HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 30, 22969-22977, July 28, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/30/22969    most recent M002931200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Seshasayee, D. Articles by Wojchowski, D. M. Search for Related Content PubMed PubMed Citation Articles by Seshasayee, D. Articles by Wojchowski, D. M. Social Bookmarking                      What's this?

Intron 1 Elements Promote Erythroid-specific GATA-1 Gene Expression^*

Dhaya Seshasayee^§¶, Justin N. Geiger^§¶, Peter Gaines^§, and Don M. Wojchowski^§**

From the  Programs in Genetics and Departments of  Biochemistry & Molecular Biology and ^§ Veterinary Science, The Pennsylvania State University, University Park, Pennsylvania 16802

Received for publication, April 6, 2000, and in revised form, May 9, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The zinc finger protein GATA-1 functions in a concentration-dependent fashion to activate the transcription of erythroid and megakaryocytic genes. Less is understood, however, regarding factors that regulate the GATA-1 gene. Presently elements within intron 1 are shown to markedly affect its erythroid-restricted transcription. Within a full-length 6.8-kilobase GATA-1 gene construct (G6.8-Luc) the deletion of a central subdomain of intron 1 inhibited transcription 10-fold in transiently transfected erythroid SKT6 cells, and likewise inhibited high-level transcription in erythroid FDCW2ER-GATA1 cells. In parental myeloid FDCER cells, however, low-level transcription was largely unaffected by intron 1 deletions. Within intron 1, repeated GATA and Ap1 consensus elements in a central region are described which when linked directly to reporter cassettes promote transcription in erythroid SKT6 and FDCER-GATA1 cells at high rates. Moreover, GATA-1 activated transcription from this subdomain in 293 cells, and in SKT6 cells this subdomain footprinted in vivo. For stably integrated GFP reporter constructs in erythroid SKT6 cells, corroborating results were obtained. Deletion of intronic GATA and Ap1 motifs abrogated the activity of G6.8-pEGFP; activity was decreased by 43 and 56%, respectively, by the deletion of either motif; and the above 1800-base pair region of intron 1 per se was transcribed at rates uniformly greater than G6.8-pEGFP. Also described is the differential utilization of exons 1a and 1b among primary erythromegakaryocytic and myeloid cells.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

GATA factors are a family of nuclear zinc finger DNA-binding proteins that hierarchically regulate the expression of lineage-specific target genes (1-6). Structurally, these factors bind a core GATA motif (within hexameric elements) via two conserved central Cys₂/Cys₂ finger domains, but diverge more in amino- and carboxyl-terminal domains (7, 8). With regards to expression profiles, GATA-1 levels are highest in erythroid and megakaryocytic cells (9, 10), and moderate in mast cells, eosinophils, and multipotential hematopoietic progenitors (11, 12). GATA-2 expression is highest in hematopoietic stem and progenitor cells, embryonic brain, endothelial cells, fibroblasts, kidney, liver, and cardiac muscle (13); GATA-3 in T-cells and neuronal tissues (14); GATA-4 in heart and gut (15); GATA-5 in heart and lung (5); and GATA-6 in heart, smooth muscle, and gut (16). Via promoter activation and/or gene disruption experiments, each has been demonstrated to activate target genes that contribute critically to the development of the above tissues (1-6). For GATA-1, attenuated expression in chimeric mice deregulates megakaryocytic progenitor cell proliferation and impairs platelet production (17), while gene disruption blocks erythroid development at a penultimate stage (1). In addition, in viral myb-ets transformed chicken myeloblasts (18) and in murine myeloid FDCER cells (19), incrementally increased expression of GATA-1 has been shown to activate megakaryocytic and erythroid gene transcription in a developmentally stepwise fashion.

Less well defined are regulators of GATA gene expression. The GATA-1 gene is best studied and first, a 900-bp¹ proximal promoter region 5' to exon 1a has been described which in isolation directs transcription in erythroleukemic murine erythrolukemic cells (but not 3T3 fibroblasts) in part via two inverted GATA-1 elements (20, 21). Unlike a yeast artificial chromosome construct containing the GATA-1 gene locus, however, this proximal promoter failed to support the expression of a linked GATA-1 cDNA at levels sufficient to rescue the erythroid differentiation of GATA1-deficient embryonic stem cells (22). Second, extended GATA-1 gene -galactosidase reporter constructs recently have been tested in vivo, and an upsteam activating element (UAE) positioned approximately 2600 bp upstream of exon 1 was discovered to be required for efficient expression in erythroid and megakaryocytic cells (23-25). Interestingly, expression in definitive erythroid cells also was inhibited by the deletion of a downstream 3900-bp region (including intron 1 and exon 1b) (22), and within this general region an erythroid-specific hypersensitive site previously has been mapped (26). Presently, possible contributions of intron 1 subdomains to high-level erythroid-restricted GATA-1 gene transcription have been investigated further. For transiently as well as stably transfected reporter constructs, a central subdomain of intron 1 is shown to be necessary (as well as sufficient) for high-level transcription in erythroid cells, and to contain repeat consensus GATA and Ap1 elements which footprint in vivo. Also examined are rates of transcriptional initiation from exon 1a versus exon 1b in primary hematopoietic cells. These novel regulatory features of the GATA-1 gene likely exert important effects on its differential levels of expression among developmental stages, and hematopoietic lineages.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cell Lines-- SKT6 cells (27) were maintained at 37 °C, 7.5% CO₂ in Opti-MEM I medium (Life Technologies, Gaithersburg, MD), 4% fetal bovine serum (Hyclone Laboratories, Logan, UT). B6SUt.Ep cells (28) were maintained in this medium containing 5% conditioned medium from WEHI-3B cells as a source of IL3 (29). FDCW2ER cells and a derived line ectopically expressing GATA-1 (FDCW2ER-GATA1, ^maj-globin positive subline) (19) were cultured in Opti-MEM I containing 8% fetal bovine serum and Epo (25 units/ml). 293 cells and derived cell lines were maintained in Opti-MEM I, 6% fetal bovine serum.

