HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 30, 23247-23252, July 28, 2000

This Article Abstract Full Text (PDF) An addition or correction has been published All Versions of this Article: 275/30/23247    most recent M002548200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Li, Y. Articles by Linn, S. Search for Related Content PubMed PubMed Citation Articles by Li, Y. Articles by Linn, S. Social Bookmarking                      What's this?

Identification and Cloning of Two Histone Fold Motif-containing Subunits of HeLa DNA Polymerase ^*

Ying Li, Zachary F. Pursell^§, and Stuart Linn^§¶

From the  Department of Molecular Oncology, Genentech, Inc., South San Francisco, California 94080 and the ^§ Division of Biochemistry and Molecular Biology, University of California, Berkeley, California 94720-3206

Received for publication, March 26, 2000, and in revised form, May 1, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

HeLa DNA polymerase  (pol ), possibly involved in both DNA replication and DNA repair, was previously isolated as a complex of a 261-kDa catalytic subunit and a tightly bound 59-kDa accessory protein. Saccharomyces cerevisiae pol , however, consists of four subunits: a 256-kDa catalytic subunit with 39% identity to HeLa pol  p261, a 80-kDa subunit (DPB2) with 26% identity to HeLa pol  p59, a 23-kDa subunit (DPB3), and a 22-kDa subunit (DPB4). We report here the identification and the cloning of two additional subunits of HeLa pol , p17, and p12. Both proteins contain histone fold motifs which are present also in S. cerevisiae DPB4 and DPB3. The histone fold motifs of p17 and DPB4 are related to that of subunit A of the CCAAT binding factor, whereas the histone fold motifs found in p12 and DPB3 are homologous to that in subunit C of CCAAT binding factor. p17 together with p12, but not p17 or p12 alone, interact with both p261 and p59 subunits of HeLa pol . The genes for p17 and p12 can be assigned to chromosome locations 9q33 and 2p12, respectively.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

DNA polymerase  is one of eight mammalian DNA template-directed DNA polymerases whose activities have been reported. Similar to pol ,¹ pol  possesses an intrinsic proofreading exonuclease activity, has high processivity, lacks primase activity, and prefers poly(dA)-oligo(dT) as a template-primer (1). Unlike pol , however, pol  is highly processive even in the absence of proliferating cell nuclear antigen (2, 3). pol  has been isolated from HeLa cells (2), the budding yeast Saccharomyces cerevisiae (pol II) (4), the fission yeast Schizosaccharomyces pombe,² Drosophila melanogaster (5), and the silk gland of Bombyx mori (6).

Most of our understanding about the function of pol  comes from genetic studies in S. cerevisiae. S. cerevisiae pol  is an essential replicative polymerase, because pol 2 mutants arrest at the early stage of S phase with the dumbbell phenotype, which is characteristic of DNA synthesis mutants (4). S. cerevisiae pol  is also a repair polymerase because it catalyzes UV-induced repair DNA synthesis in vivo (7, 8), and extracts from pol 2 mutants failed to support normal levels of NER and BER reactions in vitro (9). In addition, yeast pol  has been proposed to exert an S phase checkpoint function by sensing DNA replication blocks and DNA damage (10).

In contrast to the success in S. cerevisiae, progress in understanding the function of mammalian pol  has been problematic because of the deficiency of amenable genetics and the lack of a suitable cell-free reconstituted DNA replication or DNA repair system that can faithfully mimic the in vivo situation. HeLa pol  was initially purified as a soluble factor that restored repair synthesis to cytosol-depleted, UV-irradiated permeabilized human fibroblasts (11). By reconstituting the nucleotide excision repair (NER) process from purified proteins, Shivji et al. (12) further showed that mammalian pol  was the most efficient enzyme in performing gap-filling DNA synthesis during NER. However, Zeng et al. (13) reached a different conclusion by studying NER reactions catalyzed by cell-free extracts. They found that the monoclonal antibody against pol , which did not cross-react with pol , markedly inhibited the repair of UV-irradiated plasmid DNA up to 85%. Their findings strongly indicated that pol  instead of pol , was the major, if not the only, polymerase involved in NER. Of course, the discrepancy of these results may be due to the difference in various in vitro assay conditions.

A complex scenario also occurs in studying the role of mammalian pol  in DNA replication. HeLa pol  has been implicated in DNA replication in vivo because it is associated with actively replicating cellular DNA (14). Furthermore, mitogenic stimulation enhanced the UV cross-linking of pol  to nascent DNA along with that of the replicative polymerases pol  and pol  (14). However, pol  has no essential function in the in vitro replication assay using SV-40 DNA as template; moreover, it cannot replace pol  in the reaction (15-17).

