| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 29, 22255-22267, July 21, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, October 8, 1999, and in revised form, February 7, 2000
We have probed the association of Flp recombinase
with its DNA target using protein footprinting assays. The results are
consistent with the domain organization of the Flp protein and with the
general features of the protein-DNA interactions revealed by the
crystal structures of the recombination intermediates formed by Cre,
the Flp-related recombinase. The similarity in the organization of the
Flp and Cre target sites and in their recognition by the respective recombinases implies that the overall DNA-protein geometry during strand cleavage in the two systems must also be similar. Within the
functional recombinase dimer, it is the interaction between two
recombinase monomers bound on either side of the strand exchange region
(or spacer) that provides the allosteric activation of a single active
site. Whereas Cre utilizes the cleavage nucleophile (the active site
tyrosine) in cis, Flp utilizes it in trans (one monomer donating the tyrosine to its partner). By using synthetic Cre
and Flp DNA substrates that are geometrically restricted in similar
ways, we have mapped the positioning of the active and inactive
tyrosine residues during cis and trans cleavage
events. We find that, for a fixed substrate geometry, Flp and Cre
cleave the labile phosphodiester bond at the same spacer end, not at opposite ends. Our results provide a model that accommodates local heterogeneities in peptide orientations in the two systems while preserving the global functional architecture of the reaction complex.
The Flp protein encoded by the 2-µm plasmid of
Saccharomyces cerevisiae and the Cre protein encoded by the
bacteriophage P1 are members of the Integrase family (also called the
tyrosine family) of "conservative" site-specific recombinases (1,
2). Members of this family carry out a wide range of biological
functions but utilize a common biochemical mechanism to accomplish them (3). They mediate the breakage and joining between two double helical
DNA partners harboring their respective target sequences (4-6). Four
recombinase monomers participate in the reaction to complete two
sequential pairs of strand cleavage and joining steps. A Holliday
junction is therefore a central intermediate in recombination.
The Integrase family members follow the type IB topoisomerase chemistry
to break the DNA strands, forming a 3'-phosphotyrosine linkage and a
5'-hydroxyl group at the site of the strand nick. A number of
biochemical observations and recent structural data strongly suggest
that the active site tyrosine nucleophile effects strand cleavage with
catalytic assistance from a conserved triad consisting of two arginines
and one histidine (the RHR triad) (7-15). Two other conserved family
residues also contribute to catalysis as follows: a lysine (or
arginine) and a histidine (or tryptophan). As demonstrated for the Flp
recombinase and as suggested by the Cre-DNA crystal structure (10,
16-18), the catalytically relevant interactions for one strand
cleavage event are mediated by two monomers of the recombinase, bound
across from each other on either side of the strand exchange region (or
spacer). However, the utilization of the cleavage nucleophile is not
uniform within the family (1, 2, 19-21). For example, the Flp dimer
establishes a shared active site, the RHR triad from one monomer and
the tyrosine from the second monomer contributing to its functionality
(Fig. 1A, left). As a result,
Flp cleaves DNA in the trans mode, the tyrosine from the
monomer bound on the left arm reaching across the spacer to attack the
scissile phosphodiester at the right or vice versa (7, 16). By
contrast, within the Cre dimer, the triad and the tyrosine
contributions to an active site are made by only one monomer (Fig.
1A, right; 10). Hence, Cre cleaves DNA in the cis
mode, the tyrosine of the left or the right bound monomer attacking the
adjacent labile phosphodiester at the left or the right spacer end,
respectively. Regardless of the cleavage mode, however, neither the Flp
nor the Cre dimer can assemble two active sites at the same time. This
was revealed by solution experiments with Flp (22) and is suggested by
the crystal structure of the cleaved Cre-DNA complex (10). This active
site exclusion is consistent with the two-step strand exchange
mechanism that both proteins follow.
In the present study, we first probed the changes in protease
susceptibility of Flp upon binding to its DNA substrate. The derived
Flp footprints are consistent with the features of DNA-protein interactions observed in the Cre-DNA crystal structures (9, 10). Given
that the DNA-protein associations are similar for the trans
cleaving Flp and the cis cleaving Cre systems, we wished to
decipher which of the two monomers that constitute an active dimer
serves as the source of the catalytic tyrosine during the two cleavage
modes. The two possible alternatives are diagrammed in Fig.
1B. The cis versus trans
distinction may be represented by I and II or by I and III. In the
former case, equivalent recombinase monomers (shown in
green) provide the tyrosine, yielding cleavage at opposite
ends of the spacer. In the latter case, non-equivalent monomers
(green during cis cleavage and purple
during trans cleavage) provide the tyrosine, causing
cleavage to occur at the same end of the spacer. In order to maintain
the same geometry of the DNA-protein complex for the cis and
the trans cleavage modes (as is the case in Fig.
1B), our assays utilized synthetic DNA substrates that were
constrained in their configuration by strand-specific nucleotide bulges. Our results demonstrate that it is the I/III pair in Fig. 1B (and not the I/II pair) that fits the cleavage modes of
Cre and Flp. The peptide orientations that would accommodate this mechanism support the intersubunit interactions proposed by Gopaul and
Van Duyne (23) for a trans cleaving recombinase tetramer.
Purification of Flp, Flp Derivatives, and Cre--
Flp,
Flp(Y343F), and their tagged derivatives used in these experiments were
>90% pure and were obtained by previously published procedures (22).
The Flp derivative containing the His6 tag was run over a
nickel column prior to affinity chromatography on a specific
oligonucleotide matrix. The Cre protein (approximately 40% pure) was
prepared using a T7 expression vector kindly provided by Ron Hoess (Du
Pont Merck Pharmaceutical Co.). Identical results were obtained when
the assays were repeated with a highly pure Cre preparation provided by
Enoch Baldwin (University of California, Davis).
Synthetic DNA Substrates--
All DNA substrates were assembled
using synthetic oligonucleotides purchased from Integrated DNA
Technologies, Coralville, IA. Hybridization of the appropriate
oligonucleotides dissolved in 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10% glycerol was carried out by first heating
them to 65 °C for 5 min in a water bath, followed by slow overnight
cooling to room temperature. The substrates present in the footprinting
assays are displayed in Fig.
2A. The strand cleavage
substrates without spacer bulges were as follows: 5'AGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCA3'/3'TCGCGAGACTTCAAGGATATGAAAGATCTCTTATCCTTGAAGCCTTATCCTTGAAGT5' for Flp, and 5'CCCTTAATATAACTTCGTATAATGT
ATGCTATACGAAGTTATTAGGTCTGAAGAGGA3'/3'GGGAATTATATTGAAGCATATTACATACGATATGCTTCAATAATCCAGACTTCTCCT 5' for Cre. The positions that contribute to the recombinase
binding elements are shown in bold letters. The strand exchange region (spacer) is written in italics. The top strands are shown 5' to 3' and
bottom strands 3' to 5'. To create bulges, three additional adenine
nucleotides were placed at the required position within the spacer.
Binding of Flp to DNA Substrates--
The binding reactions were
done in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl,
and 10% glycerol. Each incubation mixture contained approximately 5 µg (100 pmol) of Flp or Flp(Y343F) and a DNA substrate equivalent to
500 pmol of the Flp-binding element. At this ratio of roughly 5-fold
molar excess of the binding site per Flp monomer, essentially all Flp
was bound to the DNA.
