we used a transcriptional reporter assay (20). In this assay, cells are transiently transfected with plasmids encoding luciferase driven by a promoter containing either Tcf-binding sites (TopFlash) or mutated Tcf-binding sites (FopFlash), together with a plasmid encoding beta -galactosidase driven by the RSV promoter (to measure transfection efficiency). The ratio of the TopFlash and FopFlash values provides a measure of beta -catenin signaling activity in the cells. Interestingly, when the DLD cell lines were compared using this assay (Fig. 2C), transcriptional activity was significantly elevated in DLD alpha - cells (p < 0.01). Importantly, the transcriptional activity in DLD alpha - cells was 30% higher than that in DLD alpha + cells, suggesting that the increase in transcriptional activity results from the loss of alpha -catenin expression rather than from a change in cell morphology.

Targeted Expression of alpha -Catenin in the Nucleus Inhibits beta -Catenin·Tcf Signaling-- The inhibitory effects of alpha -catenin overexpression on beta -catenin·Tcf transcription have been proposed to result from the sequestration of beta -catenin in the cytoplasm (11). However, the presence of endogenous alpha -catenin in the nuclei of some colon cancer cells (Fig. 1) suggests that inhibition may occur in the nucleus. To test this possibility, we targeted alpha -catenin expression to the nucleus by adding a nuclear localization signal to a GFP-alpha -catenin fusion protein. This form of alpha -catenin (GFP-alpha -NLS) was expressed to similar levels as GFP-alpha -catenin and associated with beta -catenin as expected (data not shown). In contrast to GFP-alpha -catenin, which was found both in the cytoplasm and in cell junctions in COS 7 cells (12), GFP-alpha -NLS was found exclusively in the nucleus, where it had a diffuse staining pattern (Fig. 3A). Coexpression of GFP-alpha -NLS with beta -catenin in COS 7 cells resulted in the formation of nuclear rod-like structures (Fig. 3B) that colocalized with transfected beta -catenin (data not shown). This pattern of localization is similar to that for ectopically expressed beta -catenin (11, 12) and contrasts with the diffuse nuclear localization pattern of GFP-alpha -NLS in SW480 cells (Fig. 3C), which contain nuclear beta -catenin·Tcf complexes. GFP-alpha -catenin without a nuclear localization signal also had a diffuse nuclear localization pattern in SW480 cells (Fig. 3D), consistent with a model in which beta -catenin·Tcf complexes that are not associated with endogenous alpha -catenin transport transfected GFP-alpha -catenin into the nucleus.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 3.   Subcellular localization of GFP-alpha -NLS and GFP-alpha -catenin in COS 7 and SW480 cells. Cells were transfected with constructs encoding the following proteins and visualized by fluorescence microscopy. A, GFP-alpha -NLS in COS 7 cells. B, GFP-alpha -NLS plus beta -catenin in COS 7 cells. C, GFP-alpha -NLS in SW480 cells. D, GFP-alpha -catenin in SW480 cells. Scale bar, 7 µm.

We reasoned that if alpha -catenin inhibits transcription by sequestering beta -catenin in the cytoplasm, GFP-alpha -NLS would be a less effective inhibitor than GFP-alpha -catenin. However, GFP-alpha -catenin and GFP-alpha -NLS inhibited transcription to a similar extent both in COS 7 cells transfected with beta -catenin and Tcf and in SW480 cells (Fig. 4A), which contain endogenous beta -catenin·Tcf complexes. These results are consistent with inhibition of beta -catenin function occurring in the nucleus rather than by sequestration of beta -catenin in the cytoplasm.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Targeted expression of GFP-alpha -catenin to the nucleus represses beta -catenin·Tcf transcriptional activity. A, COS 7 cells and SW480 cells were transfected with plasmids encoding beta -catenin and Tcf-1 (COS 7 cells only), pTopFlash, RSV-beta -galactosidase, and the GFP fusion proteins indicated. The data shown are mean percentage values from a typical experiment normalized for beta -galactosidase activity with the mean of the control set at 100%. B, DLD alpha - or DLD alpha + cells were transfected with pTopFlash or pFopFlash, RSV-beta -galactosidase and plasmids encoding the GFP fusion proteins indicated. Luciferase activities were normalized for transfection efficiency, and fold activation was calculated as the ratio of pTopFlash and pFopFlash luciferase activities. Experiments were done in triplicate. The results shown are from a typical experiment. C, Western blots of extracts from HEK 293 cells were probed for cyclin D1. Cells were transfected with vector plus GFP (lane 1), beta -catenin (beta Amyc) plus GFP (lane 2), vector plus GFP-alpha Delta -NLS (lane 3), and beta -catenin (beta Amyc) plus GFP-alpha Delta -NLS (lane 4). The arrow marks the position of cyclin D1. The lines on the right indicate positions of molecular mass markers.