Does HeLa pol  have similar functions to those of S. cerevisiae pol ? In fact, the previously known subunit structures of the two enzymes were different. S. cerevisiae pol  is isolated as a catalytic subunit of 256 kDa and three accessory proteins of molecular weights 79,461 (DPB2), 23,005 (DPB3), and 21,998 (DPB4) (18). HeLa pol  has a catalytic subunit of 261 kDa with 39% peptide sequence identity to the yeast catalytic subunit (19), but only a 59-kDa accessory protein with 26% peptide sequence identity to the yeast DPB2 subunit has been reported to date (20, 21). In this paper, we report the cDNA cloning of two proteins of 17 and 12 kDa that interact with HeLa pol . Both p17 and p12 contain histone fold motifs similar to those found in the S. cerevisiae pol  subunits DPB4 and DPB3, respectively.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Hydroxyurea and dimethylpimelimidate were from Sigma. pBluescriptKS(+/) and a HeLa Uni-ZAP^TM XR cDNA library in  phage were from Stratagene. pcDNA3.1 and pcDNA3.1/V5- His-TOPO were from Invitrogen, and pCMV-Tag2 was from Stratagene. Escherichia coli XL1-Blue (recA1endA1gyrA96thi-1hsdR17supE44 relA1lac[F' proAB lacIqZ M15 Tn10 (Tet^r)]^c was used for plasmid maintenance and propagation.

Monoclonal antibodies against HeLa pol  p59 and p261 from the hybridoma cell lines generated and characterized by Drs. G. Chui and P. H. Hwang (22, 23) were purified using protein A-Sepharose or protein G-Sepharose (Amersham Pharmacia Biotech). The immunoprecipitating IgG, 3B4.12.9 directed against p59, was used for affinity purification; IgG 3A5.6 and IgG 3C5.1 directed against p59 and p261, respectively, were used for immunoblotting. Anti-V5 antibody was from Invitrogen and anti-FLAG M2 antibody was from Sigma.

Isolation of HeLa pol  by Immunoprecipitation after Treatment with Hydroxyurea-- After a challenge with 2 mM hydroxyurea at 37 °C for 10 h, 40 liters of HeLa cells at a density of 5 × 10⁵/ml were harvested and washed with cold phosphate-buffered saline. Soluble extracts were prepared as described by Syväoja et al. (1). The extract was fractionated by 30-50% ammonium sulfate precipitation and then dialyzed overnight in antibody binding buffer (50 mM Tris-HCl, pH 8.0, 0.1% Triton X-100, 50 mM NaCl, 10% glycerol). The dialyzed extract was mixed with 3 ml of protein G-Sepharose beads (Amersham Pharmacia Biotech) for 2 h to eliminate proteins that bind nonspecifically to protein G. The supernatant obtained after centrifugation at 1500 × g for 5 min was mixed with 5 mg of IgG 3B4.12.9, covalently cross-linked to 2.5 ml of protein G-Sepharose beads with dimethylpimelimidate (34). Immunoabsorption was carried out for 4 h at 4 °C, after which the beads were washed successively with 30 ml of antibody binding buffer, 30 ml of 50 mM Tris-HCl (pH 8.0), 0.5% Triton X-100, 300 mM NaCl, 10% glycerol, and 10 ml of 10 mM potassium phosphate (pH 8.0), 10% glycerol. Bound proteins were then eluted with 100 mM potassium phosphate (pH 13.0) and 10% glycerol, and the eluted fraction was immediately neutralized with 1 M phosphoric acid, dialyzed versus 1 mM Tris-HCl (pH 8.0), 0.01% SDS, and dried in a speed vac.

Protein Microsequencing-- The immnopurified proteins were resuspended in Laemmli gel loading buffer (24) and subjected to 6-20% SDS-PAGE. After electrophoresis, the gel was stained with Coomassie Blue followed by destaining in water. The protein bands of interest were removed and sent to the Protein Structure Laboratory at the University of California at Davis for in-gel Lys-C (Wako Biochemicals) digestion, high pressure liquid chromatography separation of the resultant peptides, and Edman degradation for peptide sequencing.

