| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 29, 21914-21919, July 21, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, March 23, 2000, and in revised form, April 19, 2000
The sequences of nitric-oxide synthase (NOS)
flavin domains closely resemble that of NADPH-cytochrome P450 reductase
(CPR), with the exception of a few regions. One such region is the C terminus; all NOS isoforms are 20-40 amino acids longer than CPR, forming a "tail" that is absent in CPR. To investigate its
function, we removed the 21-amino acid C-terminal tail from murine
macrophage inducible NOS (iNOS) holoenzyme and from a flavin domain
construct. Both the truncated holoenzyme and reductase domain exhibited
cytochrome c reductase activities that were 7-10-fold
higher than the nontruncated forms. The truncated holoenzyme catalyzed
NO formation approximately 20% faster than the intact form. Using
stopped-flow spectrophotometry, we demonstrated that electron transfer
into and between the two flavins and from the flavin to the heme domain
is 2-5-fold faster in the absence of the C-terminal tail. The
heme-nitrosyl complex, formed in all NOS isoforms during NO catalysis,
is 5-fold less stable in truncated iNOS. Although both CPR and intact
NOS can exist in a stable, one electron-reduced semiquinone form,
neither the truncated holoenzyme nor the truncated flavin domain
demonstrate such a form. We propose that this C-terminal tail curls
back to interact with the flavin domain in such a way as to modulate
the interaction between the two flavin moieties.
Nitric oxide synthases
(NOSs)1 produce NO from
L-arginine through a series of monooxygenation reactions
(for review, see Refs. 1-3). The three isoforms, nNOS, iNOS, and eNOS,
produce NO by the same mechanism but play very different physiological
roles due to the type of cell in which they are located. nNOS, located in neurons in the brain and at neuromuscular junctions, is involved in
neurotransmission (4, 5); iNOS, located in macrophages, is involved in
the immune response (6, 7); and eNOS, located in endothelial cells, is
involved in hemodynamic regulation (8, 9). The NO produced by nNOS and
eNOS exerts its effects through the stimulation of guanylate cyclase,
whereas the NO produced by iNOS exerts its effects directly or by
combining with superoxide to form peroxynitrite, both of which are free
radicals that harm proteins and DNA.
The NOSs consist of two domains, a heme and
(6R)-5,6,7,8-tetrahydrobiopterin
(H4B)-containing oxygenase (or heme) domain, which binds
the substrate L-arginine and a flavin-containing reductase (or flavoprotein) domain, which binds the flavins FAD and FMN as
prosthetic groups and the cofactor NADPH. A calmodulin binding region
bisects the two domains. Calmodulin is required for NO production, and
its binding is dependent on cellular calcium levels. Two of the
isoforms (nNOS and eNOS) are constitutive; induction of NO synthesis
activity requires an influx of calcium to promote calmodulin binding
(5, 10). The iNOS enzyme is induced at the transcriptional level, and
calmodulin is bound even at basal calcium concentrations (11).
At the time Bredt and Snyder (5) reported the cloning of the first
nitric-oxide synthase isoform (nNOS), they noted the similarity of the
sequence of the carboxyl half of the protein with cytochrome P450
reductase (CPR). Subsequently, a heme moiety was discovered to be the
active site in the amino half of the enzyme, and attention has focused
primarily on the elucidation of catalysis in that domain (for review,
see Ref. 12). Although the three isoforms are about 50-60% identical
at the amino acid level (13), recently published crystal structures of
the heme domains of the iNOS, eNOS, and nNOS isoforms demonstrate very minor structural differences (Refs.
14-17),2 yet these isoforms
catalyze NO synthesis at vastly differing rates. The reductase domains
of NOSs are structurally similar to the NADPH-cytochrome P450 reductase
(CPR), with the nNOS flavoprotein domain sharing 36% identity and 58%
close homology at the amino acid level (18). Like those of CPR, the
flavins of NOSs can also transfer electrons to artificial electron
acceptors, such as cytochrome c,
2,6-dichlorophenolindophenol, and ferricyanide (19, 20); these rates of
reduction also differ very greatly from CPR and between the NOS isoforms.
To account for such differences in what are otherwise very homologous
structures, attention was focused on the search for control mechanisms
in several regions that exist in the flavin domains of NOSs that have
no counterpart in CPR. A putative autoinhibitory domain described by
Salerno et al. (21), consisting of about 45 amino acids
located in the middle of the FMN binding region, is present in the
constitutive NOSs (nNOS and eNOS) but is absent in iNOS and CPR. This
autoinhibitory domain was proposed to control the calmodulin
binding/activation of the constitutive isoforms. Also, nNOSµ, present
in skeletal muscle myotendinous junctions (22), contains 34 additional
amino acids in the FMN-containing subdomain of nNOS in an alternatively
processed form of the nNOS gene (23). The function of this additional
segment remains unknown. Each of the NOS isoforms contains about 21-42
additional amino acids at the C terminus (42, 33, and 21 amino acids in
bovine eNOS, rat nNOS, and murine iNOS, respectively), forming a tail that is not present in CPR. Xie et al. (24) show that
deletion of 22 or 23 residues from the C terminus of iNOS, which
removed the tail plus 1 or 2 additional residues, reduced the rate of NO synthesis 26% or 66%, respectively. To investigate the functional role of the additional 21 residues at the C terminus of the NOS isoforms, we have removed them from the iNOS holoenzyme and from an
expressed iNOS reductase domain and compared the resulting enzymes to
the intact proteins. The mechanistic implications of this deletion are discussed.