The central and C-terminal domains of alpha -catenin associate with a number of cytoskeletal proteins including vinculin (31, 32), alpha -actinin (33), ZO-1 (34), and actin (22). To determine the importance of these interactions for the inhibitory effects of alpha -catenin on transcription, we made a truncation mutant of alpha -catenin (GFP-alpha Delta -NLS). GFP-alpha Delta -NLS contains residues 1-214 of alpha -catenin, which includes the beta -catenin-binding site (33, 35, 36) and a homo-dimerization site (37) but not in vivo binding sites for other known proteins. GFP-alpha Delta -NLS was expressed to a similar level as GFP-alpha -NLS and localized exclusively to the nucleus in transiently transfected COS 7 cells (data not shown). Interestingly, GFP-alpha Delta -NLS reduced beta -catenin-dependent transcription to a similar extent as GFP-alpha -NLS in DLD alpha - cells and DLD alpha + cells (Fig. 4B), as well as in SW480 cells and COS 7 cells (data not shown). The extent of inhibition by the GFP-alpha -catenin constructs was greater in DLD alpha - cells than in DLD alpha + cells, most likely because the beta -catenin·Tcf complex in DLD alpha + cells is partially inhibited by endogenous alpha -catenin. The ability of GFP-alpha Delta -NLS to inhibit transcription in DLD alpha - cells indicates that the mechanism of inhibition does not involve binding to endogenous alpha -catenin. Taken together, these results suggest that the inhibition of beta -catenin·Tcf signaling by nuclear alpha -catenin does not require interactions with other known cytoskeletal proteins.

To determine whether alpha -catenin also regulates transcription of genes relevant to growth control, we examined cyclin D1, which is a direct gene target of the beta -catenin·Tcf complex (38, 39). Western blots of extracts from 293 cells transfected with a stabilized form of beta -catenin and either GFP or GFP-alpha Delta -NLS were probed for cyclin D1 (Fig. 4C). As reported by others (39), expression of beta -catenin increased the level of cyclin D1 in 293 cells (data not shown), and this was unaffected by coexpression of GFP (lane 2). In contrast, coexpression of GFP-alpha Delta -NLS reduced cyclin D1 to basal levels (lane 4). Expression of GFP-alpha Delta -NLS alone did not affect the basal level of cyclin D1 (lane 3). Thus, nuclear alpha -catenin can also inhibit the expression of an endogenous target of beta -catenin signaling.

