 |
INTRODUCTION |
There are two well characterized modes of action of drugs acting
against eukaryotic topoisomerase II. Anti-cancer topoisomerase II
poisons such as etoposide, amsacrine, and doxorubicin stabilize an
intermediate in the topoisomerase II reaction in which the two
topoisomerase II subunits are covalently bound to DNA via a
phosphotyrosine linkage. This covalent intermediate, termed the
covalent complex plays a critical role in cell killing by anti-topoisomerase II agents (reviewed in Refs. 1-3). The second class
of agents do not stabilize the covalent intermediate of the
topoisomerase II reaction, but inhibit the enzyme at other points of
the reaction cycle (1, 4). Since blocking the enzyme at other points of
the reaction cycle does not result in DNA damage, this second class of
agents is thought to kill cells by depriving them of the essential
enzyme activity of topoisomerase II. This second class of inhibitors
has been termed catalytic inhibitors to distinguish them from agents
that act by stabilizing covalent complexes.
A major class of catalytic inhibitors of prokaryotic topoisomerase II
inhibits topoisomerase activity by preventing ATP binding (5). These
inhibitors include novobiocin and the coumermycins. Most of these
inhibitors have relatively low potency against eukaryotic topoisomerases (5). Other, more potent catalytic inhibitors of
eukaryotic topoisomerases have been described, these include anthracyclines such as aclarubicin that intercalate in DNA and prevent
the binding of the enzyme to DNA (6, 7), and merbarone, which inhibits
DNA cleavage by the enzyme (8-10).
Wang and colleagues (11) have demonstrated that during the course of
the topoisomerase II reaction, the enzyme forms a closed clamp around
DNA. ATP binding is required to generate a closed clamp with wild type
topoisomerase II, and ATP hydrolysis generates a conformational change
that leads to reopening of the clamp (11, 12). Subsequently, Roca
et al. (13) showed that bisdioxopiperazines inhibit the
re-opening of the closed clamp, and also blocks ATP hydrolysis.
Therefore, bisdioxopiperazines would sequester topoisomerase II in the
closed clamp conformation, and inhibit enzyme activity inside the cell.
Support for this mode of action of bisdioxopiperazines in
vivo has been obtained from both yeast and mammalian cells.
Overexpression of topoisomerase II in yeast leads to resistance to
ICRF-193,1 while reducing the
activity of the enzyme leads to increased cell killing, suggesting that
cell death arises from a lack of topoisomerase II activity. Studies by
Andoh and colleagues have shown that ICRF-187 or ICRF-193 exposure
results in a failure to complete a normal mitosis, and can generate
polyploid cells (4). In vitro, bisdioxopiperazines prevent
decatenation of replicated chromosomes by topoisomerase II (4, 14).
These results are consistent with the hypothesis that a principal mode of cell killing by bisdioxopiperazines is by preventing topoisomerase II from decatenating replicated chromosomes at mitosis; a function that
absolutely requires topoisomerase II (15-17).
Expression of human topoisomerase II in yeast cells that lack
topoisomerase II activity has been shown to complement the essential functions of the yeast enzyme (18, 19). In this report, we have
investigated the action of bisdioxopiperazines against human topoisomerase II 
(top-II). We have found that the human enzyme is substantially more sensitive to bisdioxopiperazines than the yeast
type II topoisomerase. Unexpectedly, we have found that expression of
top-II confers dominant sensitivity to bisdioxopiperazines, a result
that is not in obvious agreement with these drugs acting as catalytic
inhibitors of the enzyme. Nonetheless, we were unable to detect levels
of covalent complexes that would be consistent with these drugs acting
as topoisomerase poisons. We suggest that the closed clamp conformation
of topoisomerase II is a novel type of topoisomerase poison, and that
the closed clamp form of the enzyme trapped on DNA is sufficient to
interfere with DNA metabolism and cause cell killing.
| |
EXPERIMENTAL PROCEDURES |
Yeast Strains and Plasmids--
All experiments were carried out
in JN362a (MATa ura3-52 leu2 trp1 his7 ade1-2
ISE2), or its isogenic rad52
and top2-4
derivatives, JN362at2-4 (MATa ura3-52 leu2 trp1
his7 ade1-2 ISE2 top2-4), JN394 (MATa ura3-52
leu2 trp1 his7 ade1-2 ISE2 rad52::LEU2), and JN394t2-4
(MATa ura3-52 leu2 trp1 his7 ade1-2 ISE2
rad52::LEU2 top2-4) (20-23). Strains expressing human
topoisomerase II were constructed by transforming the strains listed
above with the human topoisomerase II expression plasmids described in
the following paragraph using a modified lithium acetate procedure
(24).
The episomal expression vector for human topoisomerase II in yeast
pMJ1 has been described in detail elsewhere (25). Briefly, this plasmid
comprises the entire coding region of human topoisomerase II under
the control of the yeast TOP1 promoter as well as an URA3
selective marker, a yeast origin of replication, and a yeast centromere
for the introduction and maintenance of the plasmid in yeast. pKN9 is
essentially identical to pMJ1, except it was constructed using
yCPlac111 (26) and therefore carries LEU2 as a selectable
marker instead of URA3. The plasmid yCP50, which contains a
URA3 gene, and is maintained in yeast as a single copy plasmid, was used as an empty vector control for experiments with pMJ1
(27).
Construction of Mutated Human Topoisomerase II Genes--
Mutations in human topoisomerase II were constructed in the
plasmid pMJ1 using the Stratagene kit. The mutation of
Tyr50 
Phe, which confers resistance to
bisdioxopiperazines, has been described previously (28). A plasmid
expressing human topoisomerase II that carries a mutation in the active
site tyrosine of human topoisomerase II a (Tyr805 Phe)
was constructed using the following primers Y805FF and Y805FR
indicated: CTGCTAGTCCACGATTCATCTTTACAATGCTC (Y805FF);
GAGCATTGTAAAGATGAATCGTGGACTAGCAG (Y805FR). The underlined
base was mutated to generate the Tyr805 Phe mutation.
The presence of the desired mutation was verified by DNA sequencing.
Proteins--
Wild type yeast topoisomerase II was overexpressed
with a plasmid that carries the yeast TOP2 gene under the
control of the GAL1 promoter, using strain JEL1t1.