Partial Proteolysis--
Proteolytic digestions were performed
using sequencing grade chymotrypsin (70 ng), trypsin (30 ng), or V8
protease (35 ng) and high purity proteinase K (10 ng) for every 5 µg
of Flp. Typical reactions were done in 100-µl volume and utilized 25 µg of Flp per reaction. All enzymes were purchased from Roche
Molecular Biochemicals. Reactions were stopped after 20 min incubation
at 30 °C by adding 0.2 the volume of 6× SDS sample buffer (0.12 M Tris-HCl, pH 6.8, 100 mM dithiothreitol, 10%
SDS, 10% glycerol, 0.001% bromphenol blue). Samples were heated to
90 °C for 5 min and electrophoretically fractionated in 12%
SDS-polyacrylamide gels. Gels were either stained with Coomassie
Brilliant Blue to visualize protein bands or were prepared for Western blotting.
Western Blotting of Gel-fractionated Proteins--
Following
electrophoresis, the polypeptides were electrophoretically transferred
overnight to PVDF1 membranes
(Gelman Sciences) at 4 °C in transfer buffer containing 20 mM Tris-HCl, pH 8.0, 150 mM glycine, and 20%
methanol. The PVDF membranes were then blocked with 1% TBST buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5% Tween
20). After three washes in 1× TBST, the membranes were incubated with
an appropriate dilution of the specific monoclonal antibody (1:10,000
for the T7 tag) or with horseradish peroxidase-conjugated S protein
(1:5000; supplied by Novagen, Madison, WI) for 1 h at room
temperature. Membranes containing the T7-tagged polypeptides were
further incubated, following three washes with 1× TBST, with the
horseradish peroxidase-conjugated secondary antibody (1:3000 dilution;
obtained from Bio-Rad) Positive polypeptide bands were detected using
the ECL detection system purchased from Amersham Pharmacia Biotech.
Native Flp protein (without the tags) did not cross-react with the
T7-specific monoclonal antibody. It also tested negative during probing
with the peroxidase-conjugated S protein.
Determination of Molecular Masses--
Molecular masses were
estimated by comparison to Western blot standards provided by Novagen
or rainbow markers supplied by Bio-Rad. The reference curves were
prepared by plotting relative mobilities against
log(Mr). Variations in the estimates from
experiment to experiment were within 10%.
Peptide Sequencing--
Protease-treated samples were
fractionated in 15% SDS-polyacrylamide gels and electrophoretically
transferred to PVDF membranes. Peptide sequencing was performed either
in a gas-phase protein sequencer (LF3000; Beckman Instruments) or in a
pulsed liquid protein sequencer (Applied Biosystems) using Edman
chemistry (8).
Strand Cleavage Reactions with Flp and Cre--
The conditions
of the Flp and Cre cleavage reactions were the same and followed
previously described protocols (22). Reactions were carried out in
50-µl volume. The samples were fractionated by electrophoresis in
10% denaturing polyacrylamide gels. The cleavage bands were visualized
by autoradiography or by phosphorimaging. When reactions were directly
analyzed in non-denaturing gels, cleavage bands could not be detected,
indicating that strand cleavages within a substrate were exclusively
single-stranded. Double-stranded cleavages, if they did occur, should
have been apparent in the absence of denaturation.
Quantitation of Strand Cleavage Products--
The left and right
cleavage bands were quantitated using a Bio-Rad GS-525 Molecular
Imaging System PhosphorImager and the image analysis software Molecular
Analyst. The cleavage yield was normalized with respect to the
substrate amount in the following way. First the intensities of the
cleavage bands in a reaction set (labeled as CL or
CR in the Figs. 5-8) were computed after phosphorimaging the fractionated samples for an appropriate length of time. Since the
doublet of substrate bands (see Fig. 5, for example) were overexposed
and poorly resolved under these conditions, their intensities were
derived after reducing the imaging time appropriately. The ratio of the
intensity of a cleavage band to that of the corresponding substrate
band in a given reaction was designated as the cleavage yield. There
was a significant bias in the native Cre substrate toward one cleavage
event over the other (CL > CR). In the two experiments used to
compose Fig. 8B, the ratios of CL to CR in the unbulged
control substrate were 3.5 and 4.5, respectively. The "cleavage
yields" of CL and CR from the bulged Cre substrates were first
estimated as described here for the Flp substrates. The CL yields were
then divided by the average bias factor of 4 before plotting the
cleavage curve shown in Fig. 8B.
Structural Representations and Graphics--
The molecular
details of the Cre-DNA structures were adapted from Guo et
al. (10) using molecular visualization softwares RasMol and the
Swiss Protein Viewer.
General Strategies, Experimental Rationale, and
Interpretations--
This section can be divided into two parts. The
first set of experiments (Figs. 3 and
4) was aimed at mapping the peptide regions of Flp that are protected from protease digestion when it is
bound to its DNA substrate or to the Holliday intermediate of
recombination. The protection profile could be overlaid on the Cre-DNA
crystal structure to assess the overall degree of fit between the modes
of substrate recognition in the two systems. The second set of
experiments (Figs. 5-8) addresses how two alternative active site
orientations, one for cis and the other for trans cleavage, can be derived from the same global architecture of DNA-protein interactions.
Protease Footprinting--
The DNA substrate in the majority of
protease footprinting experiments was the Flp full site (containing two
Flp-binding elements, S2; see Fig. 2A). In one set of
experiments, a half-site (containing one Flp-binding element, S1; Fig.
2A) and a Holliday junction substrate (containing four
Flp-binding elements, HS4; Fig. 2A) were also employed. The
nonspecific DNA used as a control in these reactions was the same size
as S2 and was obtained by changing 12 positions within the left and
right Flp-binding elements (Fig. 2A) to the "least
favored" bp, as deduced from the analysis of Senecoff et
al. (24).
The Flp protein derivatives used for the footprinting assays were
tagged using the T7 epitope tag or the S peptide tag at either the
amino terminus or at the carboxyl terminus. They are schematically
represented in Fig. 2B. T7-Flp (row 1, Fig.
2B) and His6-S-Flp(Y343F) (row 3, Fig. 2B) harbored the T7 and S tags, respectively, at their
amino termini; T7-Flp-S contained both tags, T7 at the amino terminus
and S at the carboxyl terminus (row 2, Fig.
2B).
Wild type Flp or Flp(Y343F) was subjected to partial proteolysis in the
presence or absence of DNA under a set of standardized conditions
(Figs. 3 and 4). The protease-digested samples were gel-fractionated,
transferred to PVDF membranes, and probed with the T7 antibody or the S
protein probe. The ladder of bands observed, in the order of increasing
molecular mass, provides a measure of the relative distances of the
protease-sensitive sites from the position of the tag. In principle,
for every band derived from the protein tagged at the amino terminus
upon digestion with a given protease, there should be a corresponding
band from the protein tagged at the carboxyl terminus such that the two
together add up to the full-length protein. The footprinting profiles
obtained with wild type Flp or Flp(Y343F) were virtually the same,
except that the protein-DNA adduct resulting from Flp cleavage was
absent in the Flp(Y343F) reactions.
For each of the proteases used, the digestion patterns of Flp in the
absence and presence of the nonspecific DNA fragment (NS) were not
identical. This is easily seen by comparing lanes 4 to
lanes 2 in Fig. 3C, for example. The difference
could be either due to an effect of DNA on the activity of the
proteases or due to some nonspecific Flp-DNA interaction. In deriving
the footprint profiles, only those proteolytic bands that could be distinguished between the Flp/S2 and the Flp/NS samples were considered as significant, except in one case that is explained below. Prior to
assigning the composite protected peptide regions (see Fig. 4C), the molecular masses of proteolytic products were
corrected for the size differences in the respective tags they harbored (1.5 kDa for the amino-terminal T7 tag; 2 kDa for the carboxyl-terminal S tag; 5 kDa for the amino-terminal His6-S tag).