alpha -Catenin Disrupts the Interaction of the beta -Catenin·Tcf Complex with DNA-- Our results suggest that alpha -catenin inhibits the beta -catenin·Tcf complex directly in the nucleus. This might occur by disruption of the beta -catenin·Tcf complex itself, disruption of its interaction with DNA, or disruption of interactions among beta -catenin·Tcf and other proteins, such as components of the basal transcription machinery (40). To distinguish these possibilities, we first determined whether alpha -catenin could stably associate with the beta -catenin·Tcf complex (Fig. 5A). alpha -Catenin, beta -catenin, and Tcf-1 were coexpressed in Neuro-2A cells (these cells express low levels of endogenous catenins). Two isoforms of Tcf-1 were used, p45 (Fig. 5A, lanes 1 and 2), which associates with beta -catenin, and p33 (lane 3), which does not. alpha -Catenin co-immune precipitated with p45 Tcf-1 (Fig. 5A, lane 4) but not with p33 Tcf-1 (lane 6). In addition, alpha -catenin did not co-immune precipitate with p45 Tcf-1 in the absence of beta -catenin (lane 5), indicating that alpha -catenin interacts indirectly with Tcf-1 via beta -catenin. Immune precipitates were also prepared from nuclear extracts of SW480 cells and probed for endogenous Tcf-4 (Fig. 5A, lanes 7-10). Two isoforms of Tcf-4 were detected in SW480 cell extracts (lane 7), which likely correspond to Tcf-4B and Tcf-4E (20). As expected, Tcf-4 associated with beta -catenin (lane 8) but not with cadherin (lane 9). Tcf-4 also associated with endogenous alpha -catenin (lane 10). Thus, alpha -catenin can stably associate with the beta -catenin·Tcf complex both in transfected cells and in colon cancer cells.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 5.   alpha -Catenin does not disrupt the beta -catenin·Tcf complex but does block interaction of the beta -catenin·Tcf complex with DNA. A, Neuro-2A cells (lanes 1-6): extract (lane 1) and alpha -catenin immune precipitate (lane 4) from cells expressing p45 Tcf-1, GFP-beta -catenin and GFP-alpha -catenin; extract (lane 2) and alpha -catenin immune precipitate (lane 5) from cells expressing p45 Tcf-1, GFP-alpha -catenin, and GFP; extract (lane 3) and alpha -catenin immune precipitate (lane 6) from cells expressing p33 Tcf-1, GFP-beta -catenin, and GFP-alpha -catenin. SW480 cells (lanes 7-10): extract (lane 7) and beta -catenin (lane 8), cadherin (lane 9), and alpha -catenin (lane 10) immune precipitates. Lanes 1-6 were probed with anti-Tcf-1 antibodies, and lanes 7-10 were probed with anti-Tcf-4 antibodies. The positions of molecular mass markers are indicated by lines to the left and right of lanes 1-6 (67, 43, and 29 kDa) and to the right of lanes 7-10 (83 and 62 kDa). B, gel retardation assays were conducted using extracts from Neuro-2A cells transfected with p45 Tcf-1 (lanes 2-10) and a double-stranded oligonucleotide probe containing a Tcf-binding site (the probe used in lane 2 contains mutations in the Tcf-binding site). Lane 1 contains free probe only. The following proteins were incubated with cell extracts: anti-Tcf-1 antibody (Ab) (lane 4), beta -catenin (lanes 5-10), anti-beta -catenin Ab (lane 6), GST-alpha -catenin (lane 7), GST-alpha C-447 (lane 8), GST-alpha N-228 (lane 9), and anti-GFP Ab (lane 10). This is a representative gel from four independent experiments, all of which showed a similar inhibition of beta -catenin·Tcf·DNA complex formation by GST-alpha -catenin and GST-alpha N-228.