JELt1 was constructed by converting JEL1 (29) to
top1 using a top1::LEU2 disruption
vector (30), as described previously. Purification of yeast Top2p was
as described previously (20, 31, 32). A vector for expressing human
topoisomerase II was constructed by cloning the entire open reading
frame of human topoisomerase II from plasmid pBShTOP2 (a gift of
Dr. J. C. Wang, Harvard University, Cambridge, MA) under the
control of the yeast GAL1 promoter. This plasmid, pYX113pGALhTOP2,
carries the entire open reading frame of the enzyme under the control of the GAL1 promoter. Human topoisomerase II was expressed in strain JEL1t1, and was purified as described previously
(30, 33).
Drugs--
ICRF-187 (dexrazoxane) was purchased from Eurocetus.
ICRF-193 was synthesized by Dr. Donald Witiak (University of Wisconsin, Madison, WI) as described previously (34). Etoposide was purchased from
Sigma. All compounds were dissolved in Me2SO, and stored at
20 °C in small aliquots.
Topoisomerase II Assays--
DNA topoisomerase II assays were
carried out as described previously (20, 21, 32) The K+/SDS
assay was used to determine drug stabilized DNA cleavage, and was
performed as described previously (20, 32).
Measurement of Drug Sensitivity in Yeast Cells--
Drug
sensitivity in yeast cells was carried out as described previously (21,
32, 35, 36). Briefly, a logarithmically growing culture of yeast cells
(grown in either YPDA or synthetic complete dropout medium as
indicated) was diluted to 2 × 106 cells/ml, and drug
or Me2SO was added. Aliquots were removed, diluted and
plated to either YPDA plates, or to synthetic complete dropout plates.
Synthetic complete dropout plates lack one nutrient required for growth
of the yeast strains used, and were used to maintain selection for
plasmids that complement the auxotrophy. For example, in experiments
examining cell survival with cells carrying pMJ1, cells were plated to
synthetic complete medium lacking uracil. Survival is expressed
relative to the number of viable colonies at the time of drug addition.
Drug sensitivity determinations were carried out at least three times
for each strain, and representative results are shown.
Immunoprecipitation of hTOP2 Protein from Yeast Cell
Lysates--
Cell lysates for immune precipitations were prepared by
vortexing cells in the presence of glass beads in ice-cold PEB (200 mM Tris-HCl, pH 8.0, 400 mM
(NH4)2SO4, 10 mM
MgCl2, and 10% glycerol (v/v)) containing freshly added 1 mM 4(2-aminoethyl)-benzenesulfonyl fluoride (ICN) and 1 mM dithiothreitol until about 90% of the cells were
visibly lysed. The lysate was then spun in an Eppendorf microcentrifuge
at 14,000 rpm for 10 min at 4 °C. The cell lysates were then treated
with 20 µl of a protein A-Sepharose CL-4B slurry (prepared according
to manufacturer's instructions) for each 400 µl of cell lysate. The
cell lysates containing the slurry were incubated with gentle rocking
at 4 °C for 30 min, then centrifuged in a microcentrifuge for 1 min
at 200 × g. The supernatants were saved, and protein
concentration of the supernatants was determined using the Bio-Rad
protein determination kit. Appropriate volumes of extract were treated
with 10 ml of rabbit polyclonal anti-human topoisomerase II antibody
(Topogen; 2.5 units/ml). Samples were incubated at 4 °C with gentle
rocking for 2 h, then 100 ml of protein A-Sepharose CL-4B slurry
was added to each tube and incubation was continued at 4 °C for
another 2 h. The suspension was centrifuged at 200 × g for 5 min, and the pellets were washed successively in 10 mM Tris-HCl, 150 mM NaCl, 0.1% Triton X-100,
0.025% sodium azide; 10 mM Tris-HCl, 150 mM
NaCl, 0.025% sodium azide; and 50 mM Tris-HCl, pH 6.8. Finally, the pellets were resuspended in 2× Laemmli buffer (4% SDS,
20% glycerol, 100 mM Tris-HCl, pH 6.8, 200 mM
dithiothreitol, and 2 mg/ml bromphenol blue).
Gel Electrophoresis and Western Blotting--
Protein samples
were subjected to electrophoresis using 6% polyacrylamide gels as
described previously (37, 38). Transfer to nitrocellulose membranes
used standard procedures, and detection of proteins was performed using
an ECL kit (Amersham Pharmacia Biotech). Rabbit poyclonal antibodies
directed against yeast or human topoisomerase II were obtained from Topogen.
Cell Cycle Arrest--
Yeast cells were synchronized in
G1 with factor as described previously (39). Briefly,
an overnight culture was diluted to 5 × 106 cells/ml,
and incubated with 20 µg/ml factor for 3-4 h. Cells were washed
twice with pre-warmed medium and resuspended at 2 × 106 cells/ml. Cells were then treated as described in the
section describing determination of drug sensitivity.
Analytical Ultracentrifugation--
Analytical
ultracentrifugation analysis of closed clamp formation was performed as
described previously by Hsieh and colleagues (40). Briefly, a 40-µl
reaction mixture containing 10 mM Tris-HCl, pH 8.0, 50 mM KCl, 100 mM NaCl, 10 mM
MgCl2, 0.1 mM EDTA, 50 µg/ml bovine serum
albumin, 25 nM pCaSpeRhs83 DNA (circular or linearized), and 300 nM topoisomerase II protein was incubated at
30 °C for 15 min. Some reactions also included 0.5 mM
nucleoside triphosphate cofactor (ATP or AMPPNP). Experiments were
carried out with either wild type yeast topoisomerase II, or with a
mutant protein where the active site tyrosine (Tyr782) was
mutated to phenylalanine. The reaction was terminated by adding a
chilled mixture of 330 µl of saturated CsCl solution and 107 µl of
10 mM Tris-HCl, pH 8.0, to make the final density of the
solution 1.65 g/ml. The mixture was spun at 40,000 rpm in an analytical
ultracentrifuge (XL-A ultracentrifuge, Beckman Instruments) at 20 °C
for 36 h before scanning the DNA concentrations across the
gradient at wavelengths of 260 and 280 nm.
| |
RESULTS |
Human Topoisomerase II Is More Sensitive to Bisdioxopiperazines
than Yeast Topoisomerase II--
We have been studying the effects of
bisdioxopiperazines against eukaryotic topoisomerases. Since previous
mechanistic characterization of these drugs has relied principally on
yeast topoisomerase II (13), we first compared the sensitivity of
purified yeast or human topoisomerase II to bisdioxopiperazines.
Nearly complete inhibition of relaxation activity was observed at 2.5 µg/ml ICRF-193 when incubated with 100 ng of human topoisomerase II
(Fig. 1). By contrast, 50-100
µg/ml ICRF-193 was required to achieve the same degree of inhibition
with the purified yeast enzyme. Note that both enzymes were purified
from a yeast strain lacking topoisomerase I, so that all of the
relaxation activity in both enzyme preparations was due to
topoisomerase II. Similar results were obtained using a decatenation
assay (data not shown). These results indicate that ICRF-193 is about
20-fold more potent as an inhibitor of human topoisomerase II compared with yeast topoisomerase II.
View larger version (65K):
[in this window]
[in a new window]
|
Fig. 1.
Activity of yeast and human topoisomerase II
in the presence of ICRF-193. One unit of purified yeast or human
topoisomerase II was incubated with supercoiled pUC18 in the presence
or absence of varying concentrations of ICRF-193. Lane
M, molecular weight markers; lane 1,
pUC18 with no enzyme; lane 2, yeast top-II, no
ICRF-193; lane 3, as lane 2 but 10 µg/ml ICRF-193; lane 4, as
lane 2 but 25 µg/ml ICRF-193; lane
5, as lane 2 but 50 µg/ml ICRF-193;
lane 6, as lane 2 but 100 µg/ml ICRF-193; lane 7, as lane
2 but 500 µg/ml ICRF-193; lane 8,
human top-II, no ICRF-193; lane 9, as
lane 8 but 0.5 µg/ml ICRF-193; lane
10, as lane 8 but 1 µg/ml ICRF-193;
lane 11, as lane 8 but 2.5 µg/ml ICRF-193; lane 12, as lane
8 but 5 µg/ml ICRF-193; lane 13, as
lane 8 but 10 µg/ml ICRF-193.
|
|
Yeast Cells Expressing Human Topoisomerase II Are Greatly
Sensitized to Bisdioxopiperazines--
We next examined the
sensitivity of yeast cells expressing human top-II to various
bisdioxopiperazines. To assess the cytotoxicity of ICRF-193 on cells
depending on human topoisomerase II for growth, JN362at2-4 cells
transformed with pMJ1 were used. We have previously shown that these
cells are sensitive to bisdioxopiperazines (28, 41). pMJ1 carries the
entire coding sequence of human topoisomerase II under the control
of the yeast TOP1 promoter (25). Bisdioxopiperazine
sensitivity was determined at 34 °C, so that the only active
topoisomerase was the human enzyme. Cells were exposed to various
concentrations of ICRF-193, and aliquots were removed after 8 and
24 h, diluted, and plated to determine cell viability (Fig.
2A).
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 2.
Sensitivity of yeast cells expressing human
top-II to ICRF-193. Yeast cells carrying
the plasmid pMJ1 (wild type human top-II under the control of the
yeast TOP1 promoter) were exposed to different
concentrations of ICRF-193 for the indicated times. Aliquots were
removed, and diluted samples were plated to synthetic medium lacking
uracil. A, JN362at2-4 cells (relevant genotype
top2-4 RAD52+) were treated with no drug
(open squares), 1 µg/ml ICRF-193
(open diamonds), 5 µg/ml ICRF-193
(open circles), or 10 µg/ml ICRF-193
(open triangles). B, same experiment
performed with the isogenic rad52 derivative
JN394t2-4. The conditions denoted by the symbols are the
same as in A.
|
|
Yeast cells transformed with pMJ1 were extremely sensitive to ICRF-193.
ICRF-193 concentrations of 1 µg/ml were completely growth-inhibitory,
while higher drug concentrations were cytotoxic. At 10 µg/ml
ICRF-193, cell viability was reduced below 0.1% after 24 h of
drug exposure. By contrast, we previously observed that concentrations
of greater than 50 µg/ml were required to completely inhibit growth
in yeast cells expressing yeast topoisomerase II (41). These results
are consistent with the enhanced in vitro activity of
ICRF-193 against the human top-II described above.
Previous studies showed that there was only a minor dependence of cell
killing by ICRF-193 on the RAD52 recombinational repair pathway (41). This is in marked contrast to complex stabilizing topoisomerase II inhibitors, where mutations in the RAD52
pathway greatly stimulate cell killing (35, 42). The isogenic
rad52 strain, JN394t2-4, transformed with
pMJ1 was examined for ICRF-193 sensitivity to test the role of the
RAD52 pathway in sensitivity to ICRF-193. As shown in Fig.
2B, 1 µg/ml ICRF-193 inhibits growth, and cytotoxicity
occurs at higher drug concentrations. The level of cell killing at
higher drug concentrations in rad52 cells is
very similar to that seen in RAD52+ cells. As is
the case of yeast cells expressing yeast topoisomerase II, yeast cell
killing mediated by human topoisomerase II does not show a major
dependence on the RAD52 repair pathway.
Expression of Human Topoisomerase II in Yeast Cells Confers
Dominant Sensitivity to ICRF-193--
Since the yeast enzyme is much
less sensitive to ICRF-193 than the human top-II, we had available
both a drug-sensitive and a drug-resistant form of topoisomerase II. It
has previously been shown that resistance to complex stabilizing drugs
such as etoposide is recessive, i.e. a drug-sensitive allele
of the enzyme will confer drug sensitivity regardless of the presence
of a drug-resistant allele (20, 21, 43). If bisdioxopiperazines kill
cells by depriving them of an essential catalytic activity, then drug
sensitivity should be recessive, i.e. a
bisdioxopiperazine-resistant enzyme will confer drug resistance even if
a drug-sensitive enzyme is present. We tested this hypothesis by
transforming JN394, a yeast strain with a wild type topoisomerase II,
with the human top-II expression plasmid pMJ1, and determined
ICRF-193 sensitivity. To ensure that we only examined cells carrying
pMJ1, drug sensitivity measurements were carried out in synthetic
medium lacking uracil, which selects for pMJ1, and cell viability was
determined by plating to SC-URA plates. Unexpectedly, JN394 cells
expressing human top-II were very sensitive to ICRF-193 (Fig.
3.) As was the case in cells carrying the
top2-4 mutation, complete growth inhibition was observed at
1 µg/ml ICRF-193. Higher drug concentrations were cytotoxic in JN394
(TOP2+) cells, as was seen in top2-4
cells. The level of cell killing at 3 and 10 µg/ml ICRF-193 was less
than was observed in the top2-4 strain, indicating that the
wild type yeast TOP2 had some effect on cytotoxicity; however, the
observed result is opposite of the result predicted if
bisdioxopiperazines are acting solely as catalytic inhibitors of
topoisomerase II. Similar ICRF-193 sensitivity was obtained in strain
JN362a, which has a wild type RAD52 gene (data not shown);
thus, the dominant drug sensitivity does not depend on the RAD52
pathway. Dominant drug sensitivity was also observed with ICRF-187, a
bisdioxopiperazine that is less potent than ICRF-193, indicating that
dominant sensitivity is likely to be a characteristic of all
bisdioxopiperazines, not just ICRF-193 (data not shown).
View larger version (17K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of human top-II
confers dominant sensitivity to ICRF-193. Yeast cells
carrying the plasmid pMJ1 (wild type human top-II under the control
of the yeast TOP1 promoter) were exposed to different
concentrations of ICRF-193 for the indicated times. Unlike the
experiments shown in Fig. 2, the yeast strain JN394 expresses a wild
type yeast topoisomerase II (as well as wild type htop-II). JN394 is
also rad52. As in Fig. 2, aliquots were
removed, and diluted samples were plated to synthetic medium lacking
uracil. Cells (relevant genotype top2-4
rad52) were treated with no drug (open
squares), 1 µg/ml ICRF-193 (open
diamonds), 5 µg/ml ICRF-193 (open
circles), or 10 µg/ml ICRF-193 (open
triangles).
|
|
We next tested whether the topoisomerase II activity of human top-II
was required to confer sensitivity to ICRF-193. A mutant human TOP2
gene was constructed bearing a mutation at Tyr805
(Tyr805 Phe). This mutation is in the tyrosine directly
involved in the trans-esterfication reaction by which topoisomerase II
cleaves DNA; hence, the protein completely lacks topoisomerase activity (44). Expression of this protein in strain JN394 (TOP2+)
does not change sensitivity to ICRF-193 over what is seen in strains
expressing no human top-II (Fig.
4A). No growth inhibition was
seen at 2 or 20 µg/ml ICRF-193 when the Tyr805 Phe
protein was expressed. Since this protein cannot complement a yeast
TOP2 mutation, it was necessary to verify that the mutant protein was being expressed. As shown in Fig. 4B, the
expression of the Tyr805 Phe protein by immune
precipitation with an antibody directed against human topoisomerase II.
This antibody does not immunoprecipitate yeast topoisomerase II (see
Fig. 5). Fig. 4B indicates
that the expression of the Tyr805 Phe polypeptide is
the same as wild type human top-II. This experiment demonstrates
that topoisomerase II activity is necessary for sensitivity to
ICRF-193.
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
Tyr805 Phe mutant of human
top-II does not confer ICRF-193
sensitivity. JN394 cells were transformed with plasmid pMJ1Y805F.
This plasmid expresses a mutant htop-II, in which the active site
tyrosine has been changed to phenylalanine. A shows the
ICRF-193 sensitivity of JN394 cells that carry pMJ1Y805F. Cells were
plated to SC-URA to confine the survival data to cells that still
carried pMJ1Y805F. B shows an immunoprecipitation that
compares the level of human top-II polypeptide in cells carrying
either pMJ1 or pMJ1Y805F. Cell extracts were prepared from both strains
as described under "Experimental Procedures," and 500 µg of total
protein from each extract was used for immune precipitation.
Precipitates were subjected to SDS-PAGE and transferred to a
nitrocellulose membrane. The membrane was probed with antibody directed
against htop-II polypeptide.
|
|
View larger version (54K):
[in this window]
[in a new window]
|
Fig. 5.
Yeast topoisomerase II does not detectably
heterodimerize with human topoisomerase II. Cell extracts were
prepared from JEL1t1- cells carrying pYX113pGALhTOP2 grown in
galactose. Extracts were immunoprecipitated with antibody directed
against human topoisomerase II , subjected to SDS-PAGE, and
transferred to a nitrocellulose membrane. The membrane was probed with
antibody directed against either htop-II polypeptide or yeast
topoisomerase II. Lane 1, 1 mg of extract;
lane 2, 2 mg of extract probed with antibody
directed against htop-II polypeptide; lane 3,
1 mg of extract; lane 4, 2 mg of extract probed
with antibody directed against yeast topoisomerase II.
|
|
A potential explanation for the dominant sensitivity conferred by the
expression of human top-II in yeast cells also expressing wild type
yeast topoisomerase II is that the two proteins heterodimerize, resulting in a holoenzyme that is either bisdioxopiperazine-sensitive or enzymatically inactive. To test this possibility, we carried out
immune precipitations with antibody directed against human top-II.
We have previously observed that the antibody we used directed against
human top-II minimally cross-reacts with yeast topoisomerase II
(25). Therefore, if the yeast and human proteins can heterodimerize,
immune precipitation with antibody directed against the human enzyme
will also bring down the yeast enzyme. Immune precipitation was carried
out as described under "Experimental Procedures," and the
precipitated proteins were electrophoresed in acrylamide gels. After
transfer to nylon membranes, the blots were probed with antibody
directed against either yeast Top2p or human top-II protein. As
shown in Fig. 5, probing of the immunoprecipitate with anti-human
top-II antibody detects the 170-kDa human top-II polypeptide, but
the antibody directed against the yeast protein fails to detect a band
at the expected 165-kDa position. This result argues that human and
yeast topoisomerase II do not form stable heterodimers when they are
co-expressed in yeast.
A second possible explanation for the observed dominant sensitivity to
bisdioxopiperazines by expression of human topoisomerase II is that
expression of human topoisomerase II reduces the level of yeast
topoisomerase II. This could happen in at least two ways. Expression of
human topoisomerase II could reduce the transcription or translation of
the yeast TOP2 message. Alternately, abortive heterodimerization of the
human and yeast proteins could result in unstable holoenzyme that is
targeted for degradation. Both possibilities would result in a
reduction in the level of yeast Top2 polypeptide, leaving primarily the
bisdioxopiperazine-sensitive human topoisomerase II protein. We
examined this possibility using two different approaches. First, we
directly compared the level of Top2 polypeptide in yeast cells
expressing human top-II, or in cells that did not express the human
protein. Extracts were prepared from the two strains and
electrophoresed in acrylamide gels. After transfer to nylon membranes,
the blots were probed with antibody directed against yeast Top2p (Fig.
6). The levels of Top2p were essentially
indistinguishable whether human top-II was expressed or not. This
result strongly suggests that expression of human topoisomerase II does
not affect the level of yeast Top2p.
View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
Expression of human top-II
does not changes levels of yeast Top2p. Cell extracts were
prepared from strain JN394 carrying either yCP50 or pMJ1. Duplicate
samples containing 400 µg of protein were subjected to
electrophoresis, transferred to nitrocellulose membranes, and probed
with either antibodies directed against either yeast topoisomerase II
or human topoisomerase II as indicated on the figure.
|
|
We performed an additional functional test to determine whether
expression of human top-II affects the level of active yeast Top2p.
Gasser and colleagues (45) previously reported that expression of an
active site tyrosine mutant (Tyr782 Phe) of yeast TOP2
confers resistance to etoposide. Presumably, the resistance arises from
forming an inactive heterodimeric protein, and that the etoposide
resistance occurs due to the reduced level of drug-sensitive enzyme. If
the yeast and human proteins can heterodimerize, then expression of a
catalytically inactive human top-II protein will reduce the
etoposide sensitivity arising from yeast Top2p. However, if human Top2
does not affect the level of yeast Top2 protein, then etoposide
sensitivity will be unchanged. Table I
shows the etoposide sensitivity after 24 h of ICRF-193 exposure in
cells expressing human Top2 (Tyr805 Phe). Sensitivity
to etoposide in cells expressing an inactive human top-II is
identical to cells carrying a control plasmid that does not carry the
hTOP2 gene. Taken together, these results demonstrate that
expression of human topoisomerase II does not affect the level of
yeast Top2p or activity. Changes in yeast topoisomerase II cannot
explain the dominant sensitivity to bisdioxopiperazines that is
conferred by expression of human TOP2 .
Dominant Sensitivity Is Also Observed When Two Different Alleles of
Human top2 Are Co-expressed--
We recently described the isolation
of a mutant in Chinese hamster ovary topoisomerase II that results in
resistance to bisdioxopiperazines (28). The amino acid substitution
found in the Chinese hamster ovary mutant was constructed in pMJ1, and
found to confer high levels of resistance to ICRF-193 in yeast cells
expressing this mutant human top-II. We constructed a yeast strain
by transforming JN394t2-4 sequentially with pMJ1(Tyr50 Phe) and pKN9 (wild type), where the information in parentheses indicates the allele of human top-II. The plasmid pMJ1 is maintained by selection in media lacking uracil, while pKN9 is selected in media
lacking leucine, thus selection for both plasmids is maintained in
media lacking both supplements. In addition we constructed strains that
carry both pMJ1(Tyr50 Phe) and yCPlac111 (no TOP2 gene)
and pMJ1(Tyr50 Phe) and pKN9(Tyr805 Phe). Sensitivity to ICRF-193 was determined for all three strains.
Cells were grown in synthetic medium lacking uracil and leucine, and
plated to SC-Leu-Ura. The results of this experiment are shown in Fig.
7. The strain bearing both
pMJ1(Tyr50 Phe) and yCPlac111 (no TOP2 gene) is
essentially insensitive to ICRF-193, in agreement with previous
observations indicating that this mutation confers high levels of
resistance to ICRF-193. As expected, the empty vector has no effect.
Similarly, the strain bearing pMJ1(Tyr50 Phe) and
pKN9(Tyr805 Phe) also has no sensitivity to ICRF-193.
Results shown above indicated that the Tyr805 Phe
mutant by itself does not confer ICRF-193 sensitivity. Furthermore,
although the expression of both an active and an inactive topoisomerase
II should reduce topoisomerase II activity by 50% (because of the
Tyr805 Phe:Tyr50 Phe heterodimers,
which will be inactive), the cells are still able to grow well in the
presence of ICRF-193, i.e. reduction of the level of
drug-resistant enzyme does not make the cells ICRF-193-sensitive.
However, when the cells express both the Tyr50 Phe
top-II as well as the wild type enzyme, ICRF-193 causes substantial
growth inhibition. The cell titer after 24 h of exposure to
ICRF-193 is 10-20-fold lower than in the two control strains. Therefore, co-expression of both a wild type and
bisdioxopiperazine-resistant human top-II results in yeast cells
that are sensitive to the drug, and the sensitivity is not due to a
reduction in the level of drug-resistant enzyme.
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 7.
Expression of different alleles of human
top-II: bisdioxopiperazine sensitivity is
dominant. JN394t2-4 cells carrying different plasmids that
express different alleles of human topoisomerase II were treated with
ICRF-193 for the times indicated. The bisdioxopiperazine-resistant
htop-II allele used carried the Tyr50 Phe mutation.
Aliquots were removed, and diluted samples were plated to appropriate
media as described in the text to select for the plasmids contained in
each strain. Open squares, cells carrying
pMJ1Tyr50 Phe and yCPlac111 (empty vector), no
ICRF-193; closed squares, cells carrying
pMJ1(Tyr50 Phe) and yCPlac111, 50 µg/ml ICRF-193;
open triangles, cells carrying
pMJ1(Tyr50 Phe) and pKN9 (wild type human topoisomerase
II), no ICRF-193; closed triangles, carrying
pMJ1(Tyr50 Phe) and pKN9, 50 µg/ml ICRF-193;
open circles, cells carrying
pMJ1(Tyr50 Phe) and pKN9(Tyr805 Phe),
no drug; closed circles, cells carrying
pMJ1(Tyr50 Phe) and pKN9(Tyr805 Phe),
50 µg/ml ICRF-193.
|
|
ICRF-193-mediated Cell Killing of Yeast Cells Expressing Human
Topoisomerase II Differs from Cell Killing Arising from a Lack of
Topoisomerase II Activity--
If bisdioxopiperazines kill yeast cells
by inhibiting the catalytic activity of human topoisomerase II ,
then the kinetics and extent of cell killing by exposure to the drug
should be similar to that observed when cells carrying a
temperature-sensitive top2 mutation are grown at a
non-permissive temperature. To test this, we compared cell killing of
cells expressing human top-II when exposed to 25 µg/ml ICRF-193
with cell killing that occurred with cells carrying the
top2-4 allele. JN394t2-4 cells were transformed with
either pMJ1 or yCP50. Both strains were pre-grown at 25 °C. At the
start of the experiment, both strains were shifted to 34 °C, and
ICRF-193 was added to cells carrying pMJ1. Thus, both strains were
exposed to an identical heat shock. Growth of the cells was in
synthetic medium lacking uracil to maintain plasmids. At various times,
aliquots were removed and plated to SC-URA plates to determine viable
titer. The results are shown in Fig. 8.
Cell killing of pMJ1-transformed JN394t2-4 cells in the presence of 25 µg/ml ICRF-193 was much faster and to a higher level, than yCP50-transformed JN394t2-4 cells exposed to a temperature where the
endogenous yeast top2 mutant is inactive. These results provide further
support for the notion that bisdioxopiperazines to not kill yeast cells
expressing human top-II solely through depriving the cells of an
essential enzyme activity.
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 8.
Killing by ICRF-193 differs from killing due
to a lack of topoisomerase activity. JN394t2-4 cells transformed
with either yCP50 or pMJ1 were grown at 25 °C, and then shifted to
34 °C as described under "Experimental Procedures."
Open squares, cells carrying yCP50 were shifted
to 34 °C, no drug. Open circles, cells
carrying pMJ1 were shifted to 34 °C, and 25 µg/liter ICRF-193 was
added.
|
|
G1 Cell Cycle Arrest or Inhibition of DNA Replication
Does Not Prevent ICRF-193 Cytotoxicity in Yeast Cells Expressing Human
Topoisomerase II--
Since killing by a lack of topoisomerase II
occurs specifically at mitosis (16, 46), and since ICRF-193-treated
cells lose viability more quickly than cells that carry a
temperature-sensitive allele incubated at the non-permissive
temperature, it seemed likely that the timing of cell killing differed
from that occurring due to a lack of topoisomerase II activity.
Previous studies indicated that arrest with factor, which blocks
cells in G1, protected cells from cytotoxicity due to
topoisomerase II poisons, while DNA replication inhibitors provided
only partial protection (39). Thus, an examination of cell killing by
ICRF-193 in factor-arrested cells or in cells treated with
replication inhibitors should clearly distinguish between topoisomerase
II poisons and topoisomerase II catalytic inhibitors.
Fig. 9 illustrates the effects of factor arrest and treatment with hydroxyurea on cells expressing human
top-II exposed to ICRF-193. In this experiment, cells were
synchronized with a factor, as described under "Experimental
Procedures," and then either maintained in factor or released
from factor arrest. For some samples released from factor
arrest, hydroxyurea, a ribonucleotide reductase inhibitor, was added.
Unlike the results obtained with a topoisomerase II poison, factor
arrest did not protect cells appreciably from ICRF-193-mediated cell
killing. The degree of cell killing was the same whether factor was
present or not. Treatment with hydroxyurea slightly increased cell
killing by ICRF-193.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of inhibitors of cell cycle
progression on ICRF-193 cytotoxicity in yeast. JN394t2-4 cells
carrying pMJ1 were synchronized with factor as described under
"Experimental Procedures." Cells were washed free of factor,
then cell cycle inhibitors and/or ICRF-193 was added as described
below. Aliquots were removed at the indicated times, and diluted
samples were plated to SC-URA. The conditions were as follows:
open squares, no additions; closed
squares, 20 µg/ml factor; open
circles, 10 µg/ml ICRF-193; closed
circles, 10 µg/ml ICRF-193 plus 20 µg/ml factor;
open triangles, 100 mM hydroxyurea;
closed triangles, 10 µg/ml ICRF-193 plus 100 mM hydroxyurea.
|
|
Because neither factor arrest nor hydroxyurea treatment blocked
cell killing, we considered the possibility that the ICRF-193 was
incompletely washed out of the cells prior to plating. Although, this
possibility could not be rigorously excluded, we tested this possibility, by synchronizing cells with factor, treating cells with ICRF-193 plus factor for 3 h, then washing the cells
again, and resuspending the cells in medium with factor but no
ICRF-193. Cells were incubated with only factor for another 3 h, then the cells were washed and plated. This additional 3-h drug
washout did not change cell survival, compared with cells that did not have the 3-h drug-free incubation prior to plating (data not shown). Taken together, these results indicate that cells arrested in either
G1 or S phase can still be killed by ICRF-193, a result distinct from that expected for either a topoisomerase II poison or
inhibition of topoisomerase II activity
Cleavage with Human top-II and ICRF-193--
The results
described in the previous section differ from results we have
previously obtained for the effect of cell cycle inhibitors on a drug
that stabilizes a covalent complex. Furthermore, topoisomerase II
covalent complexes in cells have not been observed in cells treated
with bisdioxopiperazines (4). Nonetheless, we directly examined
covalent complex formation with ICRF-193 with purified human
topoisomerase II using a K+/SDS assay. The results,
shown in Fig. 10, indicate a slight
increase in covalent complex formation with human topoisomerase II and ICRF-193. The increase in cleavage at the highest concentration tested,
100 µg/ml, is statistically above cleavage in the absence of drug.
Induction of covalent complexes, however, is very weak compared with
canonical topoisomerase II poisons. For comparison, a doubling of the
level of covalent complex with etoposide is seen at 0.3 µM etoposide (data not shown). Comparing the drug concentration required to achieve a doubling of DNA cleavage, etoposide
is about 750 times more potent than ICRF-193. Since the concentration
required to kill yeast cells expressing human topoisomerase II is much
less than the concentration required to significantly increase covalent
complex formation, DNA cleavage stimulated by ICRF-193 is unlikely to
be responsible for the dominant cell killing of yeast cells expressing
human topoisomerase II.
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 10.
DNA cleavage induced by human topoisomerase
II in the presence of ICRF-193. DNA cleavage in the presence of
ICRF-193 was assessed by the K+/SDS method. Each sample
contained 10 units of human topoisomerase II, plus the indicated
concentration of ICRF-193. Samples were analyzed in duplicate, and the
results shown are the mean of two independent experiments.
Error bars indicate ±standard error of the mean.
Cleavage in the presence of ICRF-193 is expressed relative to cleavage
in the absence of ICRF-193.
|
|
Top2p Does Not Require the Ability to Cleave DNA to Form a Stable
Closed Clamp in the Presence of ICRF-193--
Lindsley and colleagues
have recently demonstrated that mutation of the tyrosine involved in
forming a covalent linkage with DNA is still able to form a stable
closed clamp in the presence of a non-hydrolyzable ATP analog (47).
Since mutating the homologous amino acid in human TOP2 results in a
protein that does not confer sensitivity to bisdioxopiperazines, we
were interested in determining whether these compounds can stabilize a
closed clamp formed by an active site tyrosine mutant. For these
experiments, an active site mutant of yeast TOP2 was used (47). Closed
clamp formation was monitored using analytical ultracentrifugation as
described by Hsieh and colleagues (40, 48). In this assay, Top2p is incubated in the presence of either linear or circular DNA, then subjected to centrifugation. Free DNA sediments near the bottom of the
gradient, while DNA in salt stable complexes of Top2p has lower
sedimentation rates, resulting in a series of peaks corresponding to
increasing numbers of bound Top2 molecules (40, 48). Fig. 11 shows the quantitation of DNA in a
series of ultracentrifugation runs using the Tyr782 Phe
mutant protein. Sedimentation is shown from left to
right. In the presence of circular DNA alone, the major DNA
peak occurs near the bottom of gradient (Fig. 11A). Addition
of Top2 protein alone or Top2p with ATP does not appreciably change the
sedimentation profile (data not shown). Addition of 100 µM ICRF-193, along with Top2p and 0.5 mM ATP
produces a very different profile (Fig. 11B). The free DNA
peak is substantially reduced, and a new series of peaks are observed.
The same pattern is also produced in the presence of a non-hydrolyzable
ATP analog and the absence of ICRF-193 (data not shown). By contrast,
while free linear DNA also sediments near the bottom of the gradient
(Fig. 11C), addition of Top2p, ICRF-193, and ATP does not
generate a new series of peaks (Fig. 11D). These results are
identical to those obtained by Hsieh and colleagues using wild type
Top2p (48) and indicate that ICRF-193 can stabilize a salt-stable
complex by Top2p even if the enzyme cannot cleave DNA. Similar results
were also obtained using the filter binding assay described by Roca and
Wang (13). In addition, a salt-stable complex was not observed with
circular DNA in the presence of ICRF-193 in the absence of ATP (data
not shown). Taken together, our results indicate that Top2p does not
require the ability to cleave DNA to form a salt-stable complex, but
that the ability to cleave DNA is required for bisdioxopiperazines to
induce cytotoxicity in yeast (Fig. 4A). Therefore, a closed clamp appears necessary, but not sufficient for
bisdioxopiperazine-induced cytotoxicity.
View larger version (36K):
[in this window]
[in a new window]
|
Fig. 11.
Formation of salt-stable topoisomerase
II/DNA complexes by Top2 Tyr782 Phe. Analytical
ultracentrifugation of Top2p Tyr782 Phe-containing
reactions was carried out as described under "Experimental
Procedures." The major peak at the bottom of each gradient
corresponds to DNA without any bound protein, and the lighter species
are complex of DNA with different numbers of Top2 molecules.
A, sedimentation of circular DNA alone; B,
sedimentation obtained with circular DNA in the presence of Top2
Tyr782 Phe and 100 µM ICRF-193.
C and D, same as A and B,
except the DNA was linearized by a restriction enzyme prior to
incubation with Top2p.
|
|
| |
DISCUSSION |
Previous studies have indicated that bisdioxopiperazines are
specific inhibitors of topoisomerase II (4, 41). Several lines of
evidence suggested that these compounds are catalytic inhibitors of
topoisomerase II rather than agents that stabilize topoisomerase II
covalent complexes, including a lack of dependence on the
RAD52 pathway for cell killing in yeast (41), and phenotypes in mammalian cells that are consistent with a failure to decatenate replicated chromosomes (4). In addition, it has also been shown that
bisdioxopiperazines can suppress the formation of covalent complexes by
topoisomerase II poisons such as etoposide (49). This work demonstrates
that there is an additional aspect to cell killing by
bisdioxopiperazines, i.e. the potential to act as a novel
type of topoisomerase II poison.
Wang and colleagues (13) have shown that bisdioxopiperazines trap
topoisomerase II at a unique intermediate form, where the enzyme has
formed a closed clamp. The topological state of the enzyme is the same
as when the enzyme turnover is inhibited by non-hydrolyzable ATP
analogs (11, 50, 51). Under both of these conditions, the enzyme and
covalently closed circular DNA forms a catenane, with one loop
comprising DNA and one loop comprising protein. We suggest that
topoisomerase II in this state acts as a DNA lesion, which could
inhibit DNA metabolic processes such as replication, transcription, or
chromatin assembly or disassembly.
The hypothesis that the closed clamp form of topoisomerase II can act
as a type of DNA "lesion" is based on the demonstration in this
work that bisdioxopiperazines are able to kill yeast cells even in the
presence of a bisdioxopiperazine-resistant topoisomerase II. A drug
that kills cells because of a lack of topoisomerase II should confer
recessive drug sensitivity, i.e. a drug-resistant form of
topoisomerase II should confer drug resistance regardless of whether a
drug-sensitive topoisomerase is present. This is in contrast to
topoisomerase poisons, agents that kill cells by stabilizing covalent
complexes. Previous experiments have demonstrated that complex
stabilizing drugs confer dominant drug sensitivity, i.e. a
drug-sensitive topoisomerase II confers drug sensitivity regardless of
whether a drug-resistant form of the enzyme is present (20, 43).
Interpretation of dominant drug sensitivity is complicated by the fact
that topoisomerase II is a stable dimer (52). Co-expression of a
drug-sensitive and a drug-resistant enzyme can result in heterodimers
of one sensitive and one resistant subunit. Under these circumstances,
the drug sensitivity could depend on the drug sensitivity of the
heterodimer. However, we have shown that potential heterodimers are not
relevant to the dominant drug sensitivity conferred by
bisdioxopiperazines. In experiments where active human and yeast
enzymes are expressed, we were unable to detect heterodimers with both
yeast and human monomers. In experiments where different alleles of
human top-II are expressed, we showed that the drug sensitivity of
the heterodimer is irrelevant if bisdioxopiperazines act only by
depriving cells of topoisomerase II activity. We showed that
co-expression of a bisdioxopiperazine-resistant human top-IIa along
with an active site tyrosine mutant still results in yeast cells that
are very resistant to ICRF-193. If these two subunits can freely
heterodimerize, then there will be a 50% reduction in active
topoisomerase II. Expression of both the active site tyrosine mutant
and the Tyr50 Phe mutant resulted in cells that were
completely resistant to ICRF-193. However, expression of wild type
human top-II along with the Tyr50 Phe mutant reduces
cell growth below that observed with the active site mutant. The level
of Tyr50 Phe homodimers will be the same in both
experiments. Nonetheless, only expression of wild type drug-sensitive
topoisomerase II reduced cell growth. Therefore, the wild type:wild
type homodimers and/or the wild type:Tyr50 Phe
heterodimers confer drug sensitivity, i.e. dominant drug sensitivity.
The level of drug sensitivity conferred by wild type human
topoisomerase II when the drug-resistant topoisomerase is a human enzyme is considerably less than what was observed when the
drug-resistant enzyme is yeast topoisomerase II. We suggest that this
is due to the level of drug-sensitive enzyme present in the two
circumstances. Because the two forms of the human enzyme can
heterodimerize, while the yeast and human forms cannot, expression of
drug-resistant human top-II can reduce the level of drug-sensitive
enzyme by 50%, provided that the heterodimers are fully
drug-resistant. In agreement with this hypothesis, van Hille and Hill
(53) have shown that expression of high levels of wild type human
top-II in yeast result in higher levels of bisdioxopiperazine
sensitivity than lower levels of the human enzyme.
If bisdioxopiperazines act as topoisomerase poisons, then one could
hypothesize that these drugs are complex stabilizing topoisomerase II
poisons. We detected a small increase in covalent complex formation with purified human topoisomerase II and ICRF-193. However, the potency
of covalent complex formation is inconsistent with the cytotoxicity
observed. It is probably not surprising that a small increase in
covalent complexes was observed. Trapping the closed clamp form of
topoisomerase II on DNA could result in an equilibrium between cleaved
and uncleaved complexes. Since the local concentration of topoisomerase
II bound to DNA is increased by trapping the closed clamp form of the
enzyme on DNA, it would be expected that some increase in covalent
complex was observed.
In addition to the biochemical tests, the other experiments described
above are also inconsistent with ICRF-193 acting as a complex
stabilizing topoisomerase II poison. First,
rad52 cells do not show the extreme
hypersensitivity to ICRF-193 seen with complex stabilizing drugs such
as etoposide or amsacrine (35, 36). The experiments using agents that
block cell cycle progression also demonstrated a phenotype distinct
from what has been previously observed with complex stabilizing
topoisomerase II poisons.
An alternate explanation that would be consistent with
bisdioxopiperazines acting as topoisomerase II poisons is that the formation of stable covalent complexes by human Top2p (in yeast) is
more cytotoxic than stabilized covalent complexes formed with yeast
Top2p. One way this could happen is if Top2:DNA complexes are
relatively efficient substrates for repair processes, while the human
enzyme is not efficiently recognized. We do not favor this possibility,
because we have previously shown that yeast cells expressing human
Top2p are not more sensitive to complex-stabilizing drugs such as
etoposide than cells expressing yeast Top2 (25).
How might bisdioxopiperazines kill cells? Although these drugs do not
lead to high levels of covalent complexes between topoisomerase II and
DNA, the closed clamp form of the enzyme might impede DNA metabolic
events. If topoisomerase II cannot freely slide along DNA when trapped
as a closed clamp, then it might block transcriptional elongation, DNA
replication, repair, and other DNA metabolic events. Although we do not
think that bisdioxopiperazines act as complex stabilizing topoisomerase
II poisons, our results indicate that the enzyme must be able to cleave
DNA in order to act as a poison. A possible interpretation is that the
ability of Top2p to cleave DNA impedes the ability of the closed clamp
form of the enzyme to slide along DNA. Perhaps an enzyme that cannot
cleave DNA freely slides along DNA as a washer on a string, and does
not impede other DNA metabolic events.
The ability of ICRF-193 and other bisdioxopiperazines to kill cells by
converting topoisomerase II into a "non-covalent poison" probably
depends on the level of topoisomerase II that is expressed. van Hille
and Hill (53) showed that the level of expression of hTOP2
in yeast is proportional to the degree of cell killing induced by
bisdioxopiperazines. Whether mammalian cells are strongly affected may
depend on the their level of expression of different topoisomerase II
isoforms. In this regard, it will be important to quantitate the
sensitivity of topoisomerase II 
to bisdioxopiperazines, since this
isoform is expressed in both proliferating cells and quiescent cells
(54).
Finally, the results presented here suggest that caution is needed in
the use of bisdioxopiperazines as probes of topoisomerase function in
eukaryotic cells. It is well established that topoisomerase II poisons
such as etoposide can exert effects on cells due to the generation of
covalent complexes. The effect of etoposide on specific cell processes
may not be due to a requirement for topoisomerase II in that process.
Results presented here suggest that a trapped non-covalent complex of
topoisomerase II on DNA may also produce effects on cells that are not
specifically due to a normal involvement of topoisomerase II.
Nonetheless, because bisdioxopiperazines are in clinical use as
cardioprotectants, it will be important to understand the effects of
this novel type of poisoning of topoisomerase II.
§¶,
,
TOP
ABSTRACT
INTRODUCTION
-imino)triphosphate.