Isolation of a cDNA Clone of p17-- Human expressed sequence tags (EST) were searched for sequences encoding the two peptides from p17 (TLNXSDVLSAMEEME and FVTPLK) by using the NCBI, National Institutes of Health BLAST server and the TBLASTN program (25). Seven human ESTs were identified and aligned with the SeqMan program (DNASTAR Co.), and a continuous sequence was assembled from the alignment. When sequence variants occurred, the majority sequence was taken as the correct one. The assembled continuous DNA sequence was used to design two primers: sense 1, GAGGACCTAAACCTGCCCAAT (nucleotides 81-101), and antisense 1, CTTTCAATGGGGTAACGAACC (nucleotides 304-324). A HeLa Uni-ZAP XR cDNA library (Stratagene) was then screened for a clone containing these two primers by a PCR-based method described by Israel (26). Briefly, 10⁵ clones of the library were divided into 64 wells of a 96-well microtiter plate (Corning). Each well contained about 1500 clones that were then propagated in E. coli XL1-Blue for 6 h. Amplified phage from each of 8 wells across columns, and each of 8 wells down rows, were pooled. The pooled phage were screened for the presence of the p17 cDNA by PCR using primers sense 1 and antisense 1. The clones from a single positive well were divided into 64 wells and screened again by PCR. The screening process was repeated several times until an individual positive clone was obtained.

Isolation of a cDNA Clone of p12-- Eleven human ESTs were identified to have significant homology to the S. cerevisiae pol  DPB3 peptide sequences by using the NCBI BLAST server and the TBLASTN program (25). A continuous sequence was assembled from these ESTs and was used to design two primers: sense1, ACGCCCGAGAGGAGGAGGTAC (nucleotides 53-74), and antisense1, GATGAGATCTCTGCTTATCCCG (nucleotides 506-527). A HeLa Uni-ZAP XR cDNA library (Stratagene) was then screened for a clone containing those two primers by a PCR-based method described by Israel (26).

DNA Sequencing-- For sequencing, plasmid DNAs were purified using the QIAprep Spin plasmid miniprep kit (Qiagen), and PCR products were purified using the UltraClean^TM 15 kit (Mo Bio Labs, Inc.). DNA sequencing was carried out by the University of California at Berkeley Sequencing facility using an automated ABI373 DNA Analysis System (Applied Biosystems Inc.). Both strands of the cDNAs of p17 and p12 were sequenced. The sequences obtained from different reactions were aligned by using the SeqMan program (DNASTAR Inc.). Continuous sequences were assembled from the observed overlaps.

In Vitro Transcription and Translation of the p17 or the p12 cDNA-- The open reading frame of the p17 cDNA or the p12 cDNA with its Kozak sequence was cloned into the pBluescript KS(+/) vector (Stratagene) with the 5'-end proximal to the T7 promoter. In vitro transcription and translation was carried out with the TNT® T7 Quick Coupled Reticulocyte Lysate System (Promega) according to the manufacturer's protocols in a reaction volume of 25 µl. After incubation at 30 °C for 90 min, the reaction was chilled on ice and then terminated.

In Vitro Protein-Protein Interaction Assays-- The full-length cDNA of HeLa pol  p261 or p59 was transcribed and translated in a reaction volume of 25 µl using a rabbit reticulocyte lysate system in the presence of [³⁵S]methionine as described above. 5 µl of the translated p261 or p59 was mixed with 10 µl of the in vitro translated p17 and/or 10 µl of the in vitro translated p12. The same volume of Nonidet P-40 buffer (150 mM NaCl, 1% Nonidet P-40, 50 mM Tris-HCl, pH 8.0) was added to the mixture to give rise to a final concentration of 0.5% Nonidet P-40. After the mixture was incubated at 37 °C for 30 min, 0.2 µg of the anti-p261 IgG (3A3.2) or the anti-p59 IgG (3B4.12.9) was added to the reaction, and immunoprecipitation was allowed to occur at 37 °C for 1 h. The proteins immunoprecipitated by the IgG were collected onto 20 µl of protein G beads (Amersham Pharmacia Biotech). The beads were washed three times with the Nonidet P-40 buffer and then resuspended in 20 µl of Laemmli gel loading buffer (24). The proteins bound to the protein G beads were released by incubating at 85 °C for 10 min and then separated by 4-20% SDS-PAGE. After electrophoresis, the proteins were transferred to a nitrocellulose filter that was autoradiographed.

Expression cDNA Constructs-- All eukaryotic expression vectors were constructed by standard PCR and molecular biology techniques. The open reading frame of the p261 cDNA with its Kozak sequence was cloned into pcDNA3.1 (Invitrogen). An expression vector for FLAG-tagged p17 was constructed in pCMV-Tag 2 (Stratagene). Expression vectors for V5-tagged p12 or V5-tagged p59 were constructed in pcDNA3.1/V5-His-TOPO (Invitrogen).