To determine whether alpha -catenin affected the interaction between the beta -catenin·Tcf complex and its DNA target, we conducted gel retardation assays (Fig. 5B). Cell extracts were prepared from Neuro-2A cells that had been transfected with p45 Tcf-1. When the extracts were incubated with a Tcf oligonucleotide probe, a single protein-DNA complex was detected (lane 3) that could be supershifted with an anti-Tcf-1 antibody (lane 4). This complex was not detected in the absence of cell extract (lane 1) or when a mutated Tcf oligonucleotide probe was used (lane 2). Addition of purified beta -catenin shifted the Tcf-1·DNA complex (lane 5), and the shifted complex was shifted further by anti-beta -catenin antibody (lane 6) but not by a nonspecific antibody (lane 10). Interestingly, addition of GST-alpha -catenin abrogated binding of the beta -catenin·Tcf-1 complex to DNA, although it did not affect binding of Tcf-1 to DNA (lane 7). Furthermore, a GST fusion to the N-terminal domain of alpha -catenin (N228, containing the beta -catenin-binding site) also reduced the interaction of the beta -catenin·Tcf-1 complex with DNA (lane 9), whereas a GST fusion to a C-terminal domain of alpha -catenin (C447, which does not bind to beta -catenin) had no effect (lane 8). These results were quantitated by densitometric scanning of this and other representative gels and then adjusting the amount of each beta -catenin·Tcf-1·DNA complex relative to the amount of Tcf-1·DNA complex. The amount of beta -catenin·Tcf-1·DNA complex formed in the presence of GST-alpha -catenin (lane 7) or N228 (lane 9) was between 32 and 50% of the amount of complex formed in the absence of alpha -catenin (lane 5) or in the presence of C447 (lane 8). These results suggest that the association of alpha -catenin with the beta -catenin·Tcf-1 complex reduces the interaction between this complex and DNA. This may account for the inhibitory effects of alpha -catenin on beta -catenin signaling in vivo.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The tumor suppressor function of alpha -catenin is generally believed to result from its role in cell-cell adhesion. However, alpha -catenin may also regulate adhesion-independent functions of beta -catenin. In this report we provide evidence supporting a role for alpha -catenin in the nucleus.

The mechanism by which alpha -catenin overexpression inhibits beta -catenin·Tcf-dependent transcription has been proposed to be by sequestration of beta -catenin in the cytoplasm (11). This seems unlikely, first, because endogenous alpha -catenin and exogenously expressed GFP-alpha -catenin can be found in cell nuclei, and second, because when alpha -catenin is targeted to the nucleus, it inhibits transcriptional activity to the same extent as nontargeted alpha -catenin. Because alpha -catenin associates stably with the beta -catenin·Tcf complex in cells expressing all three proteins, it may inhibit beta -catenin·Tcf transcription by preventing DNA binding. The results of gel retardation experiments (Fig. 5B) support this model, although they do not rule out that alpha -catenin also alters beta -catenin·Tcf interactions with other proteins that regulate transcription in vivo.

alpha -Catenin was present in the nuclei of SW480 and DLD-1 cells but not in the nuclei of HCT116 cells. The reason for this is presently unknown, but it suggests that nuclear localization of alpha -catenin is not determined solely by beta -catenin and that it may be regulated by other mechanisms. Nuclear entry of alpha -catenin may also be regulated in nontransformed cells, for example during Wnt signaling. Sensitive assays may be required to test this, because it may involve transient changes in the localization of a fraction of the total cellular alpha -catenin.

Factors that regulate nuclear entry of alpha -catenin would link signaling events in the cytoplasm to beta -catenin-dependent transcription in the nucleus. One possibility is that alpha -catenin responds to changes in the actin cytoskeleton. alpha -Catenin associates with a number of cytoskeletal proteins including alpha -actinin, vinculin, ZO proteins, and actin (3). The binding of these proteins (except possibly actin; see below) to alpha -catenin does not appear to be necessary for inhibition of transcription, because GFP-alpha Delta -NLS inhibits transcription to a similar extent as GFP-alpha -NLS. However, such interactions may regulate the ability of endogenous alpha -catenin to enter the nucleus and repress transcription.

An interesting possibility is that the effects of alpha -catenin on gene expression involve its ability to bind actin. Actin is normally rapidly exported from the nucleus (41), but it can accumulate there under certain conditions (42), and actin mutants that accumulate in the nucleus reduce cell proliferation (41). Moreover, changes in the level of actin can regulate transcriptional activity (43). alpha -Catenin has two domains that bind actin in vitro, a major site in the C-terminal domain and a second site close to the beta -catenin-binding site (22). Although GFP-alpha Delta -NLS does not contain the major site, it retains the second actin-binding site. Thus, it remains possible that binding to actin plays a part in the effects of alpha -catenin on beta -catenin-dependent transcription.