Chemicals--
H4B was from Research Biochemicals
International (Natick, MA), and all other chemicals were obtained from
Sigma and were of the highest grade available.
Enzymes--
Pfu turbo polymerase was from Stratagene
(La Jolla, CA); ligase and restriction enzymes were purchased from
either Promega (Cambridge, MA) or New England Biolabs (Boston, MA).
Shrimp alkaline phosphatase was from U. S. Biochemical Corp.
Plasmids--
The murine macrophage iNOS cDNA was provided
by Drs. Solomon Snyder and David Bredt at Johns Hopkins Medical School,
Baltimore, MD. The plasmid CaMpACMIP, containing rat calmodulin
cDNA, was from Dr. Anthony Persechini at the University of
Rochester in Rochester, NY. PCWori+ was given by Dr.
Michael Waterman at Vanderbilt University in Nashville, TN.
Recombinant DNA Manipulations--
iNOSpCW-tr1, the plasmid for
the expression of the truncated iNOS (residues 1-1123) in
Escherichia coli, and iNOSred-tr1, the plasmid for the
expression of the truncated iNOS reductase domain in E. coli
(residues 499-1123), were constructed as follows. For iNOS-tr1, the
initial 1123 codons of pmacNOS (from the ATG start codon to the final
residue minus 21) were amplified by polymerase chain reaction to
incorporate the recognition sequence for NdeI. Primer tr1-1
(upstream primer, with NdeI site) was 5'-TGCTTAGGAGGTCATATG -3', and primer tr1-2 (return primer) was 5'-
CAGTCAAGCTTAACCGAAGATATCTTCATG -3'. For iNOSred-tr1, the nucleotides
encoding residues 499 to 1123 of pmacNOS (from the codons of the
beginning of the calmodulin binding site to the final residue minus 21)
were amplified by polymerase chain reaction to incorporate the
recognition sequence for NdeI and six histidine codons for
ease of purification. Primer redtr1-1 (upstream primer, with
NdeI site) was
5'-GGGAATTCCATATGGCTCACCACCACCACCACCACAAGCTGAGGCCCAGGAGG-3', and
primer redtr1-2 (return primer) was
5'-CAGTCAAGCTTAACCGAAGATATCTTCATG-3'. Primers were synthesized by the
Center for Advanced DNA Technologies at the University of Texas Health
Science Center at San Antonio. Reaction mixtures included 50 pmol of
each primer, 20 ng of macNOS template, 200 µM dNTPs, 1×
Pfu turbo polymerase buffer, and 2.5 units Pfu
turbo polymerase in 50 µl total volume. The mixture was preincubated
for 1 min at 94 °C before the addition of Pfu turbo
polymerase, followed by amplification for 18 cycles: 95 °C for
45 s, 55 °C for 60 s, and 68 °C for 10 m. The
polymerase chain reaction product was gel-purified using the
GeneClean II kit (Bio101, Vista, CA) and digested with
NdeI and HindIII. PCWori+ DNA was
digested with NdeI and HindIII, and the ends were
dephosphorylated. The two pieces were ligated, and the resultant
products were used to transform E. coli XL10-gold competent
cells (Stratagene) using the manufacturer's instructions. Positive
colonies were identified by restriction digest analysis of plasmid DNA
isolated from small (2 ml) cultures of select colonies.
The plasmid CaMpACMIP was co-transformed with iNOSpCW-tr1 or
iNOSred-tr1 into E. coli BL21 cells via electroporation
using an Invitrogen Electroporator II (San Diego, CA) according to the manufacturer's instructions and plated on LB agar containing 50 µg/ml ampicillin and 35 µg/ml chloramphenicol.
Protein Expression/Purification--
Protein expression and
purification are as described in Roman et al. (25) for iNOS
and iNOS-tr1 and in McMillan and Masters (26) for iNOSred and
iNOSred-tr1. The iNOS-tr1 and iNOSred-tr1 proteins were purified in
tandem with holo iNOS and iNOSred, respectively, to reduce differences
resulting from preparation to preparation.
Spectrophotometric Methods--
Absolute spectra and CO
difference spectra were performed as described (25, 26). The molar
protein concentrations for iNOS and iNOS-tr1 were determined based on
heme content via reduced CO difference spectra, where Stopped-flow Spectroscopy--
Stopped-flow reactions were
performed aerobically under turnover conditions at 23 °C, as
described in Miller et al. (19), using an Applied
Photophysics SX.18 MV diode array stopped-flow spectrophotometer, which
had a dead time of 2 ms. Reactions contained 3 µM enzyme,
100 µM NADPH, 10 µM H4B, and
100 µM L-arginine in 50 mM HEPES,
pH 7.4. When the reductase domain constructs were used,
L-arginine and H4B were omitted. Heme reduction
was monitored at 397 nm, and heme-nitrosyl complex formation was
monitored at 436 nm. Flavin reduction was monitored at 485 nm rather
than the absorption peak value at 455 nm to avoid spectral
contamination from the heme.
Measurement of Activity--
Nitric oxide formation (hemoglobin
capture assay) and cytochrome c reduction were measured at
23 °C as described by Sheta et al. (20), with the
exception that the cytochrome c reduction assays were
performed in a buffer containing 50 mM HEPES, pH 7.4, in
the absence of NaCl.