GATA-1 Promoter Constructs-- Constructs were prepared from a 11.3-kb region of the murine GATA-1 gene (23) which includes the translational start codon of exon 2, exon 1b, exon 1a, the UAE (at 2.7 to 3.9 kb), and 2.9 kb 5' to the UAE. Constructs G4.5, ESI 3700, and ESI 1800 were prepared by exonuclease III deletion as follows. A parent construct (G6.8 within pGL2-Basic) (Promega, Madison, WI) was linearized with KpnI, blunted, and incubated at 32 °C with exonuclease III (50 units/µl). At defined intervals, products were blunted with S₁ nuclease and self-ligated. Promoter domains then were excised using NotI (engineered site at exon 2 start codon), were cloned to pGL2-BSBasic (i.e. pGL2-Basic modified to contain the polylinker region of pBS-SK+) at SmaI and NotI sites, and sized and sequenced. G2.5 was prepared by excising a 4200-bp KpnI-NheI fragment from G6.8, and blunt ending (and self-ligating) this parent plasmid. ESI 900 was prepared by PCR using G6.8 as a template and the primers 5'-CAAACTCCTATGGGAGCTGTC-3' and 5'-CTTTATGTTTTTGGCGTCTTCCA-3'. This PCR product was cloned stepwise to pCR-Script SK(+) (Stratagene, La Jolla, CA) and to pGL2-BSBasic as a KpnI-NotI fragment. G6.8 ESI 900 was prepared by replacing a 3400-bp XbaI-ClaI fragment of G6.8 with a 2450-bp SmaI-ClaI fragment from ESI 900. GFP-linked GATA-1 reporter plasmids were constructed as follow. G6.8-Luc, ESI 1800-Luc, and G6.8[GATA]₇[Ap1]₄-Luc were restricted with NotI, blunt-ended with Klenow, restricted with KpnI and ligated as a KpnI-SmaI (blunt) fragment into pEGFP1 (CLONTECH, Palo Alto, CA). G6.8[GATA]₇-EGFP and G6.8[Ap1]₄-EGFP were constructed by PCR amplification using G6.8-EGFP as template and pairs of primers (containing engineered BglII sites) that excluded either the GATA repeats or Ap1 repeats ([GATA]₇ pairs as 5'-GAGATATCCAGGAATACATAGTCTAGAAGAAATTAGTCTAG-3' and 5'-GAAGATCTTCGGAGGTCAGTGGACAAACATGGGTGT-3', 5'-GAAGATCTTCACAGACTGACTGACTGACTGACTGACTGA-3' and 5'-GATCTAGAGTCGCGGCCGCTTTACTTG-3'; [Ap1]₄ pairs as 5'-GAAGATCTTCGCAGAAGCACATAAAGATAAAATCTTTGTTTTCAAAGG-3' and 5'-GATCTAGAGTCGCGGCCGCTTTACTTG-3', 5'-GGAATACATAGTCTAGAAATACATAGTCTAG-3' and 5'-GAAGATCTTCGTCTGTCTATCTATCTATCTATCTATCTATC-3'). Products were cloned (in 3-way XbaI/BglII/NotI ligations) to pEGFP-1 and were confirmed by sequencing.

Transfections and Transcriptional Reporter Assays-- In transient transfections, exponentially growing cells were adjusted to 3 × 10⁵ c/ml in 6-well plates (3 ml per well). For SKT6-EE372 and B6SUt.Ep cells, plasmids (6.5 µg of GATA-1 reporter construct and 1.5 µg of pCMV-SEAP) (Tropix, Bedford, MA) then were diluted in Opti-MEM I medium (150 µl), incubated SuperFect reagent (60 µg) (Qiagen, Valencia, CA) for 15 min at 23 °C, and added to cells. At 48 h of culture, transfected cells were washed and lysed in reporter buffer (Promega, Madison WI). Cleared samples (10,000 × g for 10 min) were assayed for protein concentration (to account for a less than 2-fold variability in cell growth, recovery, and/or lysis), for SEAP activity (CSPD chemiluminescent substrate, Tropix, Bedford, MA), and for luciferase activity. In transfections of FDCER and FDCER-GATA1 cells, 12 µl of FuGENE-6 reagent (Roche Molecular Biochemicals) was incubated for 5 min in Opti-MEM I (100 µl), combined with plasmid DNAs (1.8 µg of GATA-1 reporter constructs plus 0.2 µg of pCMV-SEAP), and added to cells. At 24 h of culture, protein, luciferase, and SEAP were assayed. 293 cell lines (30% confluent, 100-mm dishes) were transfected using calcium phosphate, 4.5 µg of GATA-1 reporter plasmids, and 0.2 µg of pCMV-gal. At 48 h of culture, luciferase and -galactosidase activities were assayed. In stable transfections, GFP reporter constructs in pEGFP1 were linearized with XhoI and were electrotransfected into SKT6 cells using conditions described previously (27). FOG and GATA-1 were expressed stably in 293 cells from pEFNeo-FOG (30) and pREP4-GATA1 vectors. pREP4-GATA1 was prepared by cloning a 1.6-kb XbaI-NotI murine GATA-1 cDNA from pCINeo-GATA1 (319 to pREP4 (Invitrogen, Palo Alto, CA). Vectors (15 µg) plus carrier DNA (5 µg) were transfected using calcium phosphate and stably transfected sublines were selected using G418 (1 mg/ml) and/or hygromycin B (75 µg/ml). Clonal lines (293-GATA1, 293-FOG, and 293-FOG-GATA1) were isolated by limiting dilution. GATA-1 and FOG expression was assayed as described below.

Northern and Western Blotting-- RNA was isolated using TRIzol reagent (Life Technologies), and electrophoresed in formaldehyde-agarose gels, blotted to Nytran membranes (Schleicher and Schuell, Keene, NH), and fixed. ³²P-Labeled probes were prepared by random priming using DNA polymerase I (Klenow fragment), 50 µCi of [-³²P]dATP (3000 Ci/mmol), and 25 ng of the following cDNA fragments: 1.8-kb KpnI-NotI fragment of pXMGATA-1 (murine GATA-1) (9), 3.2-kb EcoRI fragment of pEFneo-FOG (murine FOG) (30), and a 0.8-kb KpnI-XhoI fragment of pSP-GAPDH (human glyceraldyhyde phosphate dehydrogenase). Hybridizations were in QuickHyb solution (Stratagene, La Jolla, CA). In Western blotting, cells were lysed in 7.5% glycerol, 2.5% SDS, 0.1 M dithiothreitol, 8.75 mM Tris, pH 6.8 (100 µl/10⁶ cells), and soluble proteins were electrophoresed and blotted to nitrocellulose. The N6 antibody to GATA-1 (Santa Cruz Biotechnology, Santa Cruz, CA) was used and detected by enhanced chemiluminescence.

In Vivo Footprinting-- Exponentially growing SKT6 cells (4 × 10⁸) were collected and resuspended in 4 ml of 7% fetal bovine serum in Opti-MEM I media. Methylation was achieved by incubation for 4 min at 20 °C with either 7 or 21 µl of (10.57 M) DMS (Sigma) per 2 ml of cells, and was terminated by washing cells twice with 0 °C phosphate-buffered saline. Genomic DNA was extracted, and methylated guanine (G) residues were hydrolyzed by incubating 20 µg of DMS-treated genomic DNA with 0.1 M piperidine for 10 min at 90 °C (31). Control genomic DNA was extracted, and exposed to DMS and piperidine. 1 µg of DNA was used as a template for ligation-mediated PCR (34). Complementary strand synthesis was with primer 1A (5'-GTCTCTCCCTCCATTTCC-3', T_m = 60 °C). Linker ligation was as described using a modified Mueller and Wold linker (32). PCR amplification of the double-stranded population was with primer 2A (5'-ACTGTGTTTCTGTGTTTTTCCTACC-3', T_m = 63 °C). A third primer (3A: 5'-CTGTGTTTCTCCTACCTTTCTGTGCTTTACC-3', T_m = 67 °C) was end-labeled using T4 polynucleotide kinase (New England Biolabs, Beverly, MA) and [-³²P]ATP (Amersham Pharmacia Biotech). The radiolabeled primer was elongated via five PCR cycles. Products were resolved in 5% gels and exposed to film. The sequencing ladder was created using Sequenase (U. S. Biochemicals, Cleveland, OH) and pCRScript-G (7)/Ap1(4) as a template.

Erythroid Splenocytes and ex Vivo Expanded Bone Marrow Cells-- Erythroid splenocytes were obtained from mice treated subcutaneously with thiamphenicol as described previously (33). Stem Span medium (Stem Cell Technologies, Vancouver, BC, Canada) (1 × 10⁶ cells/ml initial density) containing murine interleukin-3 (10 µg/ml) and -6 (10 ng/ml) and mSCF (50 ng/ml) (granulocyte/macrophage, 7-day culture); hEpo (1 unit/ml), mSCF (100 ng/ml), human insulin-like growth factor-1 (40 ng/ml), 1 µM dexamethasone, and 1 µM -estradiol (erythroid cells, 3-day culture); murine interleukin-3 (10 ng/ml) and hTpo (50 ng/ml) (megakaryocytic cells, 4-day culture).

Reverse Transcription-PCR Analyses-- cDNA was synthesized using an oligo(dT) primer and Superscript II RNase H reverse transcriptase (Life Technologies). Products derived from exon 1a versus 1b of endogenous GATA-1 gene were amplified using the following primers: 5'GAACTCGTCATACCAGTAA3' (exon 1a); 5'AAAAAGAGGAAATGGAGGAGGC3' (exon 1b); and 5'GTGGAATCTGATGGTGAGG3' (exon 2, used to amplify each product). 1 µCi of [-³²P]dATP (3000 Ci/mmol) was included in each reaction, and thermal cycles were 1 min at 92 °C, 1 min at 52 °C, 2 min at 72 °C for 32 cycles. Products were electrophoresed in 5% acrylamide gels and analyzed by autoradiography.

DNA Sequence Analyses-- Cycle sequencing reactions were performed using 3' BigDye-labeled dideoxynucleotide triphosphates and an ABI PRISM 377 DNA Sequencer (Perkin-Elmer ABI, Foster City, CA). Putative elements for transcription factor binding were defined using Sequence Interpretation Tools software.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In primary analyses of GATA-1 gene subdomains that affect erythroid-specific transcription, the deletion constructs illustrated in Fig. 1 were prepared from a parent construct, G6.8-Luc, and assayed for activity in erythroid SKT6 cells. Within G6.8-Luc, 6800 bp 5' to exon 1a are retained, including the UAE and additional upstream sequences. In G4.5-Luc and G2.5-Luc, upstream sequences of 2300 and 4300 bp are deleted, respectively. In G6.8-ESI900, upstream regions are intact but a central 900-bp subdomain of intron 1 (bounded by exons 1a and 1b and designated ESI, erythroid-specific intron) is deleted. Finally, in ESI 3700-Luc, ESI 1800-Luc, and ESI 900-Luc, subdomains of intron 1 alone are represented, and are fused to a luciferase cassette immediately upstream from a unique translational start codon in exon 2 of the GATA-1 gene (as are all luciferase and GFP reporter constructs). Activities of the above constructs in transiently transfected SKT6 cells are illustrated in Fig. 2, upper panel. For G4.5-Luc, activity reproducibly was observed to be increased 2-fold over G6.8-Luc upon the deletion of an apparently repressing 2300-bp region upstream of the UAE. Consistent with the results of in vivo studies (21, 22) deletion (from G6.8-Luc) of the UAE in construct G2.5-Luc inhibited transcription in SKT6 cells by approximately 10-fold (as compared with G4.5). More remarkably, in G6.8ESI900 the deletion of a central subdomain of intron 1 inhibited transcription as severely as the deletion of the UAE (i.e. 10-fold inhibition). In addition, when fused directly to a luciferase reporter cassette, a proximal 1800-bp region of this intron (construct ESI 1800-Luc) promoted transcription in transiently transfected SKT6 cells at rates as high as 10-fold above those observed for G6.8-Luc and G4.5. Within ESI 1800-Luc, the deletion of a distal 900-bp region (yielding the construct ESI 900) abrogated activity, further delineating strong positively acting elements within intron 1 to a central subdomain. Finally, in the construct ESI 3700 inclusion of a further 5' region of intron decreased activity in SKT6 cells, indicating the possible presence of inhibitory elements within the far upstream region of intron 1. 

View larger version (17K): [in this window] [in a new window]   Fig. 1.   GATA-1 gene luciferase reporter constructs. Diagrammed are GATA-1 gene luciferase reporter constructs including the deletion mutants G6.8, G4.5, G2.5, G6.8 ESI900, and the intron 1-derived constructs ESI-3700, ESI-1800, and ESI-900. Indexed are select restriction sites, the UAE, a primary site of transcriptional initiation at exon 1a (Tx+1) and the site of fusion (within exon 2) of each test construct to a luciferase cassette (Luc).

View larger version (30K): [in this window] [in a new window]   Fig. 2.   Deletion of an intron 1 central subdomain inhibits high level, erythroid-specific GATA-1 gene transcription. Erythroid SKT6 cells, erythroid FDCER-GATA-1 cells, and myeloid FDCER cells were transfected in triplicate with the GATA-1 gene luciferase reporter deletion constructs G6.8, G4.5, G2.5, G6.8ESI900 (left panels), or with the intron 1-derived constructs ESI-3700, -1800, -900 (right panels). Through co-transfection, pSEAP was used to account for limited variability in transfections. Graphed for each construct are transcriptional activities (luciferase units) as mean values ± S.D. Results shown are representative of three independent experiments (note the differences in ordinate scales for deletion versus intron-derived constructs).

To determine the extent to which the above delineated GATA-1 gene subdomains might regulate transcription selectively in erythroid cells, reporter constructs also were assayed in a uniquely advantageous pair of cell lines, i.e. FDCW2ER and FDCW2ER-GATA-1 cells. FDCW2ER cells are a well characterized myeloid progenitor cell line in which no expression of GATA-1, EKLF, Epo receptor, or globin gene transcripts is detectable, while FDCW2ER-GATA-1 cells are a derived subline in which the stable expression of exogenous GATA-1 activates endogenous erythroid gene expression, including GATA-1, EKLF, and ^maj globin (19). In erythroid FDCW2ER-GATA-1 cells, those GATA-1 gene constructs which possessed high transcriptional activities in erythroid SKT6 cells (i.e. G6.8-, G4.5-, and ESI 1800-Luc) likewise were transcribed at high rates (Fig. 2, center panels). In myeloid FDCW2ER cells, however, transcription of these constructs was uniformly low (Fig. 2, lower panels) while activities of constructs G2.5 and ESI 900 were elevated. These results reinforced the above findings in SKT6 cells, and indicate that a central 900-bp domain of intron 1 contains elements that strongly promote erythroid-restricted GATA-1 gene transcription. In addition, the elevated activities of constructs G2.5 and ESI 900 in myeloid FDCERW2ER cells at least suggest that domains 4500 to 2500 and +1800 to +900, while activating in red cells, might also repress transcription in other lineages. Activities of the above GATA-1 promoter constructs also were assayed in erythroid B6SUt.Ep cells (28), and activity profiles were observed to sharply parallel those observed in SKT6 and FDCW2ER-GATA-1 cells.²

Based on the above characterized role for a central subdomain of intron 1 in erythroid-specific transcriptional activity, this region of the murine GATA-1 gene next was sequenced (Fig. 3). Sequencing revealed first the occurrence of several GATA elements as well as a CACC element within a proximal 900-bp region. In addition, positioned in an immediately upstream region were clusters of seven contiguous consensus GATA elements (bold and underlined) and four adjacent Ap1 elements (italicized and underlined). The functional significance of these latter repeated elements next was tested in three ways. The ability of GATA-1, FOG, or GATA-1 plus FOG to activate the above described transcriptional reporter constructs in 293 fibroblasts was assessed; repeat domains were assessed for trans-factor occupancy in erythroid SKT6 cells by in vivo footprinting; and relative rates of transcription from promoters positioned upstream of exon 1a versus 1b were assayed.

View larger version (44K): [in this window] [in a new window]   Fig. 3.   Repeated GATA and consensus Ap1 elements within intron 1 of the GATA-1 gene. Illustrated is the sequence of a central to proximal region of intron 1. Indexed within the proximal (promoter) are 4 consensus GATA motifs ((A/T)GATA(A/G)) and a CACCC box. More centrally located and indexed are clustered GATA boxes (including 7 consensus elements) and Ap1 boxes (including 4 adjacent contiguous consensus elements).

For investigations in 293 fibroblasts, GATA-1 and/or FOG were expressed stably and in the derived cell lines 293-GATA-1, 293-FOG-GATA-1, and 293-FOG, transcription from select transiently transfected GATA-1 reporter constructs was assayed (Fig. 4A). In 293-GATA-1 cells, GATA-1 per se had little effect on the activities of either G6.8 or G6.8-ESI900 constructs (the latter of which is designated G6.8 [GATA]₇[Ap]₄ based on sequencing). For the intron 1 construct ESI 1800-Luc, however, rates of transcription due to GATA-1 expression were increased by approximately 6-fold (see Fig. 4A, second panel and lower summary panel). Also, in ESI 900-Luc this effect was limited (to approximately a 2-fold induction) due to the deletion of this intron 1 central subdomain. In 293-GATA-1-FOG cells, the co-expression of FOG with GATA-1 did not significantly affect the transcription of the intron 1 constructs ESI 3700, 1800, or 900, but did reproducibly increase transcription from the GATA-1 gene constructs G6.8-Luc and G4.5-Luc approximately 2-fold (in 293-FOG cells, FOG alone did not exert this effect). As a further positive control, 293 sublines also were transiently transfected with a reporter that contains a 545-bp promoter region of the murine IIb gene. As shown in Fig. 4A (right panels) GATA-1, as well as GATA-1 plus FOG, efficiently activated this megakaryocytic promoter. Thus, the central subdomain of intron 1 which contains repeated GATA and Ap1 elements maps as a functional target for GATA-1-dependent transcriptional activation (see Fig. 4, lower summary panel). In Fig. 4, B and C, levels of GATA-1 and FOG expression in stably transfected 293 cells are illustrated. To further assess the functional importance of cis-elements within intron 1, in vivo footprinting of a region bounding GATA and Ap1 repeats also was performed in SKT6 cells. As shown in Fig. 5, footprinting against DMS-dependent hydrolysis was observed for a region extending from nine (of 14) GATA repeats through eight GACA repeats, and extended 3' through at least four flanking nucleotides (GCAG). This was observed at two concentrations of DMS (left panel) and in independently repeated experiments. Dideoxy dGTP and dATP sequence reaction products from a cloned intron 1 fragment (primed with an internal oligo used in genomic footprinting reactions) were used to index the register of footprinted products. These data indicate stable occupancy of this intron 1 subdomain in erythroid cells.

View larger version (36K): [in this window] [in a new window]   Fig. 4.   Transcriptional activation of intron 1-derived constructs by GATA-1 in stably transfected 293 cells. Panel A, to test the ability of GATA-1 (and/or FOG) to activate transcription from intron 1 subdomains, select G6.8, and ESI luciferase reporter constructs were assayed for activity in 293 fibroblasts transfected stably with these factors. In 293-GATA-1 cells, transcription from the intron 1 construct ESI-1800 was stimulated 5-fold due to GATA-1 alone (see panel 293-G1, and lower summary panel) and this was inhibited by deletion of GATA and Ap1 repeat elements (in the truncated construct ESI-900). By comparison, transcription of the full-length construct G6.8 was stimulated by GATA-1 only 2-fold, and only in the presence of FOG (i.e. in 293-G1-FOG cells). As a positive control, a murine IIb promoter-reporter construct also was assayed in parallel, and was activated approximately 2.5-fold by GATA-1, and 8-fold by GATA-1 plus FOG (right most panels). In the lower subpanel GATA-1-induced increases in the transcription of the above constructs are summarized. Panels B and C, shown are levels of GATA-1 protein (B) and FOG transcript (C) expression in the stably transfected 293 cell lines used in the above analyses.

View larger version (58K): [in this window] [in a new window]   Fig. 5.   In vivo footprinting in SKT6 cells of an intron 1 subdomain that spans repeated GATA and AP1 elements. Left panel, in SKT6 cells, the region of intron 1 containing repeated GATA and Ap1 elements proved to be footprinted in vivo. Shown are footprints derived from the exposure of SKT6 cells to DMS at 37 µM (DMS1) and 110 µM (DMS2) together with the DMS product for purified genomic DNA. Right panel, co-analyzed is a sequencing ladder illustrating the pattern of the GATA repeat region.

Initially in SKT6 cells and erythroid splenocytes, relative rates of transcription from initiation sites within exon 1a versus exon 1b within the endogenous GATA-1 gene were next assayed. Assays were by ³²P-reverse transcriptase-PCR using primers specific for exon 1a versus 1b (for schematics of exons within the GATA-1, and -2, and -5 genes, see Fig. 6, lower panel). In both SKT6 cells and erythroid splenocytes, transcription was primarily from exon 1a yet also initiated at appreciable rates from exon 1b (Fig. 6, upper panels). Next, exon 1a and 1b-derived transcripts were assayed in marrow cells expanded ex vivo under culture conditions selective for the propagation of CFUe, CFU-Meg, or granulocytes/monocytes (Fig. 6, center panel). In marrow-derived erythroid and megakaryocytic cells, relative frequencies of exon 1a versus 1b-derived transcripts were highly similar to those observed in SKT6 cells and erythroid splenocytes. In primary granulocyte/monocytic cells, however, transcripts from exon 1b somewhat unexpectedly were detected at levels comparable to those in erythroid and megakaryocytic cells (while no exon 1a-derived transcripts were detected). Sequencing confirmed the identity of this PCR product. Thus, transcription from initiation sites in exon 1a occurs at high levels in cells that develop within erythroid or megakaryocytic lineages. In addition, initiation from this exon may be selectively repressed in alternate hematopoietic progenitor cells while initiation from exon 1b does not appear to be subject to this differential regulation.

View larger version (34K): [in this window] [in a new window]   Fig. 6.   Relative utilization of transcriptional start sites in exon 1a and 1b of the GATA-1 gene in erythroid SKT6 cells, and in primary progenitor cells expanded from marrow. RNA was isolated from SKT6 cells (left upper panel), from developmentally staged erythroid splenocytes (right upper panel), and from erythroid (CFU-e), megakaryocytic (CFU-meg) or granulocytic/monocytic (GM) marrow cells expanded from marrow in vitro (center panel). RNA was reversed transcribed, and products whose transcription initiated at exon 1a (220-bp PCR product) versus exon 1b (490-bp PCR product) were assayed by PCR using 5' primers specific to each exon. Diagrammed in the lower panel are the related exon structures of GATA-1, -2, and -5 genes. For G4.5-Luc, activity reproducibly was observed to be increased 2-fold over G6.8-Luc upon the deletion of an apparently repressing 2300-bp region upstream of the UAE.

Finally, the potential concern that activities of transiently transfected reporter constructs may not necessarily reflect their capacities to promote transcription from chromosomally integrated sites was addressed. Specifically, to further test roles for intron 1 features in regulating transcription, five related GATA-1 gene constructs were linked (at exon 2) to a GFP cassette and were electrotransfected into SKT6 cells. Stably transfected constructs included G6.8-EGFP, G6.8[GATA]₇[Ap1]₄-EGFP (deletion of intron 1 GATA and Ap1 repeats), G6.8 [GATA]₇-EGFP (deletion of repeated consensus GATA elements), G6.8 [Ap1]₄-EGFP (deletion of repeated consensus Ap1 elements), and ESI-1800-EGFP (proximal 1800 bp of intron 1 linked directly to a GFP cassette) (Fig. 7). As shown for two representative clones (paired left and right panels, Fig. 8A) (and as was observed above in transient transfections), the deletion of both GATA and Ap1 elements in G6.8[GATA]₇[Ap1]₄EGFP inhibited transcription from stable integrated constructs to low levels (i.e. levels approximating those of the negative control promoter-less construct EGFP1). By comparison, the deletion of only GATA repeats (in G6.8[GATA]₇-EGFP) or Ap1 repeats (in G6.8[Ap1]₄-EGFP) inhibited transcription among clones studied to 43 and 56% of G6.8-EGFP levels, respectively. Finally, expression from construct ESI-1800-EGPF uniformly was somewhat greater than G6·8-EGFP, despite the absence of all upstream components (including the UAE). Results for stably integrated (and single-copy) constructs are summarized in Fig. 8B (and are illustrated as median EGFP fluorescence among representative clones). These results provide further evidence that the above described elements within intron 1 exert important effects on GATA-1 gene transcription.

View larger version (20K): [in this window] [in a new window]   Fig. 7.   GATA-1 gene GFP reporter constructs. Diagrammed are the enhanced green fluorescent protein (E-GFP) reporter constructs G6.8 and ESI-1800 (as shown in Fig. 1) together with G6.8[GATA]7, G6.8[Ap1]4, and G6.8[GATA]7[Ap1]4 (in which subdomains containing repeated GATA and/or Ap1 elements are deleted). For each construct, linkage to a GFP cassette (in pEGFP1) is at exon 2 of the GATA-1 gene.

View larger version (22K): [in this window] [in a new window]   Fig. 8.   Activities of stably transfected GATA-1 gene GFP reporter constructs in erythroid SKT6 cells. Panel A, shown are flow cytometric GFP fluorescent profiles for two representative clonal SKT6 cell sublines (left and right columns) transfected stably with the following GATA-1-pEGFP1 plasmids: G6.8, G6.8[GATA]7[Ap1]4, G6.8[GATA]4, G6.8[Ap1]4, and ESI 1800. For comparison, representative profiles of SKT6-G6.8-pEGFP1 cells also are shown in each subpanel. As a negative control, SKT6 cells also were transfected stably with an empty pEGFP1 plasmid (top panels). Panel B, graphed are median fluorescence intensities (± S.D.) for n = 4 representative clones transfected with each of the above GATA-1-pEGFP1 constructs.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

While investigations in several model systems have established GATA-1 as a hierarchical regulator of erythroid, megakaryocytic, and eosinophilic gene expression (1-19), factors that control GATA-1 expression in these (and in other lineages at lower levels) are only partially defined. With respect to the GATA-1 gene, previous studies have demonstrated: 1) that a 900-bp promoter which occurs 5' to exon 1a contains two key GATA elements, and efficiently supports transcription in transiently transfected murine erythrolukemic cells (but not in 3T3 fibroblasts) (20, 21); 2) that erythroid-specific transcription of reporter constructs in mice also depends upon an activation domain positioned 2600 bp upstream from exon 1a (including a key GATA box within a 149-bp core of this UAE) (23-25); and 3) that the deletion of an extended region spanning intron 1 and exon 1b also inhibited transcription in mice of -galactosidase reporter constructs containing intact UAE and exon 1a promoter domains (23-25). This latter observation, together with preliminary characterizations of a hypersensitive site within intron 1 (26) and S₁ nuclease mapping of transcription from exon 1b (20), prompted the present investigations of intron 1 substructure, its role in directing high-level erythroid-specific transcription, and its apparent effects on transcription from initiation sites in exon 1a and 1b.

Structure-function features of intron 1 that merit attention are first, a 900-bp region immediately 5' to exon 1b which alone supported low-level transcription in erythroid cells, yet somewhat higher level transcription in myeloid FDCER cells (see Figs. 1-3). Based on the occurrence in this functional ESI-900 promoter of several consensus GATA elements as well as a CACC box (which likewise occur in the previously described promoter 5' to exon 1a) (20, 21), it was anticipated that its activity in erythroid cells might be higher. Erythroid activity, however, proved to require linkage to the central region of intron 1. This GATA and Ap1 repeat-containing region (in ESI-1800-Luc and -EGFP constructs) interestingly also strongly repressed transcription in myeloid FDCER cells. These findings at least suggest roles for this central region in recruiting not only erythroid activators, but possibly repressors in non-erythroid cells. Finally, the 1900-bp distal region of intron 1 (as linked to ESI-1800 in ESI-3700-Luc) repressed transcription specifically in erythroid SKT6 and FDCER-GATA1 cells. Inspection of this distal region, however, revealed essentially no consensus elements for transfactor binding. In contrast is the striking occurrence of the above central repeat GATA and Ap1, and data also indicate that this region is transactivated by GATA-1 in 293 cells and occupied in erythroid SKT6 cells in vivo. Specific activities exerted by subsets of repeat elements merit further study, but by analogy it is interesting to consider that essential clustered GATA elements also recently have been described within the divergently transcribed niiA and niaD genes of Aspergillus (34). In this system, disruption of these elements (or of the GATA gene, Area) blocks chromatin remodeling at these sites, and severely inhibits niiA and niaD transcription. In addition, within the short arm of chromosome Y, GATA repeats within a p17 subregion of an M34 repeat (including 12 contiguous elements in as many as 300 repeated M34 domains) also have been speculated to regulate testes-specific decondensation (35).

As investigated within the context of full-length and maximally active reporter constructs (and as analyzed in both transient and stable transfections), an important role for the central subregion of intron 1 in directing erythroid-specific GATA-1 gene expression is also presently described. Here dramatic losses in activity due to the deletion of both GATA and Ap1 elements simply but importantly reveal requirements for this intronic region in erythroid transcription. Mechanistically, this might involve effects on transcription initiated at exon 1b, 1a, or both. The deletion of this intron region inhibited overall luciferase and GFP expression from exon 2 10-fold, while levels of transcripts derived from exon 1b in erythroid cells accounted for only 10% (or less) of total levels. It therefore is concluded that transcription from both exon 1a and b depends upon the intactness of intron 1. Such effects of intron elements on transcription are not common, yet have been well documented in other systems. Examples include a tissue-specific reduction in mRNA stability upon the deletion of intron 1 of the ₁-collagen gene (36), attenuated nuclear export of mitogen-regulated proliferin transcripts (37), and roles for intron 1-3 of the mouse thymidine kinase gene in markedly modulating transcript initiation (38). In the narrowed context of erythroid genes, several examples also exist wherein introns can regulate lineage-specific transcription. In the Epo receptor gene, an erythroid-specific DNase I hypersensitive site has been mapped to intron 1, and this intron was shown to enhance transcription 4-fold and to contain two key GATA-1-binding sites (39). In the human adult - and -globin genes, important roles for introns in transcriptional regulation also have been described. In the adult -globin gene, two DNase I-hypersensitive sites have been mapped within intron II ( IVS2) that contain four GATA-1 binding sites (40) and integrity of  IVS2 has been shown to be important for transcription (possibly via interactions with elements in the locus control region) (41). Finally, in the human -globin gene cluster, a key upstream hypersensitive site, HS-40, interestingly lies within an intron of an anonymous but widely expressed gene (42) and integrity of this site likewise is essential for high-level -globin gene expression in erythroid cells (43). Within the presently studied GATA-1 gene, whether integrity of intron 1 supports transcript stability, transport, and/or initiation is under active investigation (as is the possible lineage specificity of this effect).

A final interesting feature of GATA-1 gene transcription is the observed utilization of exon 1b (but not 1a) in primary granulocytic/monocytic cells (see Fig. 6). In these granulocytes/monocytes cells, levels of exon 1b-derived transcripts were shown to approximate those in primary erythroid and megakaryocytic cells, while little to no exon 1a-derived transcripts were detected. This observation at least suggests that exon 1b might be selectively utilized in non-erythromegakaryocytic cells to provide for low-level GATA-1 expression. By comparison, in at least two related GATA genes, GATA-2 and -5, differential expression from similarly distributed exons recently has been reported. In the murine GATA-2 gene Minegishi et al. (13) have demonstrated the occurrence of two functional promoters upstream from exons 1S and 1G which are positioned in close parallel to exons 1a and 1b of the murine GATA-1 gene (see Fig. 6). Transcription from exon 1S was observed only in Sca-1⁺/c-Kit⁺ hematopoietic progenitor cells, and repeat elements for GATA binding were discovered in the promoter flanking this exon. In the chicken GATA-5 gene, transcription also is initiated from two distinct exons, and in embryonic heart, transcripts initiate from both exons while in adult heart initiation is only from 1b (44). Thus, whether transcription of the GATA-1 gene from exons 1a versus 1b might also be regulated differentially during erythroid development likely merits further investigation.

	ACKNOWLEDGEMENTS

We thank Dr. Stuart Orkin for the generous provision of the murine full-length GATA-1 promoter. We also thank Amy Wrentmore for generating 293-derived cell lines, and Amgen (Drs. Steve Elliott and Robert Pacifici) for the provision of recombinant human Epo.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant R01 HL44491 (to D. M. W.) and a Sigma Xi grant-in-aid (to D. S.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence of intron 1 subdomains reported in this submitted to GenBank^TM/EBI Data Bank under accession number X57530.

^¶ Contributed equally to the results in this report.

^** To whom correspondence should be addressed: 115 William L. Henning Bldg., The Pennsylvania State University, University Park, PA 16802. Tel.: 814-865-0657; Fax: 814-863-6140; E-mail: dmw1@psu.edu.

Published, JBC Papers in Press, May 12, 2000, DOI 10.1074/jbc.M002931200

² D. Seshasayee, unpublished data.

	ABBREVIATIONS

The abbreviations used are: bp, base pair(s); embryonic stem, UAE, upstream activating element; SEAP, secreated alkaline phosphatase; EGFP, enhanced green fluorescent protein; FOG, friend of GATA-1; DMS, dimethyl sulfate; Epo, erythropoietin; SCF, stem cell factor; Tpo, thrombopoetin; ESI, erythroid-specific intron; EKLF, erythroid Krüppel-like factor; CFU, colony forming unit; kb, kilobase(s); PCR, polymerase chain reaction.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				K. D. Dyer, M. Czapiga, B. Foster, P. S. Foster, E. M. Kang, C. M. Lappas, J. M. Moser, N. Naumann, C. M. Percopo, S. J. Siegel, et al. Eosinophils from Lineage-Ablated {Delta}dblGATA Bone Marrow Progenitors: The dblGATA Enhancer in the Promoter of GATA-1 Is Not Essential for Differentiation Ex Vivo J. Immunol., August 1, 2007; 179(3): 1693 - 1699. [Abstract] [Full Text] [PDF]

				M. Kobayashi and M. Yamamoto Regulation of GATA1 Gene Expression J. Biochem., July 1, 2007; 142(1): 1 - 10. [Abstract] [Full Text] [PDF]

				F. Bose, C. Fugazza, M. Casalgrandi, A. Capelli, J. M. Cunningham, Q. Zhao, S. M. Jane, S. Ottolenghi, and A. Ronchi Functional Interaction of CP2 with GATA-1 in the Regulation of Erythroid Promoters Mol. Cell. Biol., May 15, 2006; 26(10): 3942 - 3954. [Abstract] [Full Text] [PDF]

				H. Hisatsune, K. Matsumura, M. Ogawa, A. Uemura, N. Kondo, J. K. Yamashita, H. Katsuta, S. Nishikawa, T. Chiba, and S.-I. Nishikawa High level of endothelial cell-specific gene expression by a combination of the 5' flanking region and the 5' half of the first intron of the VE-cadherin gene Blood, June 15, 2005; 105(12): 4657 - 4663. [Abstract] [Full Text] [PDF]

				E. Y. Wong, J. Lin, B. G. Forget, D. M. Bodine, and P. G. Gallagher Sequences Downstream of the Erythroid Promoter Are Required for High Level Expression of the Human {alpha}-Spectrin Gene J. Biol. Chem., December 31, 2004; 279(53): 55024 - 55033. [Abstract] [Full Text] [PDF]

				K. Nishikawa, M. Kobayashi, A. Masumi, S. E. Lyons, B. M. Weinstein, P. P. Liu, and M. Yamamoto Self-Association of Gata1 Enhances Transcriptional Activity In Vivo in Zebra Fish Embryos Mol. Cell. Biol., November 15, 2003; 23(22): 8295 - 8305. [Abstract] [Full Text] [PDF]

				C. P. Miller, D. W. Heilman, and D. M. Wojchowski Erythropoietin receptor-dependent erythroid colony-forming unit development: capacities of Y343 and phosphotyrosine-null receptor forms Blood, February 1, 2002; 99(3): 898 - 904. [Abstract] [Full Text] [PDF]

				R. K. Rowntree, G. Vassaux, T. L. McDowell, S. Howe, A. McGuigan, M. Phylactides, C. Huxley, and A. Harris An element in intron 1 of the CFTR gene augments intestinal expression in vivo Hum. Mol. Genet., July 1, 2001; 10(14): 1455 - 1464. [Abstract] [Full Text] [PDF]

				M. Kobayashi, K. Nishikawa, and M. Yamamoto Hematopoietic regulatory domain of gata1 gene is positively regulated by GATA1 protein in zebrafish embryos Development, June 15, 2001; 128(12): 2341 - 2350. [Abstract] [Full Text] [PDF]

P. Gaines, J. N. Geiger, G. Knudsen, D. Seshasayee, and D. M. Wojchowski GATA-1- and FOG-dependent Activation of Megakaryocytic alpha IIB Gene Expression J. Biol. Chem., October 27, 2000; 275(44): 34114 - 34121.