Our results suggest that the relative levels of beta -catenin·Tcf and alpha -catenin·beta -catenin·Tcf complexes in the nucleus will determine the overall transcriptional activity. Thus, in SW480 cells, where the amount of beta -catenin far exceeds that of alpha -catenin, one would predict that endogenous nuclear alpha -catenin will not significantly affect transcription. In contrast, in DLD-1 cells, which contain far lower levels of beta -catenin than SW480 cells (Fig. 1A), one would predict that loss of alpha -catenin would result in increased beta -catenin·Tcf transcriptional activity. This appears to be the case because Tcf-dependent activity in DLD alpha - cells is 30% higher than in any of the other DLD cell lines (Fig. 2C). These results were obtained using TopFlash and FopFlash reporter plasmids. Because the basal (Tcf-independent) activity measured by FopFlash can be high in some cells (30), the apparent Tcf-dependent transcriptional activities calculated (determined as the ratio of TopFlash and FopFlash measurements) may obscure differences in Tcf-specific activity among the cell lines. We have also compared Tcf-dependent transcriptional activity using the optimized OT and OF reporter plasmids (30). The low basal (Tcf-independent) activity measured using OF results in a more accurate calculation of Tcf-dependent activity (as determined by the ratio of OT and OF measurements). The activity in DLD alpha - cells is 50% higher than in the other DLD cell lines when measured using the OT and OF reporters, confirming the results obtained using TopFlash/FopFlash.2 To date we have been unable to examine the effect of loss of endogenous alpha -catenin on beta -catenin signaling in other colon cancer cell lines because there are no other cells known to have mutations both in alpha -catenin and in either beta -catenin or APC.

The expression of alpha -catenin is often reduced during tumor progression (17), and several cancer-derived cell lines have mutations in the alpha -catenin gene. Reintroduction of alpha -catenin into such lines reduces cell growth (18) and attenuates tumor formation (19). Furthermore, DLD-1 cells that have lost alpha -catenin expression are more invasive than the parental cell line (44). An important question that will be addressed in the future is whether the increased invasiveness of DLD alpha - cells is due to a reduction in cell adhesion or to an increase in beta -catenin·Tcf transcription activity. Interestingly, in a recent study of samples from colorectal carcinoma patients (45), many of the tumors examined had reduced expression of either E-cadherin (29%) or alpha -catenin (56%), but increased tumor cell invasion and metastasis correlated with reduced expression of alpha -catenin. This suggests that alpha -catenin may function in an adhesion-independent manner to regulate invasion and metastasis. All the results presented in this report were obtained using cultured cells, and therefore, further analysis will be required to determine whether similar mechanisms operate in vivo. If this proves to be the case and if the effects of alpha -catenin on cell adhesion and transcriptional activity are separable, the targeted expression of alpha -catenin to the nucleus may be a useful approach for treating cancer cells that have activating mutations in the Wnt signaling pathway.

    ACKNOWLEDGEMENTS

We are grateful to the following for reagents: Vania Braga, Hans Clevers, Louis Reichardt, Christine Petit, David Rimm, and Marc van de Wetering. We also thank Josephine Adams, Alan Ashworth, and Alan Hall for comments on the manuscript.

    FOOTNOTES

* This work was supported in part by a Career Development Fellowship from the Wellcome Trust (to R. K.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: MRC LMCB, University College London, Gower St., London WC1E 6BT, UK. Tel.: 0207-679-7817; Fax: 0207-679-7805; E-mail: r.kypta@ucl.ac.uk.