Oxidation of NADPH was monitored at 340 nm in the presence of 50 mM HEPES, pH 7.4, 100 µM NADPH, and 500 nM enzyme (iNOSred or iNOSred-tr1) at 23 °C. The rate
was determined using an extinction coefficient of 6.2 mM
The reoxidation of reduced flavins was monitored at 485 nm for both
holoenzymes and reductase domains in the presence of 50 mM
HEPES, pH 7.4, 20 µM NADPH, and 2 µM enzyme
at 23 °C.
The ability of the truncated enzymes to catalyze the reduction of
cytochrome c was examined, and the results are shown in Table I. Both the wild type iNOS and its
reductase domain catalyze the reduction of cytochrome c at
the same rate, approximately 3000 min The rate of cytochrome c reduction by iNOS-tr1 was not
attenuated in the presence of superoxide dismutase and catalase (Table I), indicating that electrons were being transferred directly to the
cytochrome c and not to oxygen to form superoxide, which can
also reduce cytochrome c. This observation supports the
contention that the increased rate of cytochrome c reduction
of iNOS-tr1 is due to an increased rate of electron transfer from NADPH
through the NOS flavins directly to the heme of cytochrome c
and not a result of mediation by superoxide.
In the absence of a protein electron acceptor, CPR and the NOS flavin
domains will shuttle electrons directly to molecular oxygen to form
superoxide, albeit at a slower rate. As an indirect measurement of this
process, NADPH oxidation by iNOSred and iNOSred-tr1 was
monitored. iNOSred consumed NADPH at a rate of 2.1 min In view of the increased rate of electron transfer to the heme of
cytochrome c, we examined whether iNOS-tr1 also had the ability to transfer electrons more rapidly from its flavins to its
heme. Initially, the rate of NO production was measured. As shown in
Table I, a difference exists in the rate of NO production between holo
iNOS and iNOS-tr1. Although the rate of NO production by iNOS-tr1 was
slightly but consistently higher, the difference is not as dramatic as
that of cytochrome c reduction. This indicates that, whereas
the rate-limiting step for cytochrome c reduction by holo
iNOS is determined by its flavin domain, that of NO production is not.
That is, the heme of cytochrome c is able to accept
electrons as fast as NOS can transfer them; this is supported by the
observation that the ratio of cytochrome c reduced to NADPH
oxidized is 1:1 (data not shown). The rate of electron transfer to the
heme of NOS, however, is regulated differently; the flavin domain is
able to transfer electrons much faster than the heme is able to accept them. This agrees with Miller et al. (19), who have
concluded that the flavoprotein to heme electron transfer is
rate-determining for initial NO production in all NOS isoforms.
To examine flavin and heme reduction of holo iNOS and iNOS-tr1 more
directly, we used stopped-flow spectrophotometry under turnover
conditions. Spectral changes were monitored at 485 nm (flavin
reduction), 397 nm (heme reduction), and 436 nm (heme-nitrosyl complex
formation) following rapid mixing of NOS with NADPH. The spectral
traces are shown in Fig. 1, and the
actual rate constants derived from these data are shown in Table
II. The rates for iNOS and iNOS-tr1 heme
and flavin reduction are biphasic, consisting of an initial fast phase
followed by a secondary slow phase. The biphasic nature of these curves
and the derived rates for holo iNOS are similar to those reported by
Miller et al. (19).
The C Terminus of Mouse Macrophage Inducible Nitric-oxide
Synthase Attenuates Electron Flow through the Flavin Domain*
§,,,§
Department of Biochemistry, The University
of Texas Health Science Center, San Antonio, Texas 78229 and the
¶ Department of Biochemistry, Medical College of Wisconsin,
Milwaukee, Wisconsin 53226
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
= 100 mM
1 cm1
for 
A445-470; those for iNOSred and
iNOSred-tr1 were based on total flavin concentration and = 21 mM1 cm1
at 455 nm. All spectral analyses were performed using a Shimadzu model
2101 UV/visible dual-beam spectrophotometer.
1 at 340 nm for NADPH.
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
1; for
comparison, CPR also reduces cytochrome c at the same rate, i.e. 3000 min1 (not shown). The
C-terminal-truncated enzymes, however, reduce cytochrome c
at a rate 7-10-fold higher than the intact proteins. Thus, the removal
of 21 residues from the C terminus of the reductase domain greatly
potentiates the ability of iNOS holoenzyme and iNOSred to reduce
cytochrome c.
Catalytic activities of iNOS and iNOS C-terminal-truncated enzymes
1, whereas iNOSred-tr1 consumed NADPH at
9.0 min1, an increase of 5-fold. Thus, the
removal of 21 residues from the C terminus also potentiates the ability
of iNOSred to form superoxide. The rate of electron transfer to
molecular oxygen is so slow in either case, however, that the formation
of superoxide cannot be contributing significantly to cytochrome
c reduction, in agreement with the inability of superoxide
dismutase to change the reaction rate.
View larger version (28K):
[in a new window]
Fig. 1.
Stopped-flow kinetic spectrophotometry of
iNOS and iNOS C-terminal-truncated enzymes under turnover
conditions. The reaction contained 3 µM enzyme, 100 µM L-arginine, 10 µM
H4B, 100 µM NADPH, and 50 mM
HEPES, pH 7.4. The curves shown are the average of 4-5 experiments.
The experimental fits for heme reduction and heme-nitrosyl complex
formation excluded the initial decrease in absorbance (5-20 ms,
indicated by the vertical line in each graph),
which is a spectral contribution by the flavins. The curves for flavin
and heme reduction were best fit by a double-exponential curve, whereas
that of heme-nitrosyl complex formation was best fit by a single
exponential curve. The smooth line is the theoretical fit.