Cotransfection, Coimmunoprecipitation, and Western Blot Analysis-- Human embryonic kidney 293E cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. For transfections, cells were grown to 70% confluence in 100-mm cell culture dishes and transfected with the indicated plasmids using FuGENE^TM6 (Roche Molecular Biochemicals). Cells were harvested 36 h post-transfection and lysed in lysis buffer (25 mM Tris-HCl, pH 8.0, 75 mM NaCl, and 0.5% Nonidet P-40). Cell lysates were cleared by centrifugation at 10,000 × g for 10 min at 4 °C. Resulting cell-free extracts were subjected to immunoprecipitation with antibodies recognizing the epitope tags. Immunoprecipitates were washed in the lysis buffer, resolved by SDS-polyacrylamide gel electrophoresis, and subsequently analyzed by protein immunoblotting.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Purification and cDNA Cloning of HeLa p17-- A protein band corresponding in position following SDS-PAGE to a relative molecular mass of 19 kDa was initially identified with the pol  p261 and p59 subunits purified from HeLa cells that had been treated for 10 h with 2 mM hydroxyurea (Fig. 1). Using a 6-20% SDS-polyacrylamide gel instead of the standard 7.5% gel (20), this band was then identified in our purified pol  preparations from untreated HeLa cells (data not shown).

View larger version (32K): [in this window] [in a new window]   Fig. 1.   SDS-polyacrylamide gel analysis of immunoaffinity-purified HeLa DNA pol . HeLa DNA pol  was purified from HeLa cells treated with 2 mM hydroxyurea as described under "Experimental Procedures" and then electrophoresed on a 6-20% SDS-polyacrylamide gel which was subsequently stained with Colloidal Blue.

To obtain partial amino acid sequence, the protein band corresponding to a relative molecular mass of 19 kDa was in-gel digested with Lys-C protease (Wako Biochemicals), and the resultant peptides were resolved by reverse phase high performance liquid chromatography and sequenced by Edman degradation. Two peptides (TLNXSDVLSAMEEME and FVTPLK) were identified in this way.

The current data bases of the National Center for Biotechnology Information were searched for sequences containing these two peptides. No protein sequences were identified by the BLASTP algorithm (25), suggesting that the protein with a relative molecular mass of 19 kDa is a novel protein. However, seven human ESTs were found to encode the two peptides. These ESTs were aligned and assembled into a continuous sequence. Two primers were chosen from the continuous sequence and then used to screen a HeLa Uni-ZAP XR cDNA library (Stratagene) by the PCR-based method of Israel (26). A 2105-base pair cDNA clone containing these two primer sequences was obtained. The sequence codes for an open reading frame (starting from ATG) of 444 nucleotides, encoding a protein of 147 amino acids with a predicted molecular mass of 16,907 Da and a predicted pI of 4.72. Sixty-five nucleotides of 5'-untranslated sequence and 1596 nucleotides of 3'-untranslated sequence were also present. The first ATG was identified as the translation start codon because it was within the sequence GGCATGG, the consensus Kozak sequence for translation initiation (27). In addition, one stop codon in frame with the ATG is located 45 base pairs upstream from the start codon. The stop codon of the cDNA is TGA, and a polyadenylation signal (AATAAA) is 9 nucleotides upstream from the poly(A) tail.

The predicted molecular mass of p17, 16,907 Da, is smaller than its apparent molecular mass of 19 kDa determined by SDS-PAGE. The discrepancy is probably caused by the acidic pI of this protein. To test this hypothesis, the open reading frame of p17 was expressed in an in vitro rabbit reticulocyte system, and the product was analyzed on a 4-20% SDS-polyacrylamide gel. As shown in lane 1 of each panel of the experiments in Fig. 5 below, the in vitro translated protein migrates at a position corresponding to 19 kDa, which agrees with the apparent molecular mass of the protein purified from HeLa cells.

By searching the UniGene data base of the National Center for Biotechnology Information, an EST (accession number W03622), which is identical to a cDNA fragment of the human p17 gene, was assigned to the UniGene cluster Hs. 108112. Hs. 108112 has been mapped to a region of chromosome 9q33, which is between marks D9S177 and D9S154 (28). Thus, the gene of human p17 can be assigned to chromosome 9, region q33.

p17 Contains the Histone-fold Motif-- HeLa p17 has 36.5% identity to an unknown protein of S. pombe (accession number 2117305) and 32.7% identity to S. cerevisiae pol  DPB4 subunit. The alignment of the three proteins using the program ClustalW 1.7 (29) is shown in Fig. 2. Two conserved regions were identified by the Block Maker program, which included the histone fold motif at the N-terminal region and an acidic amino acid-rich domain at the C-terminal region. The histone fold motif resembles an extended helix-strand-helix motif first identified in the core histone proteins as being primarily responsible for dimerization of the H2A/H2B and H3/H4 histone pairs (30). Recently a number of proteins engaged in protein-protein and protein-DNA interactions, such as TAFIIB (transcription factor IIB), CBF, and DR1 (TATA-binding protein-associated phosphoprotein), have been found to contain the histone fold motifs (31). The histone fold motif found in HeLa p17 is most related to that of CBF-A (Fig. 2). Similar to CBF-A, p17 also has an acidic amino acid-rich region following the histone fold motif.

View larger version (57K): [in this window] [in a new window]   Fig. 2.   Amino acid sequence comparisons of HeLa p17, the homologous S. pombe peptide (accession number 2117305), S. cerevisiae DPB4, and human CBF-A. Residues in black boxes indicate sequence identity. Residues in gray boxes indicate conservative substitutions. Dashes denote gaps in the sequence introduced to maximize the alignments. The conserved histone fold motif is double overlined, and the acidic amino acid-rich region is overlined in the p17 sequence.

cDNA Cloning of p12, the Human Homologue of S. cerevisiae pol  DPB3-- p17 is the homologue to S. cerevisiae pol  DPB4. We thus asked whether there exists a human homologue for S. cerevisiae pol  DPB3. Eleven human ESTs were identified to have significant homology to S. cerevisiae DPB3. The continuous sequence assembled from these ESTs forms an open reading frame of 348 residues that encodes a polypeptide of 116 amino acid residues that contains a histone fold motif similar to that of DPB3. However, this cDNA fragment did not likely contain coding sequence for the 5' terminus because it did not contain a start ATG codon in the correct reading frame. Therefore, to obtain the full-length cDNA sequence, a HeLa ZAP cDNA library was screened with two oligonucleotides derived from the assembled EST sequence. A 803-base pair cDNA clone containing the two oligonucleotide sequences was identified after six rounds of screening. This cDNA codes for an open reading frame (starting from ATG) of 351 nucleotides, encoding a protein of 117 amino acids with a predicted molecular mass of 12,251 Da and a predicted pI of 4.87. The first ATG was identified as the translation start codon because it was within the sequence GGGATGG, the consensus Kozak sequence for translation initiation (27). In addition, one TAG stop codon in frame with the ATG initiation codon was present 60 nucleotides upstream. The 3' noncoding region was found to consist of 427 nucleotides with a polyadenylation signal (AATAAA) 17 nucleotides upstream from the poly(A) tail. Moreover, the p12 gene is part of a Unigene cluster, Hs. 19980, which has been mapped to chromosome 2, region p12 (between marker D2S292 and S2S145) (28). Thus, the p12 gene locus can be assigned to chromosome 2p12.

The open reading frame of p12 was expressed in vitro in a rabbit reticulocyte system, and the product was analyzed on a 4-20% SDS-polyacrylamide gel. As shown in lane 2 of each panel of the experiments in Fig. 5 below, the in vitro translated protein migrates to a position corresponding to 19 kDa on such a gel. Interestingly, despite the difference in their calculated molecular masses, p12 and p17 comigrate on SDS-polyacylamide gel.

p12 has a histone fold motif that is 34% identical and 52% similar to that of DPB3. Different from the motif found in p17, the histone fold motifs of p12 and DPB3 are more homologous to that of subunit C of CBF (Fig. 3).

View larger version (50K): [in this window] [in a new window]   Fig. 3.   Alignment of the amino acid sequences of HeLa p12, S. cerevisiae DPB3, and human CBF-C. Residues in black boxes indicate sequence identity. Residues in gray boxes indicate conservative substitutions. Dashes denote gaps in the sequence introduced to maximize the alignments. The conserved histone fold motif is double overlined.

p17 and p12 Interact-- p17 and p12 are homologous to subunits A and C of CBF, respectively. Because the histone fold motifs of CBF-A and CBF-C can interact with each other to form the CBF-A-CBF-C heterodimer (32), we tested whether there is physical interaction between p17 and p12. Human embryonic kidney 293E cells were transfected with expressions vectors for FLAG-p17 and/or p12-V5. Cell lysates were prepared from the transfected cells and were then immoprecipitated with anti-V5 antibody or anti-FLAG M2 antibody. The coimmunoprecipitation studies showed that p12-V5 can be immunoprecipitated with anti-FLAG antibody only in the presence of FLAG-p17 (Fig. 4), whereas FLAG-p17 can be immunoprecipitated with anti-V5 antibody only in the presence of p12-V5 (Fig. 4). Taken together, p17 and p12 do indeed interact.

View larger version (36K): [in this window] [in a new window]   Fig. 4.   p17 interacts with p12. Human embryonic kidney 293E cells were transfected with 5 µg of V5-tagged p12 cDNA in pcDNA3.1/V5-His-TOPO, or/and of FLAG-tagged p17 cDNA in pCMV-Tag2. Cells were lysed in 0.5 × Nonidet P-40 buffer (25 mM Tris-HCl, pH 8.0, 75 mM NaCl, and 0.5% Nonidet P-40) 36 h post-transfection. The cell lysates were immunoprecipitated with 1 µg of anti-FLAG M2 antibody or anti-V5 antibody. The immunoprecipitated proteins were resolved by 4-20% SDS-PAGE as noted on the top of the gel images and analyzed by immunoblotting with the anti-V5 antibody (left panels) or anti-FLAG M2 antibody (right panels). IP, immunoprecipitating antibody; WB, detection antibody used for the Western blot. The antigen migrating just below the position of the 30-kDa marker, which is recognized by the anti-FLAG antibody, is unidentified.

p17/p12 Directly Associate with Both p261 and p59 of HeLa pol  in Vitro-- To investigate whether p17 and/or p12 directly interact with HeLa pol , the full-length cDNAs of pol  p261 and p59 were transcribed and translated in a rabbit reticulocyte lysate, and the expressed proteins were incubated with in vitro translated p17 and/or p12. The mixtures were then immunoprecipitated with an antibody against p59 (3B4.12.9). Fig. 5A clearly shows that p17 combined with p12 (lane 6), but not p17 alone (lane 4) or p12 (lane 5) alone, can be coimmunoprecipitated with HeLa pol  p261 and p59. (Of course, because p17 and p12 comigrate, this experiment does not distinguish whether one or both of p17 and p12 were bound to p261/p59.)

View larger version (23K): [in this window] [in a new window]   Fig. 5.   p17/p12 directly interact with p261 and p59 of HeLa pol . A, in vitro translated p261 and p59 were incubated with in vitro translated p17 (lane 4), p12 (lane 5), or p17 and p12 (lane 6), and then the mixtures were immunoprecipitated (IP) by anti-p59 antibody, 3B 4.12.9. The precipitated proteins were mixed with the Laemmli gel loading buffer (24) and then subjected to electrophoresis through a 4-20% SDS-polyacrylamide gel. After electrophoresis, the proteins were transferred to a nitrocellulose filter that was autoradiographed. 1 µl of the in vitro translated p17 (lane 1) or p12 (lane 2) was also added directly to the gel or subjected to immunoprecipitation alone (lanes 7 and 8, respectively). B, in vitro translated p261 was mixed with in vitro translated p17 (lane 4), p12 (lane 5), or p17 and p12 (lane 6), and then the mixtures were immunoprecipitated by anti-p261 antibody, 3A3.2. The precipitated proteins were separated by 4-20% SDS-PAGE. Control lanes 1, 2, 7, and 8 were as in A. C, in vitro translated p59 was mixed with in vitro translated p17 (lane 4), p12 (lane 5), or p17 and p12 (lane 6). The proteins were then immunoprecipitated by antibody against p59, 3B4.12.9 and separated on 4-20% SDS-PAGE.

The catalytic subunit of S. cerevisiae pol  has been shown to be essential for binding of all three subunits (4), and pol  in the pol 2-1 mutants lacked the associated subunits (4). For HeLa pol , the 261-kDa catalytic subunit is also important for binding of p17 and p12. As demonstrated in Fig. 5B, p17 together with p12 (lane 5), but not p17 alone (lane 3) or p12 (lane 4) alone, can be coimmunoprecipitated with HeLa pol  p261. p261 therefore appears to be sufficient for binding of p17/p12. However, it is not the only pol  subunit to interact with p17/p12. As shown in Fig. 5C, HeLa pol  p59 alone was also able to be coimmunoprecipitated with p17/p12 (lane 6). Taken together, when both p17 and p12 are both present, p17 and/or p12 can interact with both p261 and p59 of HeLa pol .

The Four Subunits of Human pol  Form a Complex in Vivo-- Because p17 and p12 comigrate during SDS-PAGE, the above experiments do not show whether p12 and p17 are both present in the immunoprecipitates, only that both must be present so that at least one of them can interact. To be sure that a heterocomplex of all four subunits can be formed, human embryonic kidney 293E cells were cotransfected with combinations of the expression plasmids for p261, p59-V5, FLAG-p17, and p12-V5. Cell lysates were then probed by immunoblots directly (Fig. 6A) or after immunoprecipitation with anti-FLAG antibody (Fig. 6B). Expression was as predicted in each case (Fig. 6A). In the lysates prepared from the four cDNA cotransfected cells, not only FLAG-p17, but also p261, p59-V5, and p12-V5 were each also precipitated by the anti-FLAG antibody. In contrast, p261 with p59-V5 alone cannot be precipitated by anti-FLAG antibody. This result clearly demonstrates that p261, p59, p17, and p12 can form a protein complex in vivo.

View larger version (52K): [in this window] [in a new window]   Fig. 6.   p261, p59, p17, and p12 form a complex in vivo. Human embryonic kidney 293E cells were transiently cotransfected with 5 µg of p261 in pcDNA3.1, 3 µg of p59-V5 in pcDNA3.1/V5-His-TOPO, and/or 2 µg of FLAG-p17 in pCMV-Tag2, and/or 2 µg of p12-V5 in pcDNA3.1/V5-His-TOPO. The cells were lysed in 1 ml of 0.5 × Nonidet P-40 buffer (25 mM Tris-HCl, pH 8.0, 75 mM NaCl, and 0.5% Nonidet P-40) 36 h post-transfection. A, 20 µl of each cell lysate was separated by 4-20% SDS-PAGE. After electrophoresis, the proteins were transferred to a nitrocellulose filter that was probed with the indicated antibodies. B, 1 ml of each cell lysate was immunoprecipitated with 5 µg of anti-FLAG M2 antibody, and then the immunoprecipitated proteins were resolved by 4-20% SDS-PAGE. After electrophoresis the proteins were probed by immunoblotting with the indicated antibodies.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Several lines of evidence strongly suggest that p17 and p12 are subunits of HeLa pol . First, p17 and p12 interact with p261 and p59 subunits of HeLa pol  in vitro but only when both p17 and p12 are present. Secondly, p17 and p12 interact with each other. Thirdly, p17, p12, p261, and p59 are able to form a protein complex after their cDNAs were cotransfected into 293E cells. Fourthly, the endogenous p17 can be coimmunoprecipitated with pol  p261 and p59 subunits from HeLa cell-free extracts. For these reasons it seems reasonable to assume that p12 also exists in the endogenous pol  complex.

p17 and p12 contain histone fold motifs that also exist in S. cerevisiae pol  DPB4 and DPB3, respectively. By sequence homology, p12 appears to be the mammalian counterpart of S. cerevisiae DPB3. p17, however, is more homologous to S. cerevisiae DPB4. The histone fold motifs of p17 (DPB4) and p12 (DPB3) are related to those of subunits A and C of human CBF, respectively. An essential function of the histone fold motifs of the CBF subunits is to create a protein-protein interaction surface for binding to the histone acetyl transferase enzymes such as GCN5 and p/CAF (33). These associated histone acetyltransferases can activate CBF transactivation potential in vivo, possibly by acetylation of the N-terminal lysine residues of the histones, which results in disruption of local chromatin structure, thereby facilitating CBF access to its CCAAT promoter sites. p17 and p12 may be performing a similar role by creating a protein-protein interaction surface allowing pol  to interact with other proteins, possibly also proteins that modify chromatin structure so as to allow pol  to carry out its replication and/or repair functions.

Compared with the rich knowledge of the influence of histone acetylation on transcription, little is known of the exact role of chromatin structure in replication. It is a speculative proposal that local disruption of chromatin structure by histone acetylation might facilitate access of replication factors to nucleosomal DNA. An investigation of the possible interaction between pol  subunits and proteins including histone acetyl transferases will further our understanding of the function of pol  in chromosomal replication and provide insight into the DNA replication process.

	ACKNOWLEDGEMENT

We thank Ann Fischer for expert tissue culture help.

	FOOTNOTES

^* This work was supported by Grants 1R01GM30415 and P30ES08196 from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF261689 and AF261688.

^¶ To whom correspondence should be addressed: Div. of Biochemistry and Molecular Biology, 229 Stanley Hall, University of California, Berkeley, CA 94720-3206. Tel.: 510-642-7583; Fax: 510-643-9290; E-mail: slinn@socrates.berkeley.edu.

² V. Wood, B. G. Barrell, M. A. Rajandream, and R. E. Conner, GenBank^TM accession number Z95397.

	ABBREVIATIONS

The abbreviations used are: pol, polymerase; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; CBF, CCAAT binding factor; NER, nucleotide excision repair; EST, expressed sequence tag.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				Y.-L. Wang, F. Faiola, M. Xu, S. Pan, and E. Martinez Human ATAC Is a GCN5/PCAF-containing Acetylase Complex with a Novel NC2-like Histone Fold Module That Interacts with the TATA-binding Protein J. Biol. Chem., December 5, 2008; 283(49): 33808 - 33815. [Abstract] [Full Text] [PDF]

				T. Tsubota, R. Tajima, K. Ode, H. Kubota, N. Fukuhara, T. Kawabata, S. Maki, and H. Maki Double-stranded DNA Binding, an Unusual Property of DNA Polymerase {epsilon}, Promotes Epigenetic Silencing in Saccharomyces cerevisiae J. Biol. Chem., October 27, 2006; 281(43): 32898 - 32908. [Abstract] [Full Text] [PDF]

				M.-G. Spiga and G. D'Urso Identification and cloning of two putative subunits of DNA polymerase epsilon in fission yeast Nucleic Acids Res., September 23, 2004; 32(16): 4945 - 4953. [Abstract] [Full Text] [PDF]

				T. Kesti, W. H. McDonald, J. R. Yates III, and C. Wittenberg Cell Cycle-dependent Phosphorylation of the DNA Polymerase Epsilon Subunit, Dpb2, by the Cdc28 Cyclin-dependent Protein Kinase J. Biol. Chem., April 2, 2004; 279(14): 14245 - 14255. [Abstract] [Full Text] [PDF]

				A. D. McConnell, M. E. Gelbart, and T. Tsukiyama Histone Fold Protein Dls1p Is Required for Isw2-Dependent Chromatin Remodeling In Vivo Mol. Cell. Biol., April 1, 2004; 24(7): 2605 - 2613. [Abstract] [Full Text] [PDF]

				T. Iida and H. Araki Noncompetitive Counteractions of DNA Polymerase {varepsilon} and ISW2/yCHRAC for Epigenetic Inheritance of Telomere Position Effect in Saccharomyces cerevisiae Mol. Cell. Biol., January 1, 2004; 24(1): 217 - 227. [Abstract] [Full Text] [PDF]

				W. Feng, L. Rodriguez-Menocal, G. Tolun, and G. D'Urso Schizosacchromyces pombe Dpb2 Binds to Origin DNA Early in S Phase and Is Required for Chromosomal DNA Replication Mol. Biol. Cell, August 1, 2003; 14(8): 3427 - 3436. [Abstract] [Full Text] [PDF]

				H. Asahara, Y. Li, J. Fuss, D. S. Haines, N. Vlatkovic, M. T. Boyd, and S. Linn Stimulation of human DNA polymerase {epsilon} by MDM2 Nucleic Acids Res., May 1, 2003; 31(9): 2451 - 2459. [Abstract] [Full Text] [PDF]

				J. Fuss and S. Linn Human DNA Polymerase epsilon Colocalizes with Proliferating Cell Nuclear Antigen and DNA Replication Late, but Not Early, in S Phase J. Biol. Chem., March 1, 2002; 277(10): 8658 - 8666. [Abstract] [Full Text] [PDF]

				W. Feng and G. D'Urso Schizosaccharomyces pombe Cells Lacking the Amino-Terminal Catalytic Domains of DNA Polymerase Epsilon Are Viable but Require the DNA Damage Checkpoint Control Mol. Cell. Biol., July 15, 2001; 21(14): 4495 - 4504. [Abstract] [Full Text] [PDF]

				S. Waga, T. Masuda, H. Takisawa, and A. Sugino DNA polymerase varepsilon is required for coordinated and efficient chromosomal DNA replication in Xenopus egg extracts PNAS, April 5, 2001; (2001) 81088798. [Abstract] [Full Text]

				W. Liu and S. Linn Proteolysis of the human DNA polymerase {varepsilon} catalytic subunit by caspase-3 and calpain specifically during apoptosis Nucleic Acids Res., November 1, 2000; 28(21): 4180 - 4188. [Abstract] [Full Text] [PDF]

				T. Ohya, S. Maki, Y. Kawasaki, and A. Sugino Structure and function of the fourth subunit (Dpb4p) of DNA polymerase {varepsilon} in Saccharomyces cerevisiae Nucleic Acids Res., October 15, 2000; 28(20): 3846 - 3852. [Abstract] [Full Text] [PDF]

				R. Dua, S. Edwards, D. L. Levy, and J. L. Campbell Subunit Interactions within the Saccharomyces cerevisiae DNA Polymerase epsilon (pol epsilon ) Complex. DEMONSTRATION OF A DIMERIC pol epsilon J. Biol. Chem., September 8, 2000; 275(37): 28816 - 28825. [Abstract] [Full Text] [PDF]

				M. Makiniemi, T. Hillukkala, J. Tuusa, K. Reini, M. Vaara, D. Huang, H. Pospiech, I. Majuri, T. Westerling, T. P. Makela, et al. BRCT Domain-containing Protein TopBP1 Functions in DNA Replication and Damage Response J. Biol. Chem., August 3, 2001; 276(32): 30399 - 30406. [Abstract] [Full Text] [PDF]

				S. Waga, T. Masuda, H. Takisawa, and A. Sugino DNA polymerase varepsilon is required for coordinated and efficient chromosomal DNA replication in Xenopus egg extracts PNAS, April 24, 2001; 98(9): 4978 - 4983. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) An addition or correction has been published All Versions of this Article: 275/30/23247    most recent M002548200v1