Published, JBC Papers in Press, March 12, 2000, DOI 10.1074/jbc.M001929200

2 A. L. Giannini, M. d. M. Vivanco, and R. M. Kypta, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: Tcf, T-cell factor; LEF, lymphoid enhancer factor; APC, adenomatous polyposis coli; GFP, green fluorescent protein; NLS, nuclear localization signal; GST, glutathione S-transferase; RSV, Rous sarcoma virus; PBS, phosphate-buffered saline.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Wodarz, A., and Nusse, R. (1998) Annu. Rev. Cell Dev. Biol. 14, 59-88
2. Eastman, Q., and Grosschedl, R. (1999) Curr. Opin. Cell Biol. 11, 233-240
3. Provost, E., and Rimm, D. L. (1999) Curr. Opin. Cell Biol. 11, 567-572
4. Fagotto, F., Gluck, U., and Gumbiner, B. M. (1998) Curr. Biol. 8, 181-190
5. Yokoya, F., Imamoto, N., Tachibana, T., and Yoneda, Y. (1999) Mol. Biol. Cell 10, 1119-1131
6. Gallet, A., Angelats, C., Erkner, A., Charroux, B., Fasano, L., and Kerridge, S. (1999) EMBO J. 18, 2208-17
7. Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K. W. (1997) Science 275, 1787-1790
8. Rubinfeld, B., Robbins, P., El-Gamil, M., Albert, I., Porfiri, E., and Polakis, P. (1997) Science 275, 1790-1792
9. Ilyas, M., Tomlinson, I. P., Rowan, A., Pignatelli, M., and Bodmer, W. F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10330-10334
10. Ishitani, T., Ninomiya-Tsuji, J., Nagai, S., Nishita, M., Meneghini, M., Barker, N., Waterman, M., Bowerman, B., Clevers, H., Shibuya, H., and Matsumoto, K. (1999) Nature 399, 798-802
11. Simcha, I., Shtutman, M., Salomon, D., Zhurinsky, J., Sadot, E., Geiger, B., and Ben-Ze'ev, A. (1998) J. Cell Biol. 141, 1433-1448
12. Giannini, A. L., Vivanco, M. d. M., and Kypta, R. M. (2000) Exp. Cell Res. 255, 207-220
13. Aberle, H., Butz, S., Stappert, J., Weissig, H., Kemler, R., and Hoschuetzky, H. (1994) J. Cell Sci. 107, 3655-3663
14. Jou, T. S., Stewart, D. B., Stappert, J., Nelson, W. J., and Marrs, J. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5067-5071
15. Hirano, S., Kimoto, N., Shimoyama, Y., Hirohashi, S., and Takeichi, M. (1992) Cell 70, 293-301
16. Torres, M., Stoykova, A., Huber, O., Chowdhury, K., Bonaldo, P., Mansouri, A., Butz, S., Kemler, R., and Gruss, P. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 901-906
17. Hirohashi, S. (1998) Am. J. Pathol. 153, 333-339
18. Watabe, M., Nagafuchi, A., Tsukita, S., and Takeichi, M. (1994) J. Cell Biol. 127, 247-256
19. Bullions, L. C., Notterman, D. A., Chung, L. S., and Levine, A. J. (1997) Mol. Cell. Biol. 17, 4501-4508
20. Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W., Vogelstein, B., and Clevers, H. (1997) Science. 275, 1784-1787
21. Claverie, J. M., Hardelin, J. P., Legouis, R., Levilliers, J., Bougueleret, L., Mattei, M. G., and Petit, C. (1993) Genomics 15, 13-20