Note that the time scale for all the curves is 0-100 ms, except for
iNOS heme-nitrosyl complex formation (436 nm), which is 0-70 ms. The
experiments were performed as described under "Experimental
Procedures."
Rates of electron transfer of iNOS and iNOS C-terminal-truncated
enzymes under turnover conditions
1. The values
reported for the holo wild type and truncated enzymes are derived from
the traces shown in Fig. 1. All numbers are the average of 4-5
experiments and are the mean ± S.E. The curves for flavin and
heme reduction were best fit by a double-exponential curve, whereas
those of heme-nitrosyl complex formation were best fit by a single
exponential curve. The experiments were performed under turnover
conditions as described under "Experimental Procedures."
The data in Table II clearly show that flavin reduction is far faster than heme reduction (5-10-fold). Since the flow of electrons is from NADPH to FAD to FMN and finally to the heme (27), the rate of reduction of the flavins and intramolecular transfer between them are certainly not limiting the rate of heme reduction, similar to the mechanism displayed by CPR (28). The initial fast phase of flavin reduction most likely represents the conversion of the fully oxidized flavoprotein to the fully reduced and semiquinone forms. This process consists of the transfer of electrons from NADPH to the FAD moiety followed by the transfer of electrons to FMN at a rate as fast as, if not faster than, that of transfer from NADPH to the first flavin (29). Since the transfer of electrons from FAD to FMN is so fast, the rate of the fast phase most likely reflects the rate of electron transfer from NADPH to FAD. The slower, second phase seen in the stopped-flow measurement of flavin reduction is much slower than the rate of heme reduction, too slow to be involved in transfer of electrons to the heme domain, and thereby likely represents the comproportionation of electrons, including forward and back reactions between the flavins. Table II shows that iNOS and iNOS-tr1 differ with respect to both phases of flavin reduction, with iNOS-tr1 exhibiting rates 2× and 5× those of iNOS for the fast and slow phases, respectively, consistent with the 10-fold increase observed in cytochrome c reduction. Similar data are obtained with the corresponding reductase domain enzymes (Table II). The rates of the fast and slow phases are 1.5-fold and 5.4-fold higher, respectively, for iNOSred-tr1 over iNOSred. Thus, the transfer of electrons to FAD (fast phase) and the shuffling of electrons between the flavin prosthetic groups (slow phase) are both faster in the absence of the C-terminal tail.
Once NADPH is exhausted and catalysis stops, the enzyme returns
eventually to its resting, fully oxidized state but only after a
transient period in a partially reduced state. In studies with nNOS,
Miller et al. (19) and Noble et al. (30)
demonstrate the formation of an air stable, one electron-reduced
semiquinone that cannot reduce either its own heme or that of
cytochrome c and that persists for about 20 min before
reverting to the fully oxidized state (not shown). This redox behavior
is reminiscent of that observed with CPR, the flavoprotein with which
it shares substantial sequence homology in the flavin domain. This fact has led to speculation that the flavoprotein domain of NOS operates through a similar, if not identical, mechanism to that of CPR (2). To
determine whether the C-terminal tail affects this process, the rate of
flavin reoxidation was examined for the intact and truncated enzymes
using the reductase domain constructs (iNOSred and iNOSred-tr1) to
avoid signal contamination by the heme domain. Flavin reoxidation was
monitored at 485 nm and appears as an increase in flavin absorbance as
the reaction begins with fully reduced flavins (Fig.
2). As shown in Fig. 1, flavin reduction
occurs very quickly, on the order of ms. Since these flavin reoxidation experiments were performed in a standard rather than stopped-flow spectrophotometer, flavin reduction was already complete at the start
of the reaction, having occurred during the approximately 10 s
between mixing components and the start of absorbance monitoring. The
initial, zero absorbance represents fully reduced flavins catalyzing
the oxidation of NADPH. After the NADPH is exhausted, flavin
reoxidation, seen as an absorbance increase, occurs. NADPH is utilized
5-fold faster by iNOSred-tr1 than iNOSred, as discussed above regarding
superoxide production and as reflected by the 5-fold longer lag before
the absorbance increase seen for iNOSred. The absorbance change
plateaus, representing the air-stable form of the flavins. In Fig. 2,
the amplitude of the signal for iNOSred tr-1 is twice that of iNOSred,
indicating that, although iNOSred initially forms the stable, one
electron-reduced semiquinone, iNOSred-tr1 does not, instead becoming
fully oxidized. This behavior is also observed with the holo iNOS and
iNOS-tr1 (not shown). The slope of the line represents the rate of
flavin oxidation and it is clear that this rate for iNOSred-tr1 is
twice that of iNOSred, which is consistent with both flavins being
rapidly and fully oxidized rather than just one, as in the semiquinone
form. To directly address this difference between holo and truncated enzymes, the same reaction was performed but monitored at 585 nm, which
specifically measures the neutral semiquinone form (28). For iNOSred,
the semiquinone form accumulates steadily until it reaches a plateau at
about 180 s, which persists for the remaining 120 s of the
experiment (data not shown). This is entirely consistent with the data
shown in Fig. 2, where the change in absorbance reflecting reoxidation
of one flavin occurs between 170 and 210 s. With iNOSred-tr1, such
an accumulation and persistence are not seen.