Chymotryptic Footprinting of Flp Bound to DNA Substrates Containing
One, Two, and Four Flp-binding DNA Arms--
A normal Flp
recombination event is initiated by the binding, separately, of two Flp
monomers from solution to each of the two binding elements of the
minimal recombination target site. Dimerization of Flp occurs only
between two DNA-bound Flp monomers. Furthermore, the strand exchange
mechanism gives rise to a Holliday junction as an obligatory
intermediate in the reaction. We wished to probe the footprinting
patterns of Flp bound to DNA harboring a single Flp-binding element
(S1, Fig. 2A), or to a functional substrate
containing two binding elements (S2, Fig. 2A), or
to a Holliday junction containing four Flp binding arms
(HS4, Fig. 2A). The results of these assays using
partial proteolysis by chymotrypsin are presented in Fig. 3. The two
profiles shown in A and B correspond to identical
sets of chymotryptic reactions fractionated differentially to highlight
the region corresponding to 30-14 kDa in A and to expand
that spanning 50-25 kDa in B.
The overall protection patterns were quite similar with the three types
of substrates (lanes 3-5 of Fig. 3, A and
B). A conspicuous region of protection spanning the
22-30-kDa range was seen in all three cases (PII in Fig.
3A). Within PII, a doublet at approximately 24-25 kDa
showed a higher degree of protection in Flp bound to S2 than in Flp
bound to S1 or HS4. Although not readily apparent in Fig.
3A, this difference can be seen by comparing lanes
3 and 5 to 4 in Fig. 3A'
(A' shows the relevant region of A for a longer exposure of the Western blot luminogram). Similarly, the two bands at
14-16 kDa (PI) showed significant protection in the Flp-S2 complex but were essentially unprotected in the Flp-S1 and Flp-HS4 complexes (compare lane 4 to lanes 3 and
5 in Fig. 3A). Finally, a 34-35-kDa proteolytic
fragment was absent from the S1, S2, and HS4 lanes, defining a third
chymotryptic footprint, PIII (Fig. 3, A and B).
The possible significance of the band marked PIV in Fig.
3B is discussed in reference to the results shown in Fig. 4A (see below).
An interesting feature of the footprints was the enhancement of a
doublet band just above PIII (labeled E; approximately
38-39 kDa) in the presence of the Flp substrates (lanes
3-5; Fig. 3B) but not in the presence of nonspecific
DNA (compare lane 6 to lane 2 in Fig.
3B). The cleavage enhancement was stronger for S1 and S2
compared with HS4. This hypersensitivity to chymotrypsin is suggestive
of a potential conformational transition, commensurate with DNA
binding, near the carboxyl-terminal portion of Flp adjacent to PIII.
This region maps to the amino-terminal side of the active site tyrosine
(Tyr-343) of Flp.
The band migrating slower than 50 kDa in lanes 3-5 of Fig.
3, A and B (CL), was the result of DNA
cleavage by Flp and the formation of the covalent Flp-DNA adduct. It
should be pointed out that, a priori, the presence of CL in
the Flp/S1 case (lanes 3) was not expected, since it takes
two Flp monomers to assemble a single active site for strand cleavage
(7, 16). However, once a Flp monomer has bound its cognate sequence in
S1 and oriented the scissile phosphodiester, fortuitous transient
binding of a second Flp monomer on the same DNA or encounter with a
second DNA-bound Flp monomer may result in strand cleavage.
Substrate-mediated Protection against Chymotrypsin in Flp Tagged at
the Carboxyl Terminus or Flp(Y343F) Tagged at the Amino
Terminus--
To verify the authenticity of the footprints obtained
with Flp tagged at the amino terminus, a similar chymotryptic digestion was carried out using Flp tagged at the carboxyl terminus in the presence of S2 or NS. The results are shown in Fig. 3C. The
sum of the molecular masses of a protected fragment from
amino-terminally tagged Flp and its complement from carboxyl-terminally
tagged Flp, corrected for the differences in tag sizes, should be
approximately 46.5 kDa, the mass of native Flp. Since the
amino-terminal T7 tag and the carboxyl-terminal S tag are approximately
1.5 and 2.0 kDa, respectively, the observed sum should be 46.5 + 3.5 = 50 kDa. The regions of protection marked P'I
(32-36 kDa), P'II (20-28 kDa), and P'III
(14-16 kDa) match the PI (14-16 kDa), PII (22-30 kDa), and PIII
(34-35 kDa) protections, respectively, deduced from the data in Fig.
3, A and B.
The protected band at 7-8 kDa (p'5, Fig. 3C) is
likely the result of chymotryptic cleavage at one or more tyrosine
residues at positions 361, 362, and 364. This assignment, although not confirmed by sequencing, is consistent with a previously mapped V8
cleavage site at Glu-370 (8, 28). These are the only aromatic residues
within a 20 amino acid segment spanning Glu-370 (from 361 to 380). The
approximately 10-kDa band P'IV (lane 2, Fig. 3C)
protected in the S2 and NS lanes (lanes 3 and 4,
Fig. 3C) signifies cleavage at Tyr-343 (or Phe-343 for
Flp(Y343F)), as determined by amino-terminal sequencing (see Fig.
4C). The high protease sensitivity of the peptide segment
housing the Flp catalytic tyrosine was noted in a previous study as
well (8). Protease susceptibility in the vicinity of the catalytic
tyrosine has been also observed for the lambda Int protein (29). We
interpret the P'IV protection to be functionally relevant even though
it was observed in both S2- and NS-containing reactions. Since Tyr-343 forms a covalent adduct with the DNA backbone upon strand cleavage, it
has to be in close contact with DNA. The band corresponding to P'IV
expected from Flp tagged at the amino terminus is approximately 40 kDa
(the combined masses of Flp together with the carboxyl- and
amino-terminal tags should be 50 kDa). Such a band was observed in the
partial chymotryptic digest of N-tagged Flp (PIV, lane 2, Fig. 3B) and was not detected in the presence of the
Flp substrates (lanes 3-5, Fig. 3B). As with
P'IV, PIV was also absent in the reaction containing the nonspecific
DNA fragment (lane 6, Fig. 3B).
The pattern with the C-tagged Flp also included a 46-kDa protected
polypeptide (p'0, Fig. 3C). The equivalent 4-kDa
protection from N-tagged Flp would not have been detected under the
electrophoretic conditions employed in Fig. 3, A, B, and
D.
Note that the Flp cleavage product (>50 kDa; CL) was not
seen with the C-tagged Flp (absence of CL in lane 3 of Fig.
3C). This result is consistent with previous observations
that even minor alterations of the carboxyl terminus of Flp (in the
present instance, the addition of the S tag) result in loss of
catalytic activity (30). The crystal structure of the Cre-DNA complex also indicates that the carboxyl-terminal region is responsible for the
allosteric activation of one Cre monomer within a dimer to cleavage
competence (10).
The chymotryptic footprints obtained with N-tagged Flp(Y343F) in the
presence of the S2 DNA (Fig. 3D) were qualitatively
identical to those yielded by wild type Flp and S2 (compare lane
3 of Fig. 3D with lanes 4 in Fig. 3,
A and B). The three protected areas (PI,
PII, and PIII) were clearly discernible, and specific
bands within a region of protection (for example, the doublets harbored by PI and PII) were slightly shifted up in agreement with the longer
amino-terminal tag in Flp(Y343F). As expected from the inability of
Flp(Y343F) to cleave DNA, no band migrating above 50 kDa was observed
in its footprint.
Footprints of Flp Derived by Tryptic and Proteinase K
Digestion--
The general inferences drawn from the chymotrypsin
assays were further tested by probing N-tagged Flp in the presence of
S2 with two other proteases (Fig. 4, A and B).
Individually, the information contained within each of the two
footprint patterns was sparse relative to the chymotryptic data.
Collectively, however, they support and augment the conclusions derived
from the latter. For instance, the PII footprint (the protected doublet
at approximately 24 kDa) was detected in the trypsin digestion
(lane 3, Fig. 4A). Similarly, the approximately
33-kDa band protected in the proteinase K assays (p3,
lane 3, Fig. 4B) maps adjacent to the
amino-terminal border of the PIII patch. The proteinase K profile also
contained a 47-48-kDa protected band (p5, lane
3, Fig. 4B), placing the corresponding proteolytic site
near the extreme carboxyl-terminal region of Flp.
Summary of the Footprints of the Flp-DNA Complexes--
The
outcomes of the footprint analyses are schematically diagrammed in Fig.
4C. The diagram below relates the
protected regions to the location of the principal protease-sensitive
sites mapped within Flp when it was not bound to DNA. Because the
cleanest internally cleaved and electrophoretically fractionated
polypeptide fragments (suitable for amino-terminal microsequencing)
were obtained with V8 protease, the primary landmarks in Fig.
4C are provided by Glu residues (Glu-128, Glu-271, and
Glu-370). In addition, the protected P'IV cleavage fragment from the
chymotrypsin digest of C-tagged Flp was characterized as the product of
cleavage at Tyr-343. Hyper-cleavage of unbound Flp at Asp-134 and
Asp-332 that we observed during digestion with endoproteinase Asp-N
would be consistent with V8 and chymotryptic cleavages at Glu-128 and Tyr-343, respectively (data not shown). Earlier experiments had revealed that one of the preferred cleavages by trypsin also occurs proximal to Tyr-343, at Arg-340 (8).
The three areas of protection (PII, PIII, and PIV/p'5) spanning the
major portion of the carboxyl-terminal domain of Flp would be
consistent with the extensive contacts between the corresponding region
of the Cre protein and its binding site revealed by the crystal
structure (10; see Fig. 9 also). The two protected segments within the
Flp amino-terminal domain (p'0 and P1) would also agree with the
crystal structure in which the amino- and carboxyl-terminal domains of
Cre form a crescent over the DNA target. However, the predicted
secondary structure of Flp, as well as the footprinting data, suggests
that the amino-terminal domains of Flp and Cre may be less related to
each other. The significance of the footprints in DNA recognition by
Flp is further addressed under "Discussion."
Overall, the footprinting analysis on Flp conforms to the reasonable
expectation that the mode of substrate binding is conserved among
members of the Int family. This provides the justification for the
functional assays for Flp and Cre described below.
Cleavage Assays in Bulge-containing DNA Substrates--
The logic
of forcing Flp and Cre substrates into similar configurations for
mapping strand cleavage was based on our previous work (22) with Flp
substrates containing nucleotide bulges in specific strands. NMR and
FRET studies have shown that the bulge acts as a one-way hinge in DNA
(25-27). Depending on the strand that it resides in and its position
within that strand, a bulge promotes the bending of the flanking DNA
arms in one direction (away from the bulge) but not the other. Thus, by
placing nucleotide bulges at equivalent positions within DNA sequences
of similar size and organization (as is the case for the Flp and Cre
target sites), they can be forced to assume similar geometries. The
structural features of the different bulged substrates are illustrated
in the appropriate figures and described in the corresponding text.
Preferential Cleavage of Bulge-containing Strands by Cre and
Flp--
The experiments displayed in Fig.
5 test whether trans cleavage
by Flp and cis cleavage by Cre can be related by I and II or
by I and III in Fig. 1B.
For the Flp system, strand-specific nucleotide bulges between the
central two nucleotides of the spacer can constrain the substrate
geometry to two nearly exclusive states that yield left cleavage in one
case and right cleavage in the other (22). It is always the strand
harboring the bulge that becomes cleavage-susceptible. Furthermore,
this selective cleavage occurs by the trans mechanism, as
would be expected from the known behavior of the Flp protein (7, 16,
31). We have now constructed bulged synthetic Cre substrates (analogous
to the Flp substrates, containing nucleotide bulges in the middle of
the spacer), and we assayed their cleavage preferences in the presence
of wild type Cre (Fig. 5A). The corresponding results with
bulged Flp substrates and Flp are shown for comparison (see Ref.
22).
In the control substrate with no bulges, there was an intrinsic
3-4-fold bias that favors left end cleavage by Cre over the right end
(Fig. 5A, lane 2). When the bulge was located in the top
strand (the strand containing the labile phosphate at the left end),
cleavage was directed almost exclusively to the left end, magnifying
the natural cleavage bias (Fig. 5A, lane 4). When the bulge
was present on the bottom strand, cleavage became biased in the
opposite direction, toward the right end by a factor of 3 (Fig.
5A, lane 6; CR:CL ~3:1). By taking into account
the inherent cleavage preference of the control substrate, the bottom
strand bulge enhances the odds of right cleavage by a factor of 9-12. This strong proclivity for cleavage of the bulge-containing strand was
identical to that observed with Flp (Fig. 5A, lanes 7-12). The Flp substrates in the reactions represented by lanes 10 and 12 contained the bulge on the top and bottom strands, respectively.
Thus, for a defined geometry of their substrates (imposed
experimentally by the strand bulge), the cis cleaving Cre
and the trans cleaving Flp orient the reactive tyrosine
toward the same end of the spacer (as in I and III of Fig.
1B). It should be noted that the bulge geometry affects
cleavage directly and not indirectly by slowing down the reverse
reaction that reseals a broken strand. The cleavage bias observed in
substrates containing spacers with centrally placed bulges was
identical for Flp as well as the joining incompetent variant Flp(H305L)
(22). We assume that this condition holds for the Cre reactions as well.
There is one report in literature (32) that, in contradiction to the
crystal structure (10), claims trans cleavage by Cre. Our
repeated efforts have failed to provide any evidence of Cre cleaving
substrates with or without bulges in the trans mode.2 The criterion set by
us for trans cleavage was a cleavage followed by joining
reaction when a recombinase mutant lacking the active site tyrosine was
paired with an RHR triad mutant. This is because a cleavage produced
adjacent to the tyrosine mutant (as is the case for trans)
can readily proceed through the joining step. The active site tyrosine
is not required for strand joining. In every situation that Flp
answered the test (7, 31), Cre failed. Thus, in our assays, Cre and Flp
are truly cis and trans cleaving recombinases.
Scanning the Flp and Cre Spacer with Bulges for
Position-dependent Cleavage Bias--
If the bulge induces
similar DNA geometry in the Flp and Cre substrates (as we have
supposed), the position effects on strand cleavage displayed by the
spacer bulges should be similar for both the Flp and Cre systems. The
experiments that address this issue are summarized in Figs. 6-8.
To simplify interpretations, the following points may be emphasized.
Strand cleavage assays for the wild type recombinases normally measure
the balance between the cutting (forward) and joining (reverse)
reactions. In the case of Flp, strand joining can be suppressed by
introducing mismatches in the spacer immediately adjacent to the
cleavage site or by using the mutant protein Flp(H305L). The assays
shown in Fig. 6A utilize a
combination of both these conditions to circumvent possible
differential effects on the joining reaction of bulges neighboring a
scissile phosphodiester versus bulges internal to the
spacer. Currently, we do not have a mutant of Cre that catalytically
mimics Flp(H305L), being normal in cleavage but defective in strand
joining. In the Cre assays, done with the wild type protein (Fig. 8),
bulges immediately adjacent to the cleavage positions were omitted to
avoid "mismatch" effects on the joining reaction. Comparison of the
cleavage results with wild type Cre and Flp(H305L) is valid
qualitatively. Quantitatively, the Flp (H305L) reactions yielded higher
levels of cleavage as expected (compare Fig. 6A to Fig.
8A).
Bulges within the Flp Spacer--
In Fig. 6A, the
outcomes from a cleavage reaction of Flp(H305L) with substrates
containing spacer bulges at various positions are displayed. The lack
of cleavage by Flp(H305L) at a given spacer end in the presence of a
neighboring bulge (absence of CL in lane 6 and of CR in
lane 15 of Fig. 6A) was expected. The mutant is known to cut poorly at mismatched spacer ends (a bulge would
effectively mimic base noncomplementarity; see also Fig.
6B). By contrast, as expected from the blockage in strand
sealing, wild type Flp yielded enhanced cleavage adjacent to the bulge
(CL
The results displayed in Fig. 6B document the differential
cleavage competence of Flp(H305L) in response to mismatches at the ends
of the spacer or internal to it. As shown in lanes 2 and
3 Fig. 6B, end mismatches severely compromised
the activity of Flp(H305L) but not of wild type Flp. By contrast, base
non-complementarity at the spacer center did not affect cleavage by
Flp(H305L) (lane 6 of Fig. 6B). Note that the
differences in cleavage by wild type Flp in lanes 2 and
5 of Fig. 6B reflect the role of "end
homology" in cleavage reversal, namely the slow down in joining due
to mismatched bases adjoining the nick (33, 34).
The cleavages at the left and right spacer ends for the different bulge
positions (Fig. 6A) were quantified as a weighted fraction
of the substrate strand converted to CL or CR (see "Materials and
Methods") and are graphically represented in Fig. 7. Large cleavage
discriminations were observed when the bulge was located at or near the
center of the spacer. A strong diminution in the bias, or even its
reversal, was observed at the spacer extremities. This pattern holds
true for bulges on the other strand as well. The dashed line
in Fig. 7 represents the cleavage profile obtained for substrates
containing bulges on the bottom strand (raw data not shown). The two
cleavage curves, drawn as the algebraic sum of the left and right
cleavages, demonstrate the inverse relationship in the choice of the
phosphodiester target imposed by a matched pair of bulges located at
equivalent positions on opposite strands.
The above results suggest that the DNA arms for the centrally placed
bulges assume a geometry that most closely resembles their relative
disposition within the cleavage-competent complex formed between a Flp
dimer and a normal DNA substrate. However, large cleavage preferences
were observed even with bulges placed eccentrically within the spacer
(between 2 and 3 or 6 and 7; lanes 8 and 12 of
Fig. 6A). Presumably, the Flp dimer can manipulate these
substrates sufficiently to establish a correctly oriented active site.
The cleavage bias for wild type Flp for substrates with bulges at the
internal spacer positions (between 2' and 3', 4' and 5', and 6' and 7')
was qualitatively the same as that for Flp(H305L) (data not shown),
further indicating that cleavage bias was a function of substrate
geometry and did not result from indirect effects of bulges on strand ligation.
Bulges within the Cre Spacer--
The cleavage patterns obtained
with wild type Cre for substrates containing bottom strand spacer
bulges are arranged in Fig. 8,
A and B. In the plot showing the cleavage yields
as a function of the bulge location (Fig. 8B), the CL yields
were divided by a correction factor of 4 to compensate for the cleavage
bias in the native substrate (lane 2 of Fig. 8A;
see also "Materials and Methods"). The dependence and the magnitude
of the bias on the bulge position qualitatively paralleled those
observed for the Flp substrate (shown in Figs. 6A and 7).
The bias was strongest at an internal position within the Cre spacer
(bulge between 2' and 3'; Fig. 8, A and B) and
either faded or reversed itself as the bulge was moved to either side
(between 1' and 2' to the right; and between 3' and 4', 4'
and 5', and 5' and 6' to the left; Fig. 8, A and
B). As already noted, the intrinsic cleavage bias of the
control Cre substrate significantly favors the top strand (CL > CR; lane 2, Fig. 5A). Because of the low cleavage
susceptibility of the native bottom strand, spacer bulges introduced on
this strand provide a strikingly clear cut demonstration of their role in determining the choice of strands as targets for cleavage.
The similarity in the correlation between cleavage bias and bulge
location for the Flp and Cre substrates supports the functional similarity of the bulge-containing substrates in the cleavage reactions
by the two recombinases. The cleavage curves in Figs. 7 and
8B are suggestive of a sinusoidal trend, as would be
expected for the phasing of the DNA kinks induced by bulges located
along the helical path of a DNA strand (reviewed in Ref. 35). Since the
functional spacer length for recombination (the distance between the
scissile phosphodiester bonds) is less than 10 bp (6 bp for Cre and 8 bp for Flp), it is not possible to test directly this prediction. In
addition, if the primary determinant of the geometry of the protein-DNA
complex is the interactions between the two bound recombinase monomers,
the "cleavage periodicity" may differ significantly from the
helical periodicity of DNA. The effects of the nucleotide bulges are
most easily explained by their role in offering steric inducements or
posing steric barriers, in a position dependent manner, to the
establishment of a particular cleavage geometry as follows: one that
targets the left spacer end, or one that targets the right spacer end.
Footprinting methods (36, 37), despite their relatively low
resolution compared with x-ray crystallography or NMR analysis, provide
useful information on structure-function relationships in proteins.
Footprint analysis of the DNA-bound Flp has revealed several protected
peptide regions and one hypersensitive region. The deduced footprints
shed light on peptide segments that contact DNA (or are in proximity to
DNA) or undergo conformational changes as a result of DNA binding. Some
contributions to the footprints are likely from interactions between
Flp monomers that are bound to DNA. Our interpretations assume that the
absence or reduction of a proteolytic band is the result of protection
from protease and not due to rapid degradation of the primary cleavage
product. The latter possibility is extremely unlikely under the
limiting protease amounts used in our assays. Furthermore, in a time
course assay from 5 to 30 min, no evidence for such degradation was
seen.3 The potential
significance of the observed footprints (Fig.
9) may be assessed in the context of the
known DNA-binding properties of Flp (28, 38, 39) as follows: a
previously proposed model structure for Flp (30), the recently solved
structures of the catalytic domains of lambda Int and lambda HP Int
proteins (11, 12), the structure of the Escherichia coli
XerD protein (15), and the co-crystal structures of Cre-DNA complexes
(9, 10, 40).
DNA Recognition, Strand Selectivity, and Cleavage Mode during
Integrase Family Site-specific Recombination*
§,,
, and**
Department of Microbiology, University of
Texas, Austin, Texas 78712, ¶ Faculty of Applied Marine
Sciences, Cheju University, Cheju City 690756, South Korea, and
European Molecular Biology Laboratory,
Postfach 102209, Heidelberg, Germany
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (19K):
[in a new window]
Fig. 1.
cis and trans
cleavages within the Integrase family recombinases. A,
the positioning of the catalytic Arg-His-Arg (RHR) triad and the
tyrosine nucleophile around the scissile phosphodiester bond is shown.
In the case of Flp (left), which cleaves DNA in
trans, the RHR triad (shown in blue) is
contributed by one protein monomer, and the tyrosine (shown in
red) is contributed by a second monomer. For Cre
(right), the triad as well as the tyrosine are derived from
a single Cre monomer (all residues shown in blue). The
arrangement of the phosphate group and the amino acid side chains are
redrawn from the Cre-DNA crystal structure (10). B, a
recombinase dimer that cleaves in cis (I; Cre,
for example) can, in principle, be related to one that cleaves in
trans (Flp, for example) in one of two ways (II
or III). The tyrosine (from the green monomer)
that cleaves at the left end of the spacer can be pushed to the right
end in its functional orientation as shown in II. Or, the
tyrosine from the monomer at the right (purple) can be moved
to the left end as shown in III. The cleavage susceptible
phosphodiester positions are indicated by the dots. The
representation of the cleavage active and inactive recombinase monomers
in green and purple, respectively, in the
cis cleaving dimer (I) follows the color codes
used by Guo et al. (10).
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (28K):
[in a new window]
Fig. 2.
Synthetic DNA substrates and tagged variants
of Flp used in the Flp footprinting assays. A, the sequences
of the individual substrates are shown with the Flp-binding elements
written in bold uppercase letters, and the arrows
indicate their relative orientations. The linear substrates
S1 and S2 and the Holliday junction
HS4 contain one, two, and four Flp-binding elements,
respectively. The Holliday junction is represented in an antiparallel
configuration. Note that the two Flp-binding elements within a
recombination substrate (say, S2) differ in one of the 13-bp positions;
the nearest neighbors of the GC pair immediately flank the strand
exchange region. It is a TA pair in the left binding element of S2 and
an AT pair in the right binding element. Interaction between two Flp
monomers, one bound at the left and one bound at the right of the 8-bp
spacer, is essential for the assembly of a functional strand cleavage
pocket. The non-binding substrate NS was obtained by
altering 12 positions each within the left and right binding elements.
The defunct binding elements are shown in italics.
B, the wild type Flp protein was tagged at either the amino
terminus with the T7 tag (row 1) or at both the amino and
carboxyl termini with the T7 and S tag (row 2),
respectively. Flp(Y343F) was tagged at the amino terminus with a
combined His6-S tag (row 3). The sequences of
the tags and the additional mass contributed by them to the 46.5 kDa of
native Flp are indicated.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (47K):
[in a new window]
Fig. 3.
Chymotryptic footprint patterns of N-tagged
Flp or Flp(Y343F) and C-tagged Flp. The reactions in
A-D were carried out in identical manner ("Materials and
Methods"). The samples in A and B were
electrophoretically fractionated for different lengths of time to
highlight individual features within the footprints. The Western blots
were probed with a monoclonal antibody against the T7 peptide in
A and B and with the S probe in C and
D. The N-C ruler placed at the right of each
panel measures the distance of a protected region from the tagged end.
Lanes 1 and 2 are untreated Flp and Flp treated
with chymotrypsin in the absence of DNA. S1, S2, HS4, and
NS refer to the presence of substrates with one, two, four,
and no Flp-binding elements (see Fig. 2A for details),
respectively, in the protease reactions. Regions of protection for the
N-tagged proteins are marked P with an appropriate suffix.
The P' patches refer to the footprints from the C-tagged protein. The
suffixes I-IV match them to the P footprints from the N-tagged
protein. The arrows with the p' label (p'0 and p'5 in
C) indicate protected bands whose counterparts from the
N-tagged profile were not apparent. The band migrating above the Flp
band (CL in A and B) is due to the
covalent attachment of Flp to DNA as a result of strand cleavage.
E refers to enhanced chymotryptic cleavage in lanes
3-5. A' represents a longer exposure of the
luminogram of A to accentuate features of the PII
footprint.
View larger version (32K):
[in a new window]
Fig. 4.
Footprinting profiles of N-tagged Flp with
trypsin and proteinase K, distribution of protected regions on the Flp
protein. A and B, the footprints of N-tagged Flp
using trypsin and proteinase K are shown. Lane designations and other
details are as in Fig. 3. The probe was a monoclonal antibody directed
against the T7 peptide. The PII footprint observed with chymotrypsin
(see Fig. 3) was also revealed by trypsin (A). Two protected
bands p3 and p5 were displayed by proteinase K (B). The
Flp-DNA covalent adduct is labeled CL. C, the Flp
protein is schematically represented as a cylinder. The
cleavage protection (denoted by P, p') and enhancement
(denoted by E) data from Fig. 3 are mapped on Flp after
compensating for the sizes of the tags used for end labeling (see Fig.
2; also explanation in text). The approximate ranges of PI, PII, and
PIII, based on molecular mass estimates, are 114-150, 186-259, and
295-314, respectively. Potential chymotryptic sensitive sites near the
PI borders are Tyr-107, Tyr-108, and Trp-155. The amino-terminal PII
border matches Phe-182, Phe-186, or Phe-192. Phe-248 or Tyr-271 form
the likely carboxyl-terminal border of PII. Tyr-293, Phe-296, and
Phe-314 are plausible residues that delimit PIII. The
protease-sensitive sites in Flp or Flp(Y343F) adjacent to or
overlapping a subset of the protected regions were determined by
amino-terminal microsequencing (this study; see Ref. 8).
View larger version (33K):
[in a new window]
Fig. 5.
Selective strand cleavage by Cre and Flp in
substrates containing strand-specific bulges. A, the Cre and
Flp substrates (at left and right, respectively)
are schematically shown with their spacer sequences written out, and
the scissile phosphodiesters indicated as p. The recombinase
binding elements are indicated by the parallel arrows that
also represent their head to head orientation. The top and
bottom strands (arbitrary designations) are distinguished by
thick and thin lines, respectively. The spacer
positions are numbered from left to right on the
top strand and from right to left on the bottom
strand (in the 5' to 3' direction). The A3 bulges were
introduced between positions 3 and 4 or 3' and 4' in the Cre substrate
and between 4 and 5 or 4' and 5' in the Flp substrate. The reactions
were carried out on substrates labeled with 32P at the 3'
ends on both strands (indicated by the asterisks). The bands
CL and CR represent cleavage fragments derived
from the left and right ends of the spacer,
respectively. The cleavage bands from the bulge containing strands
would be 3 nucleotides longer than those from the control substrate.
The unreacted substrate bands are denoted by S. The presence
of more than one cleavage band at a given spacer end is due partly to
substrate heterogeneity and partly to the occurrence of an occasional
aberrant cleavage in linear substrates. B, the experimental
results from A are schematically diagrammed at the
bottom. The Cre and Flp substrates are drawn in
thick and thin lines, respectively; the
corresponding recombinase proteins are represented by the
unshaded and shaded ovals, respectively. The
phosphodiester that is reactive during a cleavage event is shown by the
filled circle. The unreactive one is shown by the open
circle.
View larger version (23K):
[in a new window]
Fig. 6.
Strand cleavage by Flp(H305L) and Flp in
substrates with spacer bulges and spacer mismatches. A, in
the normal Flp substrate shown at the top, the numbers 0 and
0' (C) and 9 and 9' (G) refer to the nucleotide
positions immediately flanking the spacer. The bulge positions on the
top strand are denoted above the respective reactions. The
reactions in lanes 2 and 3 were done with the
control substrate harboring no spacer bulges. B, in the
schematic representation of Flp substrates, the mismatched nucleotides
are indicated. The designations of substrate and cleavage bands in
A and B follow the symbols used in Fig. 5.
CR in lane 5 and CR CL in lane 14 of Fig. 6A). In plotting the cleavage bias in Fig.
7, the values of CL and CR for bulges
located at the left and right spacer ends, respectively, were derived
from the wild type Flp reaction (CL from lane 5 and CR from lane 14 of Fig. 6A). All
other values were from the Flp(H305L) reactions. Thus, Fig. 7
represents the cleavage profile, with minimal strand religation, as a
function of the bulge location within the spacer. Even without these
adjustments to the cleavage outputs by Flp(H305L), the patterns in Fig.
7 (see below) would not be significantly altered qualitatively.
View larger version (21K):
[in a new window]
Fig. 7.
The cleavage yields by Flp(H305L) from
Fig. 6A, CL and
CR, respectively, were calculated (as described under
"Materials and Methods") and graphed as a function of the bulge
position (indicated by the vertical arrows on the
abscissa). The cleavage curve was drawn (solid line) by
connecting points representing the algebraic sum of CL and CR for each
bulge position. The values of CL for the bulge placed between 0 and 1 and that of CR for the bulge placed between 8 and 9 were obtained from
the Flp reactions (lanes 5 and 14 of Fig.
6A). For a detailed explanation, see text. This manipulation
was necessitated by the severely diminished cleavage capacity of
Flp(H305L) at a scissile phosphodiester position when it was flanked
immediately by a bulge on the same strand or the opposite strand
(lanes 6 and 15 of Fig. 6A; see also
text for details). The dashed line is the cleavage curve
computed for bottom strand bulges from an experiment analogous to that
shown in Fig. 6A.
View larger version (20K):
[in a new window]
Fig. 8.
Strand cleavage bias as a function of the
bulge position within the Cre spacer. A, the bulge locations
are indicated above the respective reactions. A control
assay with the normal substrate (schematically depicted at the
top) is shown in lane 2. B, the
amounts of CL and CR products from reactions with the bulge-containing
substrates were normalized against the corresponding amounts from the
control substrate (lane 2) as described under "Materials
and Methods." The graph represents the averaged values
from two reaction sets, one of which is shown in A.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (31K):
[in a new window]
Fig. 9.
Comparison of Flp footprints to DNA contacts
observed in the crystal structure of Cre bound to DNA; a model for DNA
recognition by Flp. A, the secondary structure
representation of the carboxyl-terminal domain of Cre is taken from Guo
et al. (10) and that of Flp is based on the Protein
Secondary Structure Prediction Program provided by the Baylor College
of Medicine, Houston. The predicted Flp helices (bottom
panel) are named arbitrarily to obtain reasonable matches with the
Cre nomenclature. The asterisks in Cre indicate amino acids
that are in close proximity to DNA. The shaded sequences in
Cre represent two conserved regions in prokaryotic Int type
recombinases as follows: Box I (or Box A) and Box II (or Box B plus Box
C) (1, 2). In Flp, the regions of protease protection are
underlined and labeled as in Fig. 4C. The
conserved boxes of the yeast family recombinases, Box I and Box II (41),
are shown by the shaded areas. Note that the demarcation of
the yeast family Box II places the active site tyrosine (shown in
bold letter) outside its boundary, whereas the prokaryotic
Box II includes this residue. The RHR catalytic triads (within Box I
and Box II) are also shown in bold letters. The observed
protections in Flp are in fair agreement with the expectations based on
the protein-DNA and protein-protein contacts revealed by the Cre
structure (10). The Flp to Cre alignment is similar to those published
previously (2, 12). B, the global three-dimensional topology
of the Flp protein is obtained by fitting the secondary structure of
Flp (predicted by Protein Secondary Structure Prediction Program) to a
proposed model structure for Flp (30). To do this, the amino-terminal
domain of the protein is moved with respect to the carboxyl-terminal
domain using the presumably flexible interdomainal peptide loop so as
to bring the former into close proximity with DNA. In the resulting
protein-DNA model, the DNA is held between the two domains in a manner
that is analogous to the mode of substrate association by the Cre
protein (10). The peptide regions protected in the protease
footprinting assays (p'0, PI-IV) are indicated in
red. Note that the A/B helices together with the D helix
could form a scissors-like grip on the DNA primarily through the major
groove. The clustering of the RHR triad residues around the scissile
phosphodiester bond (shown in red) and the positioning of
the active site tyrosine (shown in green) away from it are
consistent with the mechanism of phosphate orientation and the
trans mode of nucleophile donation during strand cleavage by
Flp. The protection of this tyrosine and the adjacent peptide segment
must result from proximity to DNA at the other end of the spacer.
Carboxyl-domain Footprints of Flp-- The PII and PIII footprints (Fig. 9A) observed in the carboxyl-terminal domain of Flp show overlap with two highly conserved amino acid regions within the Int type yeast recombinases, referred to as Box I and Box II, respectively (41). The hallmark catalytic triad of the Int family (Arg-191, His-305, and Arg-308 in Flp; Refs. 42 and 43) are located within the following boxes: Arg-191 in Box I (spanning positions 185-203; Fig. 9A) and His-305 and Arg-308 in Box II (spanning positions 295-313; Fig. 9A). The Box I (also called Box A) and Box II homologies extend to the prokaryotic members of the Int family as well (1, 2). However, Box II has been expanded in these protein alignments and includes the invariant active site tyrosine as well. Note that Box II is a composite of the B and C boxes in the classification of Esposito and Scocca (1). The PIV Flp footprint includes Tyr-343, the active site nucleophile for the strand cleavage reaction.
The rather extended series of footprints covering the carboxyl-terminal domain of Flp is consistent with the observation that, in the crystal structure (10) of Cre, DNA contacts essentially span the entire carboxyl-terminal portion of the protein. Furthermore, the predicted secondary structural features of the Flp carboxyl-terminal domain align reasonably well with the corresponding domain of Cre (Fig. 9A). The similarity breaks down toward the extreme carboxyl terminus, where Flp has a relatively long peptide tail compared with Cre.
The PI and PII protections and the cleavage enhancement adjacent to PIII (see Fig. 4C) showed subtle differences depending on the type of DNA substrate to which Flp was bound. The protections were more prominent in the S2 substrate (full-site) compared with S1 (half-site) or HS4 (Holliday junction). The cleavage enhancement, on the other hand, was less conspicuous in HS4 compared with S1 or S2. These variations in the footprint profiles likely reflect differences in DNA-protein or protein-protein interactions and conformational dynamics within the recombination complexes at individual stages of the reaction.
Amino-terminal Footprints of Flp-- The amino-terminal domain of Flp contains two footprints, p'0 and PI, located near the opposite ends of this domain (Fig. 4C and Fig. 9B). The PI footprint would correspond to the DNA contact points observed in the D and E helices and the interhelical segment between E and F helices of the Cre protein (10). In the Cre structure, the amino-terminal helices B and D are seen to contact the DNA major groove. The Flp results do not reveal an obvious footprint that can be interpreted as equivalent to the B helix-DNA interaction of Cre. The p'0 protection in Flp (proximal to the carboxyl-terminal side of helix A; Fig. 9B) may represent the corresponding, if somewhat altered, DNA contact by Flp. The secondary structural correspondence between the amino-terminal domains of Flp and Cre are quite poor and are therefore not aligned in Fig. 9. We suspect that DNA recognition by the amino-terminal domains of Flp and Cre may be less well conserved than that of their carboxyl-terminal domains.
Substrate Recognition by the Int Family Recombinases, DNA Binding by C-shaped Protein Clamps-- The protease footprinting results obtained for Flp, together with the available structural and biochemical information for the Int family members, suggest a reasonable global conformation for the Flp-DNA complex. In Fig. 9B, the Flp protein is shown to form a C-clamp around the DNA in a manner analogous to Cre (10). A similar mode of DNA binding is accommodated by the Flp model structure of Saxena et al. (30), provided the amino-terminal domain is swung into position to contact DNA. The picture of DNA being cradled within a protein crescent agrees well with the bidomain architecture of Flp deduced from partial proteolysis of the free protein or the protein bound to DNA (8, 28, 38). This mode of DNA interaction is also supported by UV cross-linking studies demonstrating that the amino-terminal domain of Flp contacts the spacer-proximal 4 bp of the binding element, whereas the carboxyl-terminal domain contacts the spacer-distal 9 bp (39). The general view of the Flp-DNA complex presented here will be refined by crystal structures of Flp-DNA complexes that are currently being solved.4 However, the inferred similarity between Flp and Cre in their DNA association validates the rationale for inquiring how two similar protein-DNA assemblies yield different modes of strand cleavage.
Directed DNA Bends as the Agent of Strand Cleavage Selectivity-- The results from the present study, together with those of Lee et al. (22), have shown that nucleotide bulges located centrally within the spacer induce the same directionality of cleavage bias in synthetic Cre and Flp substrates. It is the strand that contains the bulge that is the preferred target for cleavage in both cases. Based on the geometric effects of nucleotide bulges in double-stranded nucleic acids (25-27, 44, 45), the biased cleavages can be accounted for by two distinct DNA bends, equivalent in magnitude but opposite in orientation. In the absence of the bulge, a substrate bound by a Flp or Cre dimer has a finite probability of establishing either of these two DNA bends. The bulge, depending on the strand that contains it and its relative location within that strand, can enrich one type of DNA bend by selectively blocking the other. The bulge-mediated cleavage exclusion on one of the two strands in Flp substrates is consistent with the overall features of the Flp-induced DNA bend described extensively by Sadowski and colleagues (46-48). Furthermore, the most recently solved structure of the pre-cleavage synaptic complex formed by Cre (40) also suggests that it is the DNA bend direction that specifies the strands to be cleaved and exchanged in the initial step of recombination.
The positional effects of the bulge on the magnitude and direction of the bias indicate similar trends for both Flp and Cre. The implication is that both recombinases induce identical or similar DNA configurations when bound to the two substrate arms flanking the spacer. By extrapolation, a similar geometry also exists in the recombination complexes, in which all four arms of the DNA partners are protein-bound.
Global Change in Strand Cleavage Mode by Local Change in Peptide
Geometry--
The Cre crystal structure reveals that it is the extreme
carboxyl-terminal region of Cre consisting of the K, L, M, and N helices and the tail end of the protein that partake in the
interactions responsible for the allosteric activation of one monomer
within a dimer to cleavage competence (Fig.
10, top; see Refs. 9 and 10). The perspective in Fig. 10 brings into view the relevant portions
of the carboxyl-terminal domain of Cre. The outline of the DNA backbone
is included to indicate the direction of the bend (corresponding to
bottom strand bulge and cleavage at the right spacer end by the
green monomer). A two-dimensional projection of the K-N
helices and their connectivities is shown in the bottom left
panel of Fig. 10. Gopaul and Van Duyne (23) have pointed out that,
for a given recombinase subunit, an extensible tether between the L and
M helices could, in principle, confer the trans configuration on M (which harbors the catalytic tyrosine), whereas the
rest of the carboxyl-terminal peptide folds back to retain the
cis configuration of N. The strand cleavage patterns imposed by the spacer bulges in Cre and Flp reactions are consistent with this
model. In the representation of the Flp dimer in Fig. 10 (bottom right), the purple L helix is connected to M'-N',
defining the peptide connectivity within a monomer of the
trans cleaving recombinase. The M-N helices (now linked to
the green L' helix) are swung away to designate their
plausible location within a recombination complex containing a
recombinase tetramer (23). Although the cyclic contact between adjacent
recombinase monomers is counterclockwise for the Cre tetramer (Fig. 10,
bottom left), it becomes clockwise for Flp (Fig. 10,
bottom right) in order to retain identity in strand
cleavage. It seems plausible that a trans cleaving
recombinase could have evolved differently, by maintaining the
counterclockwise interaction seen in Cre, but adopting strand
selectivity in cleavage opposite to that of Cre.
|
Evolution of Divergent Protein Folds for a Conserved
Function--
The evolution of two distinct DNA cleavage modes within
the Int family recombinases by localized amino acid changes among its
members does not contradict the rules of protein structure and folding.
A relevant example is the conversion of staphylococcal nuclease from
the native monomer form into a stable dimer by a short peptide deletion
in a surface loop (49). The resultant stripping of the
carboxyl-terminal 
helix from its normal position (cis)
and its incorporation into an equivalent position on the adjoining
monomer (trans) is analogous to the switching of peptide connectivities diagrammed in Fig. 10. More recently, it has been shown
that interchanging two amino acid neighbors in the Arc repressor transforms the local peptide fold from a 
strand into a right-handed helix (50). This structural alteration has little effect on the global
protein stability or folding cooperativity.
| |
ACKNOWLEDGEMENTS |
|---|
We acknowledge the gift of the Cre expression vector by Ron Hoess and a sample of pure Cre preparation by Enoch Baldwin. We thank Klaus Linse and associates at the Core Facility of the Institute for Cell and Molecular Biology (University of Texas, Austin) for performing protein sequencing. We are grateful to Shailja Pathania for helping with the preparation of figures and to all our colleagues for comments and criticism. Cecil Harkey provided excellent technical assistance.
| |
FOOTNOTES |
|---|
* This work was supported in part by grants from the National Institutes of Health and the Robert F. Welch foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Recipient of a National Institutes of Health postdoctoral fellowship.
** To whom correspondence should be addressed. Tel.: 512-471-0966; Fax: 512-471-5546; E-mail: jayaram@icmb.utexas.edu.
Published, JBC Papers in Press, March 9, 2000, DOI 10.1074/jbc.M90826199
2 J. Lee and M. Jayaram, unpublished data.
3 G. Tribble, Y.-T. Ahn, J. Lee, T. Dandekar, and M. Jayaram, unpublished data.
4 P. Rice and M. M. Cox, personal communication.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: PVDF, polyvinylidene difluoride; bp, base pair; NS, nonspecific; Int, Integrase.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Esposito, D., and Scocca, J. J. (1997) Nucleic Acids Res. 25, 3605-3614 |
| 2. | Nunes-Duby, S. E., Kwon, H. J., Tirumalai, R. S., Ellenberger, T., and Landy, A. (1998) Nucleic Acids Res. 26, 391-406 |
| 3. | Nash, H. A. (1996) in Escherichia coli and Salmonella, Cellular and Molecular Biology (Neidhart, F. C., ed), Vol. 2 , pp. 2363-2376, American Society for Microbiology, Washington, D. C. |
| 4. | Sadowski, P. D. (1993) FASEB J. 7, 760-767 |
| 5. | Landy, A. (1993) Curr. Opin. Genet. & Dev. 3, 699-707 |
| 6. | Lilley, D. M. (1997) Chem. Biol. 4, 717-720 |
| 7. | Chen, J.-W., Lee, J., and Jayaram, M. (1992) Cell 69, 647-658 |
| 8. | Evans, B. R., Chen, J. W., Parsons, R. L., Bauer, T. K., Teplow, D. B., and Jayaram, M. (1990) J. Biol. Chem. 265, 18504-18510 |
| 9. | Gopaul, D. N., Guo, F., and Van Duyne, G. D. (1998) EMBO J. 17, 4175-4187 |
| 10. | Guo, F., Gopaul, D. N., and Van Duyne, G. D. (1997) Nature 389, 40-46 |
| 11. | Hickman, A. B., Waninger, S., Scocca, J. J., and Dyda, F. (1997) Cell 89, 227-237 |
| 12. | Kwon, H. J., Tirumalai, R., Landy, A., and Ellenberger, T. (1997) Science 276, 126-131 |
| 13. | Pargellis, C. A., Nunes-Duby, S. E., de Vargas, L. M., and Landy, A. (1988) J. Biol. Chem. |