22. Rimm, D. L., Koslov, E. R., Kebriaei, P., Cianci, C. D., and Morrow, J. S. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8813-8817
23. Sehgal, R. N., Gumbiner, B. M., and Reichardt, L. F. (1997) J. Cell Biol. 139, 1033-1046
24. Fischer-Fantuzzi, L., and Vesco, C. (1988) Mol. Cell. Biol. 8, 5495-5503
25. Ozawa, M. (1998) J. Biol. Chem. 273, 29524-29529
26. Kypta, R. M., Su, H., and Reichardt, L. F. (1996) J. Cell Biol. 134, 1519-1529
27. Castrop, J., van Wichen, D., Koomans-Bitter, M., van de Wetering, M., de Weger, R., van Dongen, J., and Clevers, H. (1995) Blood 86, 3050-3059
28. Barker, N., Huls, G., Korinek, V., and Clevers, H. (1999) Am. J. Pathol. 154, 29-35
29. Vivanco, M. D., Johnson, R., Galante, P. E., Hanahan, D., and Yamamoto, K. R. (1995) EMBO J. 14, 2217-2228
30. da Costa, L. T., He, T. C., Yu, J., Sparks, A. B., Morin, P. J., Polyak, K., Laken, S., Vogelstein, B., and Kinzler, K. W. (1999) Oncogene 18, 5010-5014
31. Weiss, E. E., Kroemker, M., Rudiger, A. H., Jockusch, B. M., and Rudiger, M. (1998) J. Cell Biol. 141, 755-764
32. Watabe-Uchida, M., Uchida, N., Imamura, Y., Nagafuchi, A., Fujimoto, K., Uemura, T., Vermeulen, S., van Roy, F., Adamson, E. D., and Takeichi, M. (1998) J. Cell Biol. 142, 847-857
33. Nieset, J. E., Redfield, A. R., Jin, F., Knudsen, K. A., Johnson, K. R., and Wheelock, M. J. (1997) J. Cell Sci. 110, 1013-1022
34. Itoh, M., Nagafuchi, A., Moroi, S., and Tsukita, S. (1997) J. Cell Biol. 138, 181-192
35. Huber, O., Krohn, M., and Kemler, R. (1997) 110, 1759-1765
36. Obama, H., and Ozawa, M. (1997) J. Biol. Chem. 272, 11017-11020
37. Koslov, E. R., Maupin, P., Pradhan, D., Morrow, J. S., and Rimm, D. L. (1997) J. Biol. Chem. 272, 27301-27306
38. Tetsu, O., and McCormick, F. (1999) Nature 398, 422-426
39. Shtutman, M., Zhurinsky, J., Simcha, I., Albanese, C., D'Amico, M., Pestell, R., and Ben-Ze'ev, A. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 5522-5527
40. Hecht, A., Litterst, C. M., Huber, O., and Kemler, R. (1999) J. Biol. Chem. 274, 18017-18025
41. Wada, A., Fukuda, M., Mishima, M., and Nishida, E. (1998) EMBO J. 17, 1635-1641
42. Nishida, E., Iida, K., Yonezawa, N., Koyasu, S., Yahara, I., and Sakai, H. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 5262-5266
43. Sotiropoulos, A., Gineitis, D., Copeland, J., and Treisman, R. (1999) Cell 98, 159-169
44. Vermeulen, S. J., Bruyneel, E. A., Bracke, M. E., De Bruyne, G. K., Vennekens, K. M., Vleminckx, K. L., Berx, G. J., van Roy, F. M., and Mareel, M. M. (1995) Cancer Res. 55, 4722-4728
45. Gofuku, J., Shiozaki, H., Tsujinaka, T., Inoue, M., Tamura, S., Doki, Y., Matsui, S., Tsukita, S., Kikkawa, N., and Monden, M. (1999) Am. J. Clin. Pathol. 111, 29-37