|
The reduction of heme in iNOS is also a biphasic reaction and,
interestingly, is unique to this isoform. nNOS and eNOS heme reduction
are both monophasic under the conditions of our experiments (19). It is
evident from the data in Table II that there are only small differences
in heme reduction between iNOS and iNOS-tr1, with the fast and slow
phases of iNOS-tr1 being 1.2-fold and 2.4-fold higher, respectively,
than those of iNOS. It is unclear what the two phases of the reaction
represent, but perhaps a clue comes from the work of Abu-Soud et
al. (31), who showed that nNOS becomes inactivated during
catalysis due to the rapid formation of a heme-nitrosyl complex between
the enzyme and the NO it generates. This NO can also bind to and
inactivate the ferric form of the enzyme and, although in nNOS the
ferrous form is primarily produced, it is the ferric-NO complex that
predominates in an aerobic environment with iNOS (32). As much as
70-90% of the enzyme may be present in the inactive form during the
steady state. The heme-nitrosyl complex is also formed with eNOS, which
forms the complex the most slowly, whereas iNOS forms it the most
rapidly of all the isoforms (19). Thus, heme reduction during catalysis
would demonstrate an initial fast phase, because no heme-nitrosyl
complex is present, followed by a slower phase, reflecting both an
equilibrium between free and nitrosyl-complexed heme and the inability
of this nitrosyl-complexed heme to bind oxygen until it dissociates.
Comparing the data in Fig. 1 for wavelengths 397 nm (heme reduction)
and 436 nm (nitrosyl complex formation) shows that there is a lag in
the onset of nitrosyl complex formation of almost 20 ms in the case of
iNOS-tr1, which corresponds with the onset of the second phase of heme
reduction. This behavior is less clear for the wild type enzyme, where
nitrosyl complex formation is faster, and heme reduction is slower; in this case, the lag is about 8 ms. This biphasic behavior in heme reduction thus represents a switch in the rate-limiting step from heme
reduction to the dissociation of the heme-nitrosyl complex (33).
Abu-Soud et al. (34) demonstrate that the off-rate of NO
from the ferric-NO complex of an iNOS heme domain construct is 13 ± 3 s1 (at 10 °C), which is similar to
our value for the slow phase of heme reduction in the holo-enzyme at
25 °C.
As shown in Table II, iNOS forms the heme-nitrosyl complex at a rate of
105 s1, whereas iNOS-tr1 forms this complex
4-fold slower (26 s1). Perhaps the more rapid
flux of electrons into the heme, reflected by the 20% increase in the
fast phase, affects either the association or dissociation of the
heme-nitrosyl complex formation. Thus, these two factors, the increase
in the rate of heme reduction (fast phase) and the decreased formation
and/or destabilization of the heme-nitrosyl complex, which results in
an apparent increase in the slow phase of heme reduction, account for
the slightly higher rate of NO formation of iNOS-tr1 over iNOS.
Although the removal of the C-terminal tail residues has some effect on
the function of the heme domain in this enzyme, the majority of the
effect is obviously in the function of the flavin domain. iNOS-tr1
transfers electrons faster into the FAD from NADPH (fast phase of
flavin reduction) and from the flavin domain to the heme domain (fast
phase of heme reduction) than intact iNOS. The steady-state level of
flavin semiquinone, i.e. a form containing a one
electron-reduced FMN moiety, in the truncated enzymes is very low.
Based on the flow of electrons depicted in Scheme
1, the rate constant of electron transfer
either to the heme (k4) or to FAD
(k3) is necessarily faster in the truncated enzymes than in the intact enzymes. Since the rate of cytochrome c reduction is greatly potentiated in the truncated forms,
the increase must be in k4. This is also
reflected in the higher rate of heme reduction and NO and superoxide
formation by iNOS-tr1. This accelerated electron transfer to the heme
domain also results in a decreased rate of formation or increased rate
of dissociation of the heme-nitrosyl complex.
|
Comproportionation of the electrons between the FMN and FAD, described by the rate constants k2 and k3 and reflected by the slow phase of flavin reduction in the stopped-flow experiments, also varies significantly between the intact and truncated enzymes. Since k2 is extremely fast and k4 is faster in the truncated enzyme than in the intact enzyme, k3 must be decreased in iNOS-tr1.
Interestingly, although the C terminus is also involved in the
stabilization of the one electron-reduced semiquinone form of iNOS,
CPR, which does not have the C-terminal tail and which iNOSred-tr1 was
created to mimic, does form the air-stable one electron-reduced
semiquinone. Thus, whatever role the C-terminal tail plays in the
stabilization of the semiquinone form of iNOS is served differently in
CPR. Although the reductase domains of the NOSs are thought to be very
similar in structure to CPR, there must be differences in the way the
two flavins interact with each other. The FAD binding portion of the
nNOS flavin domain has been crystallized and was shown to be identical
to the FAD domain of CPR (12, 35). However, the C-terminal tail does
not show up in the crystal structure, indicating that it is not an
ordered, but rather a flexible, part of the molecule. It is easy to
imagine that this tail curls back to interact with the flavin domain in such a way as to modulate the interaction between the two flavin moieties, and perhaps interactions between FMN and the heme in cytochrome c, a situation that does not occur in CPR. In the
structure of CPR (36), the two flavin (FAD and FMN) rings are
juxtaposed to each other at their dimethyl benzene rings and form a
wall with an angle of about 150°. Both the N and C termini of the CPR polypeptide lie near the junction of the two flavins; the C terminus lies on one side of the flavin wall (re-face of the FAD ring), whereas
the N terminus lies on the other side of the flavin plane. Therefore,
it is conceivable that the C-terminal tail of the intact iNOS protein
covers the concave side of the flavin wall and modulates both the
distance and angle of the two flavin rings. These, in turn, regulate
the electron flow between the two flavins and also between FMN and
cytochrome c or the heme domain of the NOS protein. It is
also possible that the interface of the two flavin domains is more open
in the NOSs than in CPR and that the C-terminal tail is protecting the
opening of this interface. Without this protective C-terminal overhang,
the air-stable semiquinone, found in both CPR and wild type iNOS, is no
longer stable in the truncated form of iNOS. It should be noted that in
iNOSred, the calmodulin binding domain is included at its N terminus
and that the protein contains a stoichiometric amount of
Ca2+/calmodulin tightly bound to the protein. Thus, this
bound Ca2+/calmodulin lies at the other side of the
flavin-flavin wall (the convex side) and, together with the C-terminal
tail, protects the flavin interface. It remains to be seen whether the
C-terminal tails of the other two NOSs, nNOS and eNOS, which, unlike
iNOS, are modulated by Ca2+/calmodulin, would have a
similar effect on their electron transfer rates. It is also entirely
conceivable that the redox potentials of the flavins in the truncated
form of the enzyme are different from those of the intact proteins.
This work is another of several indications that important modulatory
regions exist in the flavoprotein domains of the NOSs.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Drs. Solomon Snyder, David Bredt, Tony Persechini, and Mike Waterman for the generous gifts of plasmid and cDNAs.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health (NIH) Grant GM52419 and Robert A. Welch Foundation Grant AQ1192 (to B. S. S. M.) and NIH Grant GM52682 (to J.-J. K.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ To whom correspondence should be addressed: Dept. of Biochemistry, The University of Texas Health Science Center, 7703 Floyd Curl Dr., San Antonio, TX 78229. To L. J. Roman: Tel.: 210-567-6979; Fax: 210-567-6984; E-mail: roman@uthscsa.edu. To B. S. Masters: Tel.: 210-567-6627; Fax: 210-567-6984; masters{at}uthscsa.edu.
Published, JBC Papers in Press, April 25, 2000, DOI 10.1074/jbc.M002449200
2 H. Li, P. Martásek, B. S. S. Masters, T. L. Poulos, and C. S. Raman, manuscript in preparation.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: NOS, nitric-oxide synthase; nNOS, rat neuronal NOS; eNOS, bovine endothelial NOS; iNOS, murine macrophage inducible NOS; iNOS-tr1, iNOS with a 21-amino acid truncation at the C terminus; iNOSred, the reductase domain of iNOS; iNOSred-tr1, the reductase domain of iNOSred with a 21-amino acid truncation at the C terminus; CPR, NADPH-cytochrome P450 reductase; H4B, (6R)-5,6,7,8-tetrahydrobiopterin.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
|
|---|
| 1. | Marletta, M. A. (1993) J. Biol. Chem. 268, 12231-12234 |
| 2. | Masters, B. S. S. (1994) Annu. Rev. Nutr. 14, 131-145 |
| 3. | Griffith, O. W., and Stuehr, D. J. (1995) Annu. Rev. Physiol. 57, 707-736 |
| 4. | Garthwaite, J., Charles, S. L., and Chess-Williams, R. (1988) Nature 336, 385-388 |
| 5. | Bredt, D. S., and Snyder, S. H. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 682-685 |
| 6. | Marletta, M. A., Yoon, P. S., Iyengar, R., Leaf, C. D., and Wishnok, J. D. (1988) Biochemistry 27, 8706-8711 |
| 7. | Stuehr, D. J., Gross, S. S., Sakuma, I., Levi, R., and Nathan, C. F. (1989) J. Exp. Med. 169, 1011-1020 |
| 8. | Furchgott, R. F. (1988) in Vasodilation: Vascular Smooth Muscle, Peptides, Autonomic Nerves, and Endothelium (Vanhoutte, P. M., ed) , pp. 401-414, Raven Press, Ltd., New York |
| 9. | Ignarro, L. J., Byrns, R. E., and Woods, K. S. (1988) in Vasodilation: Vascular Smooth Muscle, Peptides, Autonomic Nerves, and Endothelium (Vanhoutte, P. M., ed) , pp. 427-435, Raven Press, Ltd., New York |
| 10. | Forstermann, U., Pollock, J. S., Schmidt, H. H. H. W., Heller, M., and Murad, F. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1788-1792 |
| 11. | Cho, H. J., Xie, Q. W., Calaycay, J., Mumford, R. A., Swiderek, K. M., Lee, T. D., and Nathan, C. (1992) J. Exp. Med. 176, 599-604 |
| 12. | Masters, B. S. S. (2000) in Nitric Oxide (Ignarro, L., ed) , Academic Press, Inc., San Diego, CA, in press |
| 13. | Dinerman, J. L., Lowenstein, C. J., and Snyder, S. H. (1993) Circ. Res. 73, 217-222 |
| 14. | Crane, B. R., Arvai, A. S., Ghosh, D. K., Wu, C., Getzoff, E. D., Stuehr, D. J., and Tainer, J. A. (1998) Science 279, 2121-2126 |
| 15. | Raman, C. S., Li, H., Martásek, P., Král, V., Masters, B. S. S., and Poulos, T. L. (1998) Cell 95, 939-950 |
| 16. | Fischmann, T. O., Hruza, A., Niu, X.-D., Fossetta, J. D., Lunn, C. A., Dolphin, E., Prongay, A. J., Reichert, P., Lundell, D. J., Narula, S. K., and Weber, P. C. (1999) Nat. Struct. Biol. 6, 233-242 |
| 17. | Li, H., Raman, C. S., Glaser, C. B., Blasko, E., Young, T. A., Parkinson, J. F., Whitlow, M., and Poulos, T. L. (1999) J. Biol. Chem. 274, 21276-21284 |
| 18. | Bredt, D. S., Hwang, P. M., Glatt, C. E., Lowenstein, C., Reed, R. R., and Snyder, S. H. (1991) Nature 351, 714-718 |
| 19. | Miller, R. T., Martásek, P., Omura, T., and Masters, B. S. S. (1999) Biochem. Biophys. Res. Commun. 265, 184-188 |
| 20. | Sheta, E., McMillan, K., and Masters, B. S. S. (1994) J. Biol. Chem. 269, 15147-15153 |
| 21. | Salerno, J. C., Harris, D. E., Irizarry, K., Patel, B., Morales, A. J., Smith, S. M. E., Martásek, P., Roman, L. J., Masters, B. S. S., Jones, C. L., Weissman, B. A., Lane, P., Liu, Q., and Gross, S. S. (1997) J. Biol. Chem. 272, 29769-29777 |
| 22. | Chang, W.-J., Iannaccone, S. T., Lau, K. S., Masters, B. S. S., McCabe, T. J., McMillan, K., Padre, R. C., Spenser, M. J., Tidball, J. G., and Stull, J. T. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9142-9147 |
| 23. | Silvagno, F., Xia, H., and Bredt, D. S. (1996) J. Biol. Chem. 271, 11204-11208 |
| 24. | Xie, Q. W., Cho, H., Kashiwabara, Y., Baum, M., Weidner, J. R., Elliston, K., Mumford, R., and Nathan, C. (1994) J. Biol. Chem. 269, 28500-28505 |
| 25. | Roman, L. J., Sheta, E. A., Martásek, P., Gross, S. S., Liu, Q., and Masters, B. S. S. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8428-8432 |
| 26. | McMillan, K., and Masters, B. S. S. (1995) Biochemistry 34, 3686-3693 |
| 27. | Adak, S., Ghosh, S., Abu-Soud, H. M., and Stuehr, D. J. (1999) J. Biol. Chem. 274, 22313-22320 |
| 28. | Yasukochi, Y., Peterson, J. A., and Masters, B. S. S. (1979) J. Biol. Chem. 254, 7097-7104 |
| 29. | Matsuda, H., and Iyanagi, T. (1999) Biochim. Biophys. Acta 1473, 345-355 |
| 30. | Noble, M. A., Munro, A. W., Rivers, S. L., Robledo, L., Daff, S. N., Yellowlees, L. J., Shimizu, T., Sagami, I., Guillemette, G., and Chapman, S. K. (1999) Biochemistry 38, 16413-16418 |
| 31. | Abu-Soud, H. M., Wang, J., Rousseau, D. L., Fukuto, J., Ignarro, L. J., and Stuehr, D. J. (1995) J. Biol. Chem. 270, 22997-23006 |
| 32. | Hurshman, A. R., and Marletta, M. A. (1995) Biochemistry 34, 5627-5634 |
| 33. | Abu-Soud, H. M., Rousseau, D. L., and Stuehr, D. J. (1996) J. Biol. Chem. 271, 32515-32518 |
| 34. | Abu-Soud, H. M., Wu, C., Ghosh, D. K., and Stuehr, D. J. (1998) Biochemistry 37, 3777-3786 |
| 35. | Masters, B. S., Miller, R. T., Martásek, P., Roman, L. J., Nishimura, J. S., Panda, S., Harris, D. E., Horowitz, P. M., Shea, T. M., Salerno, J. C., Zhang, J., and Kim, J.-J. P. (1999) in Flavins and Flavoproteins 1999 (Ghisla, S. , Kroneck, P. , Macheroux, P. , and Sund, H.., eds) , pp. 845-852, Rudolf Weber, Agency for Scientific Publications, Berlin, Germany |
| 36. | Wang, M., Roberts, D. L., Paschke, R., Shea, T. M., Masters, B. S., and Kim, J.-J. P. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 8411-8416 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  I. Navarro-Lerida, M. Martinez-Moreno, I. Ventoso, A. Alvarez-Barrientos, and I. Rodriguez-Crespo Binding of CAP70 to Inducible Nitric Oxide Synthase and Implications for the Vectorial Release of Nitric Oxide in Polarized Cells Mol. Biol. Cell, July 1, 2007; 18(7): 2768 - 2777. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. P. Panda, Y. T. Gao, L. J. Roman, P. Martasek, J. C. Salerno, and B. S. S. Masters The Role of a Conserved Serine Residue within Hydrogen Bonding Distance of FAD in Redox Properties and the Modulation of Catalysis by Ca2+/Calmodulin of Constitutive Nitric-oxide Synthases J. Biol. Chem., November 10, 2006; 281(45): 34246 - 34257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Roman and B. S. S. Masters Electron Transfer by Neuronal Nitric-oxide Synthase Is Regulated by Concerted Interaction of Calmodulin and Two Intrinsic Regulatory Elements J. Biol. Chem., August 11, 2006; 281(32): 23111 - 23118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Tiso, D. W. Konas, K. Panda, E. D. Garcin, M. Sharma, E. D. Getzoff, and D. J. Stuehr C-terminal Tail Residue Arg1400 Enables NADPH to Regulate Electron Transfer in Neuronal Nitric-oxide Synthase J. Biol. Chem., November 25, 2005; 280(47): 39208 - 39219. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jachymova, P. Martasek, S. Panda, L. J. Roman, M. Panda, T. M. Shea, Y. Ishimura, J.-J. P. Kim, and B. S. S. Masters Recruitment of governing elements for electron transfer in the nitric oxide synthase family PNAS, November 1, 2005; 102(44): 15833 - 15838. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. W. Konas, K. Zhu, M. Sharma, K. S. Aulak, G. W. Brudvig, and D. J. Stuehr The FAD-shielding Residue Phe1395 Regulates Neuronal Nitric-oxide Synthase Catalysis by Controlling NADP+ Affinity and a Conformational Equilibrium within the Flavoprotein Domain J. Biol. Chem., August 20, 2004; 279(34): 35412 - 35425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Panda, S. Adak, D. Konas, M. Sharma, and D. J. Stuehr A Conserved Aspartate (Asp-1393) Regulates NADPH Reduction of Neuronal Nitric-oxide Synthase: IMPLICATIONS FOR CATALYSIS J. Biol. Chem., April 30, 2004; 279(18): 18323 - 18333. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P.-F. Chen and K. K. Wu Structural Elements Contribute to the Calcium/Calmodulin Dependence on Enzyme Activation in Human Endothelial Nitric-oxide Synthase J. Biol. Chem., December 26, 2003; 278(52): 52392 - 52400. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M. Knudsen, C. R. Nishida, S. D. Mooney, and P. R. O. de Montellano Nitric-oxide Synthase (NOS) Reductase Domain Models Suggest a New Control Element in Endothelial NOS That Attenuates Calmodulin-dependent Activity J. Biol. Chem., August 22, 2003; 278(34): 31814 - 31824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Roman, J. McLain, and B. S. S. Masters Chimeric Enzymes of Cytochrome P450 Oxidoreductase and Neuronal Nitric-oxide Synthase Reductase Domain Reveal Structural and Functional Differences J. Biol. Chem., July 3, 2003; 278(28): 25700 - 25707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Adak, M. Sharma, A. L. Meade, and D. J. Stuehr A conserved flavin-shielding residue regulates NO synthase electron transfer and nicotinamide coenzyme specificity PNAS, October 15, 2002; 99(21): 13516 - 13521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. H. Craig, S. K. Chapman, and S. Daff Calmodulin Activates Electron Transfer through Neuronal Nitric-oxide Synthase Reductase Domain by Releasing an NADPH-dependent Conformational Lock J. Biol. Chem., September 6, 2002; 277(37): 33987 - 33994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Lane and S. S. Gross Disabling a C-terminal Autoinhibitory Control Element in Endothelial Nitric-oxide Synthase by Phosphorylation Provides a Molecular Explanation for Activation of Vascular NO Synthesis by Diverse Physiological Stimuli J. Biol. Chem., May 17, 2002; 277(21): 19087 - 19094. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Rozhkova, N. Fujimoto, I. Sagami, S. N. Daff, and T. Shimizu Interactions between the Isolated Oxygenase and Reductase Domains of Neuronal Nitric-oxide Synthase. ASSESSING THE ROLE OF CALMODULIN J. Biol. Chem., May 3, 2002; 277(19): 16888 - 16894. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. J. Roman, P. Martasek, R. T. Miller, D. E. Harris, M. A. de la Garza, T. M. Shea, J.-J. P. Kim, and B. S. S. Masters The C Termini of Constitutive Nitric-oxide Synthases Control Electron Flow through the Flavin and Heme Domains and Affect Modulation by Calmodulin J. Biol. Chem., September 15, 2000; 275(38): 29225 - 29232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Adak, J. Santolini, S. Tikunova, Q. Wang, J. D. Johnson, and D. J. Stuehr Neuronal Nitric-oxide Synthase Mutant (Ser-1412 right-arrow Asp) Demonstrates Surprising Connections between Heme Reduction, NO Complex Formation, and Catalysis J. Biol. Chem., January 5, 2001; 276(2): 1244 - 1252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Santolini, S. Adak, C. M. L. Curran, and D. J. Stuehr A Kinetic Simulation Model That Describes Catalysis and Regulation in Nitric-oxide Synthase J. Biol. Chem., January 5, 2001; 276(2): 1233 - 1243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. R. Nishida and P. R. O. de Montellano Control of Electron Transfer in Nitric-oxide Synthases. SWAPPING OF AUTOINHIBITORY ELEMENTS AMONG NITRIC-OXIDE SYNTHASE ISOFORMS J. Biol. Chem., June 1, 2001; 276(23): 20116 - 20124. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhang, P. Martasek, R. Paschke, T. Shea, B. S. Siler Masters, and J.-J. P. Kim Crystal Structure of the FAD/NADPH-binding Domain of Rat Neuronal Nitric-oxide Synthase. COMPARISONS WITH NADPH-CYTOCHROME P450 OXIDOREDUCTASE J. Biol. Chem., September 28, 2001; 276(40): 37506 - 37513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Stuehr, S. Pou, and G. M. Rosen Oxygen Reduction by Nitric-oxide Synthases |