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
J. D. Ahlstrom and C. A. Erickson
The neural crest epithelial-mesenchymal transition in 4D: a `tail' of multiple non-obligatory cellular mechanisms
Development, June 1, 2009; 136(11): 1801 - 1812.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
W.-H. Lien, O. Klezovitch, M. Null, and V. Vasioukhin
{alpha}E-catenin is not a significant regulator of {beta}-catenin signaling in the developing mammalian brain
J. Cell Sci., May 1, 2008; 121(9): 1357 - 1362.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Shibata, H. Takano, M. Ito, H. Shioya, M. Hirota, H. Matsumoto, Y. Kakudo, C. Ishioka, T. Akiyama, Y. Kanegae, et al.
{alpha}-Catenin is essential in intestinal adenoma formation
PNAS, November 13, 2007; 104(46): 18199 - 18204.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Chen, H.-X. Yan, J. Chen, W. Yang, Q. Liu, B. Zhai, H.-F. Cao, S.-Q. Liu, M.-C. Wu, and H.-Y. Wang
Negative Regulation of c-Myc Transcription by Pancreas Duodenum Homeobox-1
Endocrinology, May 1, 2007; 148(5): 2168 - 2180.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. A. Scott and A. S. Yap
Cinderella no longer: {alpha}-catenin steps out of cadherin's shadow
J. Cell Sci., November 15, 2006; 119(22): 4599 - 4605.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
K. Willert and K. A. Jones
Wnt signaling: is the party in the nucleus?
Genes & Dev., June 1, 2006; 20(11): 1394 - 1404.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-G. Hwang, S.-S. Yu, J.-H. Ryu, H.-B. Jeon, Y.-J. Yoo, S.-H. Eom, and J.-S. Chun
Regulation of {beta}-Catenin Signaling and Maintenance of Chondrocyte Differentiation by Ubiquitin-independent Proteasomal Degradation of {alpha}-Catenin
J. Biol. Chem., April 1, 2005; 280(13): 12758 - 12765.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Zhu, M. Mazor, Y. Kawano, M. M. Walker, H. Y. Leung, K. Armstrong, J. Waxman, and R. M. Kypta
Analysis of Wnt Gene Expression in Prostate Cancer: Mutual Inhibition by WNT11 and the Androgen Receptor
Cancer Res., November 1, 2004; 64(21): 7918 - 7926.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. J. Gottardi and B. M. Gumbiner
Distinct molecular forms of {beta}-catenin are targeted to adhesive or transcriptional complexes
J. Cell Biol., October 25, 2004; 167(2): 339 - 349.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
F. H. Brembeck, T. Schwarz-Romond, J. Bakkers, S. Wilhelm, M. Hammerschmidt, and W. Birchmeier
Essential role of BCL9-2 in the switch between {beta}-catenin's adhesive and transcriptional functions
Genes & Dev., September 15, 2004; 18(18): 2225 - 2230.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. D. Merdek, N. T. Nguyen, and D. Toksoz
Distinct Activities of the {alpha}-Catenin Family, {alpha}-Catulin and {alpha}-Catenin, on {beta}-Catenin-Mediated Signaling
Mol. Cell. Biol., March 15, 2004; 24(6): 2410 - 2422.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Piedra, S. Miravet, J. Castano, H. G. Palmer, N. Heisterkamp, A. Garcia de Herreros, and M. Dunach
p120 Catenin-Associated Fer and Fyn Tyrosine Kinases Regulate {beta}-Catenin Tyr-142 Phosphorylation and {beta}-Catenin-{alpha}-Catenin Interaction
Mol. Cell. Biol., April 1, 2003; 23(7): 2287 - 2297.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. Mareel and A. Leroy
Clinical, Cellular, and Molecular Aspects of Cancer Invasion
Physiol Rev, April 1, 2003; 83(2): 337 - 376.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. J. Chung, S.-G. Hwang, P. Nguyen, S. Lee, J.-S. Kim, J. W. Kim, P. A. Henkart, D. P. Bottaro, L. Soon, P. Bonvini, et al.
Regulation of leukemic cell adhesion, proliferation, and survival by beta -catenin
Blood, July 18, 2002; 100(3): 982 - 990.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
N. A. C. S. Wong and M. Pignatelli
{beta}-Catenin--A Linchpin in Colorectal Carcinogenesis?
Am. J. Pathol., February 1, 2002; 160(2): 389 - 401.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/29/21883    most recent
M001929200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giannini, A. L.
Right arrow Articles by Kypta, R. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giannini, A. L.
Right arrow Articles by Kypta, R. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement