HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 31, 23462-23470, August 4, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/31/23462    most recent M002208200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Schedlich, L. J. Articles by Baxter, R. C. Search for Related Content PubMed PubMed Citation Articles by Schedlich, L. J. Articles by Baxter, R. C. Social Bookmarking                      What's this?

Nuclear Import of Insulin-like Growth Factor-binding Protein-3 and -5 Is Mediated by the Importin  Subunit^*

Lynette J. Schedlich^§, Sophie L. Le Page, Sue M. Firth, Lyndall J. Briggs^¶, David A. Jans^¶, and Robert C. Baxter

From the  Kolling Institute of Medical Research, University of Sydney, Royal North Shore Hospital, Sydney, New South Wales 2065, Australia and the ^¶ John Curtin School of Medical Research, Australian National University, Canberra, Australian Capital Territory 2601, Australia

Received for publication, March 14, 2000, and in revised form, May 1, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Although insulin-like growth factor-binding protein (IGFBP)-3 and IGFBP-5 are known to modulate cell growth by reversibly sequestering extracellular insulin-like growth factors, several reports have suggested that IGFBP-3, and possibly also IGFBP-5, have important insulin-like growth factor-independent effects on cell growth. These effects may be related to the putative nuclear actions of IGFBP-3 and IGFBP-5, which we have recently shown are transported to the nuclei of T47D breast cancer cells. We now describe the mechanism for nuclear import of IGFBP-3 and IGFBP-5. In digitonin-permeabilized cells, where the nuclear envelope remained intact, nuclear translocation of wild-type IGFBP-3 appears to occur by a nuclear localization sequence (NLS)-dependent pathway mediated principally by the importin  nuclear transport factor and requiring both ATP and GTP hydrolysis. Under identical conditions, an NLS mutant form of IGFBP-3, IGFBP-3[²²⁸KGRKR  MDGEA], was unable to translocate to the nucleus. In cells where both the plasma membrane and nuclear envelope were permeabilized, wild-type IGFBP-3, but not the mutant form, accumulated in the nucleus, implying that the NLS was also involved in mediating binding to nuclear components. By fusing wild-type and mutant forms of NLS sequences (IGFBP-3 [215-232] and IGFBP-5 [201-218]) to the green fluorescent protein, we identified the critical residues of the NLS necessary and sufficient for nuclear accumulation. Using a Western ligand binding assay, wild-type IGFBP-3 and IGFBP-5, but not an NLS mutant form of IGFBP-3, were shown to be recognized by importin  and the / heterodimer but only poorly by importin . Together these results suggest that the NLSs within the C-terminal domain of IGFBP-3 and IGFBP-5 are required for importin--dependent nuclear uptake and probably also accumulation through mediating binding to nuclear components.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The mitogenic effects of insulin-like growth factors (IGFs)¹ are modulated by a family of IGF-binding proteins (IGFBPs). Following their secretion into the extracellular environment, the IGFBPs inhibit or stimulate cell growth by regulating access of the extracellular IGFs to the type I IGF receptor (1). However, some IGFBPs, including IGFBP-3, also have effects on cell growth that are type I receptor-independent (2, 3). Expression of recombinant human IGFBP-3, for example, has been shown to inhibit the proliferation of murine fibroblasts with a targeted disruption to the type I receptor (4). This growth inhibitory effect was directly related to the induction of apoptosis by IGFBP-3 (5). In addition, a number of potent growth-inhibitory and apoptosis-inducing agents such as transforming growth factor 1, retinoic acid, tumor necrosis factor-, and anti-estrogens also induce IGFBP-3 gene expression (6, 7). These effects on cell growth may be mediated by IGFBP-3 in an IGF-independent manner. There are fewer reports of IGF-independent effects of IGFBP-5; these include its ability to stimulate bone cell growth in the absence of increased IGF-I binding to its receptor (8). The mechanism(s) for the IGF-independent effects of IGFBP-3 and IGFBP-5 are currently unknown but may involve a direct nuclear action.

Although some proteins appear to be constitutively nuclear, others enter the nucleus only under defined conditions (9). Thus, cells are able to control the activity of nuclear proteins by regulating their nuclear uptake during differentiation and changes in the metabolic state of the cell. The central pore of the nuclear pore complex allows molecules up to 45 kDa to move freely between the nuclear and cytoplasmic compartments (10). For proteins larger than 45 kDa, nuclear transport is generally an active, nuclear localization sequence (NLS)-dependent process that requires specific targeting sequences contained within the primary sequence of the transported protein or a cotransported protein (11).

The cell contains multiple signal-dependent pathways for nuclear transport, of which the best characterized requires the cytosolic receptors, importin  and  (12), the monomeric guanine nucleotide-binding protein, Ran (13-15), and interacting proteins such as nuclear transport factor 2 (16-18). Conventionally, the importin  subunit acts as an adapter, binding to the NLS of cytosolic proteins as well as to importin , which together with Ran effects translocation through the nuclear pore complex. The importin / heterodimer recognizes three different classes of NLS: those that contain basic residues arranged as a single stretch (e.g. the NLS of the SV40 large tumor antigen, T-ag) (9, 19, 20) or as two clusters of basic residues separated by a spacer region (bipartite NLS) (9, 21) or those resembling the NLS of the yeast homeodomain protein Mat2 (22). Other signal-dependent pathways have been described that include the transport of proteins that bind directly to and are transported by members of the importin  family (in this pathway the adapter, importin , is not required to effect nuclear transport) (23-25) and those that do not require soluble cytosolic receptors at all but appear to require ATP (26-28).

Significantly, in the context of IGF-independent nuclear action, the C-terminal regions of IGFBP-3 and IGFBP-5 contain a domain with strong sequence homology to the bipartite NLS consensus motif (29). This basic domain is highly conserved in IGFBP-3 and IGFBP-5 from different species, suggesting that it has functional significance. Similar basic sequences have been identified in a number of other secreted proteins and shown to be important for their respective signaling roles. These include platelet-derived growth factor A (30), acidic fibroblast growth factor (31), and parathyroid hormone-related protein (32). We and others have described the nuclear transport of IGFBP-3 and IGFBP-5 in a number of cell lines (33-36).

As part of our investigation into the role of nuclear IGFBP-3 and IGFBP-5, the present study examines the mechanisms for their nuclear import. We report that previously identified NLS-like sequences within IGFBP-3 and IGFBP-5 are necessary and sufficient for their nuclear accumulation. IGFBP-3 nuclear import is an energy-dependent process requiring ATP and GTP hydrolysis and mediated by importin . In addition, IGFBP-3 and IGFBP-5 are both recognized specifically by importin  and the importin / heterodimer but not by importin . Thus, nuclear import of IGFBP-3, and by analogy IGFBP-5, appears to occur by a signal-dependent importin -mediated pathway. In addition, we show that, possibly mediated by its NLS, IGFBP-3 is capable of interaction with nuclear binding sites, which may play an important role in its nuclear accumulation.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Recombinant human IGFBP-3 and IGFBP-3[²²⁸KGRKR  MDGEA] were produced by a replication-deficient adenovirus-mediated expression system, as described previously (37). IGFBP-3 was purified from conditioned media by IGF-I affinity chromatography and reverse-phase high pressure liquid chromatography (38). In studies requiring fluorescently labeled IGFBP-3, the protein was conjugated to dichlorotriazinylaminofluorescein I HCl as described previously for Cy3 (35). The fusion proteins generated by linking -galactosidase to the bipartite NLS derived from the Xenopus laevis phosphoprotein, N1N2 (N1N2 NLS:-gal), or the T-ag NLS were expressed, purified, and, where appropriate, fluorescently labeled with 5-iodoacetamidofluorescein as described previously (39). Recombinant human IGFBP-5 was a generous gift from J. Zapf (Zürich, Switzerland). IGFBP-1 was purified from human amniotic fluid (40), recombinant human IGFBP-2 was provided by Sandoz (Basel, Switzerland), and IGF-I was provided by Genentech (South San Francisco, CA). Antiserum against IGFBP-3 was prepared in this laboratory following immunization of rabbits with purified antigen, and the monoclonal antibody specific for importin  (mAb3E9, from purified ascites fluid) was from S. Adam (Chicago, IL). Dichlorotriazinylaminofluorescein I HCl was purchased from Research Organics and 5-iodoacetamidofluorescein and Texas Red-dextran (~70 kDa) were purchased from Molecular Probes. Creatine phosphokinase, creatine phosphate, ATP, and FITC-dextran (~77 kDa), leupeptin, apyrase, GTPS, CHAPS, Triton X-100, and RIA grade BSA were obtained from Sigma.

In Vitro Nuclear Transport Assay-- In vitro nuclear transport was carried out as described previously (41). Chinese hamster ovary (CHO) cells were cultured on glass coverslips, washed with ice-cold transport buffer (50 mM Hepes/KOH, pH 7.3, 110 mM potassium acetate, 5 mM sodium acetate, 2 mM magnesium acetate, 1 mM EGTA, and 1 mM dithiothreitol), and permeabilized with 50 µg/ml digitonin (Calbiochem) for 5 min on ice. The cells were washed with transport buffer, and the coverslips were inverted over 20 µl of transport buffer containing either IGFBP-3 (5 ng/µl) or N1N2 NLS:-gal (0.2 µg/µl) with 45 mg/ml rabbit reticulocyte lysate (RRL) (Promega), an ATP-regenerating system (0.125 mg/ml creatine phosphokinase, 30 mM creatine phosphate, 2 mM ATP), and 200 µg/ml Texas Red or FITC-labeled dextran. Although no RRL-induced proteolysis of IGFBP-3 was detected by Western immunoblotting (data not shown), 1 µg/ml leupeptin, 25 units/ml trasylol (Bayer), and 40 µg/ml bestatin (Roche) were routinely added as protease inhibitors to the transport assay. The cells were incubated in a humidified environment for 30 min at 22 °C.

For competition experiments, RRL was incubated at 22 °C for 30 min with an excess of unlabeled IGFBP-3 prior to the addition of labeled IGFBP-3. Where RRL was omitted, 0.25% BSA was included in the transport buffer. For studies carried out in the absence of an ATP-regenerating system, apyrase was used to pretreat cells (0.2 unit/ml, 37 °C, 15 min), and RRL (800 units/ml, 22 °C, 10 min) was used to remove endogenous ATP. To investigate the role of importin  in IGFBP-3 nuclear import, the transport assay was carried out in the presence of an anti-importin  antibody (80 µg/ml) without the addition of RRL. The role of GTP hydrolysis in nuclear import of IGFBP-3 was examined by preincubating RRL with the nonhydrolyzable GTP analogue, GTPS (2 mM), for 10 min at 22 °C. When added to the cells, the final concentration of GTPS was 300 µM. To assess the contribution to nuclear accumulation of binding to nuclear components, the nuclear envelope was permeabilized by addition of 0.025% CHAPS in 2 mM Tris·HCl, pH 7.0, and 1% glycerol to the transport solution (42), and the duration of the assay was reduced to 10 min at 22 °C.

For transport assays using labeled IGFBP-3 or N1N2 NLS:-gal, fluorescence was detected directly following fixation of the cells. Where unlabeled IGFBP-3 was used, the subcellular localization was determined using indirect immunocytochemistry. Cells were fixed using Histochoice (Amresco), the nuclear envelope was permeabilized with 0.25% Triton X-100, and the cells were blocked with 1% BSA in phosphate-buffered saline for 1 h at 22 °C. The cells were then incubated with antiserum against IGFBP-3 or nonimmune rabbit serum (1:5000) diluted in blocking buffer for 1 h at 22 °C. Cells were then washed and incubated with goat anti-rabbit IgG conjugated with rhodamine (Immunotech) diluted 1:200 in blocking buffer for 1 h at 22 °C. Cells were mounted in an antifade medium and examined using a confocal laser scanning microscopic (CLSM) system (Optiscan F900e Personal Confocal System, Victoria, Australia) fitted with a krypton-argon laser and dual channel detection optics. Individual cells were optically sectioned in the xy plane with multiple scan averaging. All images were collected under identical, nonsaturating conditions. The intensity of fluorescent labeling within cells was analyzed using the program NIH Image version 1.61. Pixel intensity, as a measure of fluorescence intensity, was measured within specific regions of the cell (cytoplasmic and nuclear) as well as in regions outside the cell (background). The pixel intensity from each subcellular region was averaged over at least 100 cells. After correction for background fluorescence, the results were expressed as the ratio of nuclear to cytoplasmic fluorescence (Fn/c).

Construction of EGFP Fusion Proteins-- A 1080-base pair EcoRI-PvuII fragment containing the full coding sequence of human IGFBP-3 was inserted into pSELECT (Promega) to generate pSF106 (38). Site-directed mutagenesis of pSF106 was carried out with the following oligonucleotides to introduce specific mutations: 5'-CCCAACTGTGACAAGAACGGATTTTATAAGAAAAAGC was used to generate pSF184 (²¹⁶K  N); 5'-GTGACAAGAAGGGATTTTATCACTCCCGCCAGTGTCGCCCTTCCAAAGG was used to generate pSF170 (²²⁰KKK  HSR) and 5'-TTTTATAAGAAAAAGCAGTGTCGCCCTTCCATGGACGGGGAGGCGGGCTTCTGCTGGTGTGTGGATAAGTATGGG to generate pSF110 (²²⁸KGRKR  MDGEA). Nucleotides that differ from the IGFBP-3 sequence are underlined. The cDNA for human IGFBP-5 was generated from total RNA isolated from U2-OS osteosarcoma cell-line by reverse transcription-polymerase chain reaction. The resulting 868-base pair fragment containing the full coding sequence of IGFBP-5 was inserted into pAC-CMV to generate pSF601.

Oligonucleotides containing KpnI and BamHI restriction sites for subcloning were synthesized on an Oligo 1000 DNA Synthesizer (Beckman Instruments). Fragments containing the 18-amino acid wild-type or mutant NLSs of IGFBP-3 or IGFBP-5 were amplified by Pfu turbo polymerase (Stratagene) and cloned into the EGFP C-terminal fusion vector, pEGFP-C1 (CLONTECH).

The wild-type IGFBP-3 NLS was amplified from pSF106 using primers 1 and 2 and wild-type IGFBP-5 NLS was amplified from pSF601 using primers 3 and 4 (Table I). The mutant ²¹⁶K  N^(BP-3) was amplified from pSF184 using primers 2 and 5, and ²⁰²K  N^(BP-5) was amplified from pSF601 using primers 4 and 6. The mutant ²¹⁵KK  AA^(BP-3) was amplified from pSF106 using primers 2 and 7, and ²⁰¹RK  AA^(BP-5) was amplified from pSF601 using primers 4 and 8. The mutant ²²⁰KKK  HSR^(BP-3) was amplified from pSF170 using primers 2 and 9, and ²⁰⁶KRK  HSR^(BP-5) was amplified from overlapping oligonucleotides 10 and 11. The mutant ²²⁸KGRKR  MDGEA^(BP-3) was amplified from pSF110 using primers 1 and 12, and ²¹⁴RGRKR  MDGEA^(BP-5) was amplified from pSF601 using primers 3 and 13. All mutations within the 18-amino acid basic region of IGFBP-3 and IGFBP-5 (except the N-terminal double alanine mutants) are based on the corresponding sequences in IGFBP-1.

The IGFBP-3 double mutant ²¹⁶K  N and ²²⁰KKK  HSR^(BP-3) was amplified from pSF170 using primers 2 and 5, and the double mutant ²¹⁶K  N and ²²⁸KGRKR  MDGEA^(BP-3) was amplified from pSF110 using primers 5 and 12. Following amplification, all polymerase chain reaction products were cloned inframe into the KpnI and BamHI restriction sites of pEGFP-C1 and checked by sequencing.

Cell Culture and Transient Transfection-- CHO cells were maintained in -modification of Eagle's medium supplemented with 10% fetal calf serum (Cytosystems). For transient transfection, CHO cells were cultured on glass coverslips in 6-well dishes. At 70-80% confluence, 2 µg of EGFP fusion plasmid was transfected into cells using LipofectAMINE (Life Technologies) according to the manufacturer's instructions. At 24 h after transfection, cells were fixed with Histochoice for 20 min, mounted in an antifade medium, and scored using an Olympus BX60 fluorescent microscope.

Statistical Analysis-- Data were analyzed by analysis of variance followed by Fisher's protected least significant difference test using Statview 4.02 (Abacus Concepts, Inc.).

Dot Blot and Western Ligand Binding Assays-- Binding of IGFBP-3 and IGFBP-5 to importin subunits was examined by dot blot or Western ligand binding assays as described previously (43). The mouse - and -importin subunits were expressed as glutathione S-transferase fusion proteins and purified as described previously (43). The binding proteins and controls were applied directly to a nitrocellulose membrane (dot blot) or separated on 10% SDS-polyacrylamide gel electrophoresis prior to membrane transfer (Western ligand blot). The two different approaches allowed these studies to be carried out with the binding proteins in their native (dot blot) and denatured forms (Western ligand blot). Where indicated, IGFBP-3 was preincubated with an equimolar amount of IGF-I before application in the dot blot assay. The membranes were blocked in intracellular buffer containing 5% BSA for 4 h at 22 °C and hybridization at 4 °C for 16 h in intracellular buffer containing 1% BSA and either a preformed complex of mouse  and  importin subunits fused to glutathione S-transferase (1:1 molar ratio) at a final concentration of 150 nM or with the individual subunits alone at the same concentration. Binding of importins to IGFBPs was detected using a glutathione S-transferase-specific antibody (Amersham Pharmacia Biotech), followed by an alkaline phosphatase-conjugated secondary antibody (Sigma) and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-1-phosphate (Promega) (dot blot) or a horseradish peroxidase-conjugated secondary antibody (Amersham Pharmacia Biotech) and ECL (Amersham Pharmacia Biotech) (Western ligand blot). In the case of the latter, imaging was carried out using a Fujifilm FLA-3000 Gel Imager, with quantitation performed using the Image Gauge 3.11 software.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Nuclear Import of IGFBP-3 Is a Specific and Saturable Process-- NLS-dependent nuclear protein import is an active process requiring cytosolic factors including importin /, Ran, and interacting factors (44). Because IGFBP-3 (40-45-kDa glycosylated doublet) is close to the theoretical limit for diffusion into the nucleus, we investigated whether nuclear import could occur by a conventional NLS-mediated pathway. An in vitro nuclear transport assay was used in which the plasma membrane of CHO cells was permeabilized with the weak nonionic detergent digitonin, leaving the nuclear envelope intact (41). Nuclear transport of fluorescently labeled IGFBP-3 was examined in the presence of a transport solution containing RRL (a source of cytosolic proteins), an ATP-regenerating system (to provide energy for translocation), and fluorescently labeled-dextran (to control for membrane integrity). The subcellular distribution of the fluorescent signal was determined using CLSM. In all cells where the plasma membrane had been permeabilized but where the nuclear envelope remained intact (fluorescently labeled dextran being specifically excluded from the nucleus), IGFBP-3 was localized to the cell nuclei (Fig. 1A). Quantitation using NIH Image version 1.61 (see "Experimental Procedures") showed that IGFBP-3 accumulated in the nucleus at levels 4.7-fold greater than in the cytoplasm (Fig. 1D).

View larger version (75K): [in this window] [in a new window]   Fig. 1.   Nuclear import of IGFBP-3 is a specific and saturable process. Following permeabilization of the plasma membrane, CHO cells were incubated in transport solution containing cytosol, an ATP-regenerating system and fluorescently labeled IGFBP-3 without (A, nil) or with a 10-fold (B) or 20-fold (C) excess of unlabeled IGFBP-3. The images were collected using CLSM and are representative of three independent experiments. Scale bar, 50 µm. Quantitation was carried out using NIH Image, and the results were expressed as the ratio of nuclear to cytoplasmic fluorescence (Fn/c) ± S.E. (D).

To demonstrate that nuclear import of IGFBP-3 was a specific and saturable process, we competed fluorescently labeled IGFBP-3 with unlabeled IGFBP-3. Cytosol was preincubated with a 10- or 20-fold excess of unlabeled IGFBP-3 prior to the addition of fluorescently labeled IGFBP-3. Results of the in vitro nuclear transport assay showed that the nuclear to cytoplasmic fluorescence ratio was reduced to 2.6-fold in the presence of a 10-fold excess of unlabeled IGFBP-3 (Fig. 1, B and D). Following preincubation with a 20-fold excess of unlabeled IGFBP-3 (Fig. 1C), this was further reduced to 1.5-fold (Fig. 1D), close to an Fn/c value of 1.0 representing equal fluorescence in the nucleus and cytoplasm. Therefore, an Fn/c value of 1.5 suggests that little nuclear fluorescence was detectable following the addition of a 20-fold excess of unlabeled IGFBP-3.

Nuclear Transport of IGFBP-3 Is an Energy-dependent Process Mediated by the Importin  Subunit-- The role of individual components of the nuclear transport pathway can be examined by their selective addition to the in vitro nuclear transport assay. We compared the nuclear uptake of IGFBP-3 with that of N1N2 NLS:-gal, which is transported to the nucleus by the conventional NLS-mediated nuclear protein import pathway utilizing Ran and the importin / heterodimer (45, 46). Following nuclear transport, the subcellular localization of unlabeled IGFBP-3 was monitored using indirect immunocytochemistry, the control protein was directly fluorescently labeled, and both were detected using CLSM.

As was observed for fluorescently labeled IGFBP-3 (Fig. 1A), all cells with an intact nuclear envelope contained nuclear IGFBP-3 (Fig. 2A). When specific IGFBP-3 antiserum was replaced with nonimmune rabbit serum in similarly treated cells, only light background labeling was detected, indicating that the signal was specific to IGFBP-3 (data not shown). As previously shown, the N1N2 NLS directed nuclear accumulation of -galactosidase (Fig. 2A) (46). In the absence of an ATP-regenerating system, both IGFBP-3 and N1N2 NLS:-gal were localized to the cytoplasm, being generally excluded from the nucleus (Fig. 2B). A requirement for ATP in NLS-dependent nuclear import has been described for a number of proteins (26, 42).

View larger version (71K): [in this window] [in a new window]   Fig. 2.   Nuclear import of IGFBP-3 is an energy-dependent process mediated by the importin- subunit. Digitonin-permeabilized CHO cells were incubated with IGFBP-3 and N1N2 NLS:-gal (a control for the conventional importin /-mediated nuclear import pathway directed by a bipartite NLS) and visualized by CLSM. In vitro nuclear transport (see "Experimental Procedures") was carried out in the presence of cytosol and an ATP-regenerating system (A). The effect on nuclear transport of omitting the ATP-regenerating system (B) or cytosol (C) was examined. Transport studies were also carried out in the presence of an anti-importin- antibody without the addition of cytosol (D) and following preincubation of cytosol with the nonhydrolyzable GTP analogue GTPS (E). Images are representative of at least three independent experiments. Scale bar, 50 µm.

When cytosolic proteins (in the form of RRL) were omitted from the transport solution, the pattern of nuclear accumulation of IGFBP-3 (Fig. 2C) was indistinguishable from that seen in its presence (Fig. 2A). Therefore, in contrast to N1N2 NLS:-gal, which demonstrated cytosol-dependent nuclear transport (Fig. 2C), nuclear import of IGFBP-3 was independent of exogenously added cytosol. Previous studies have shown that although importin  is released following treatment of cells with digitonin, sufficient importin  may remain to sustain basal nuclear import (12, 47, 48). Therefore, the independence of nuclear uptake of IGFBP-3 on cytosolic factors suggests that importin  is not required for nuclear import, whereas the possibility remains that importin  may act alone as the transport receptor for IGFBP-3. NLS-dependent nuclear import, where the transported protein binds directly to importin  independently of importin , has been documented for a number of proteins (23-25, 49).

Nuclear import of IGFBP-3 was examined following neutralization of importin  from the assay by the addition of an anti-importin  antibody in the absence of RRL. Results showed a significant reduction in the level of nuclear import of both IGFBP-3 and N1N2 NLS:-gal (Fig. 2D). Because no importin  was added to the system in this experiment, the results suggest that importin  is unlikely to have a role in IGFBP-3 nuclear import. In a similar experiment where RRL was preincubated with the anti-importin  antibody prior to addition to the assay, nuclear import of IGFBP-3 was also reduced (data not shown). The role of GTP hydrolysis in nuclear transport of IGFBP-3 was examined following preincubation of the cytosol with the nonhydrolyzable GTP analogue, GTPS. Again nuclear accumulation of both IGFBP-3 and N1N2 NLS:-gal was reduced in the presence GTPS (Fig. 2E), with the pattern of IGFBP-3 labeling similar to that observed for cells treated with the anti-importin  antibody (Fig. 2D). These results suggest that nuclear accumulation of IGFBP-3 is an active process with a requirement for both importin  and GTP hydrolysis in its nuclear transport and appears to be independent of importin . In addition, because some nuclear uptake of IGFBP-3 remains (Fig. 2D), other uptake/accumulation mechanisms may be operating in addition to that utilizing importin . Although the cytosol-independent nature of IGFBP-3 nuclear import implies that a role for Ran is unlikely, other GTP-binding proteins may be involved in nuclear protein import, and the action of these proteins may constitute the basis of the inhibition of IGFBP-3 nuclear import by GTPS. Alternatively, Ran may not have been fully depleted from the transport assay following permeabilization of the cells.

Nuclear Accumulation of IGFBP-3 Is Prevented When the Putative NLS Is Mutated or Lost by Proteolytic Cleavage-- We have previously shown that the mutant, IGFBP-3[²²⁸KGRKR  MDGEA], obtained by exchanging part of the putative NLS of IGFBP-3 for the corresponding sequences in IGFBP-1, is not transported to the nucleus of intact cells (35). However, we have also shown that this IGFBP-3 mutant is unable to bind at the cell surface (38), leading to the speculation that transport to the nucleus may be blocked at the level of the plasma membrane rather than at the level of entry into the nucleus. To address this issue, we compared nuclear uptake of wild-type and mutant IGFBP-3 (in cells were the plasma membrane had been permeabilized) using the fully reconstituted in vitro nuclear transport assay. In contrast to wild-type IGFBP-3 (Fig. 3A), the mutant, IGFBP-3[²²⁸KGRKR  MDGEA], was not localized to the nucleus (Fig. 3B), suggesting that residues 228-232 within the basic region of IGFBP-3 are indeed required for nuclear accumulation as well as plasma membrane binding.

View larger version (54K): [in this window] [in a new window]   Fig. 3.   Nuclear accumulation of IGFBP-3 is prevented when the putative NLS is mutated or lost by proteolytic cleavage. Nuclear transport of wild-type IGFBP-3 (A) was compared with the mutant IGFBP-3[228KGRKR  MDGEA] (B) and a 30-kDa N-terminal proteolytic fragment of IGFBP-3 (C). In vitro nuclear transport was carried out in digitonin-permeabilized CHO cells in the presence of a fully reconstituted transport system. Images were collected using CLSM and are representative of three independent experiments. Scale bar, 50 µm.

During an early round of purification of wild-type IGFBP-3, a 30-kDa proteolytic fragment was generated. The purified fragment was subject to N-terminal sequencing and shown to be an N-terminal fragment of IGFBP-3. It therefore lacks the basic region present in the C-terminal domain of the protein. When nuclear uptake was examined, this truncated form of IGFBP-3 did not accumulate in the nucleus (Fig. 3C). Therefore, with respect to nuclear transport, the proteolytic fragment behaved in a similar fashion to the mutant form of IGFBP-3, supporting the observation that sequences within the C-terminal domain are required for active nuclear transport.

IGFBP-3 Binds to Insoluble Nuclear Components-- In the presence of a permeabilized nuclear envelope, soluble proteins are able to pass freely between the cytoplasm and nucleus. Under these circumstances, nuclear accumulation occurs only if the protein binds to insoluble nuclear components (42). To investigate whether IGFBP-3 was capable of such interactions, we used the in vitro transport assay on cells where the nuclear envelope had been permeabilized with the detergent CHAPS. To demonstrate that CHAPS was effectively permeabilizing the nuclear envelope, experiments were carried in the presence of FITC-dextran (molecular mass, ~77 kDa). Under these conditions FITC-dextran distributes evenly between the nucleus and cytoplasm. In the presence of a fully reconstituted assay and the absence of a barrier to nuclear entry, nuclear accumulation of wild-type IGFBP-3 was observed (Fig. 4A). The same field of cells visualizing the FITC-dextran signal (Fig. 4B) showed that accumulation of IGFBP-3 only occurred in those cells with a perforated nuclear envelope. In contrast, N1N2 NLS:-gal did not accumulate in the nucleus, instead equilibrating between the nuclear and cytoplasmic compartments (data not shown). Nuclear accumulation of the mutant IGFBP-3[²²⁸KGRKR  MDGEA] was also examined following permeabilization of the nuclear envelope; under these conditions the mutant failed to accumulate in the nuclei of cells with a permeabilized nuclear envelope (Fig. 4, C and D). These results indicate that, in contrast to the conventional NLSs, the IGFBP-3 NLS contains sequences capable of conferring nuclear accumulation in the absence of an intact nuclear envelope, presumably through interaction with nuclear components.

View larger version (108K): [in this window] [in a new window]   Fig. 4.   IGFBP-3 binds to insoluble nuclear components. Following permeabilization of both the plasma membrane and the nuclear envelope, nuclear accumulation of wild-type IGFBP-3 (A) and the IGFBP-3 mutant, 228KGRKR  MDGEA (C) was examined in the presence of cytosol and an ATP-regenerating system. The distribution of FITC-dextran in the same field of cells is shown for wild-type (B) and mutant (D) IGFBP-3. Arrows indicate nonpermeabilized cells. The images were collected using CLSM and are representative of three independent experiments. Nuclear accumulation indicates binding to detergent-insoluble nuclear components. Scale bar, 50 µm.

The NLSs of IGFBP-3 and IGFBP-5 Are Capable of Targeting a Heterologous Protein to the Nucleus-- In a previous study we showed that both IGFBP-3 and IGFBP-5 are transported to the cell nucleus in intact cells (35). The ability of the putative NLS regions within IGFBP-3 and IGFBP-5 to target EGFP to the nucleus was examined by fusing these sequences to EGFP and expressing the resultant fusion protein in CHO cells. EGFP is a 27-kDa protein and as such is capable of passive diffusion into the nucleus (50). Nuclear accumulation occurs only if EGFP is fused to sequences that confer active nuclear import or nuclear binding. Transfected cells were scored in two categories: where the nuclear and cytoplasmic fluorescent intensity was equivalent (no nuclear accumulation) and where the nuclear signal was greater than the cytoplasmic signal (nuclear accumulation). Expression of EGFP alone resulted in only a small percentage of cells (7.3%) with a nuclear signal greater than that observed in the cytoplasm (Fig. 5A and Table II). However, expression of the wild-type IGFBP-3 NLS (residues 215-232) fused to EGFP resulted in 92.8% of cells where nuclear was greater than cytoplasmic intensity (Fig. 5B). Likewise, when the wild-type IGFBP-5 NLS (residues 201-218) was fused to EGFP, 96.9% of cells had accumulated EGFP in the nucleus (Fig. 5C). From this data we conclude that these 18-residue basic sequences within the C-terminal domains of IGFBP-3 and IGFBP-5 are sufficient for nuclear uptake of the binding proteins.

View larger version (90K): [in this window] [in a new window]   Fig. 5.   The basic regions of IGFBP-3 and IGFBP-5 direct the nuclear import of an heterologous protein. Plasmids expressing the native EGFP (A) and EGFP fused to the putative NLSs of IGFBP-3 (B) or IGFBP-5 (C) were transiently transfected and expressed in CHO cells and visualized by fluorescent microscopy. Likewise, EGFP fused to the corresponding 18-amino acid region of IGFBP-3 containing the mutation 228KGRKR  MDGEA (D) and this region of IGFBP-5 containing the mutation 214RGRKR  MDGEA (E) were also expressed in CHO cells. Images are representative of at least four independent experiments. Scale bar, 25 µm.

To identify which residues within these sequences were necessary for nuclear accumulation, we mutated each of the three basic clusters within the NLS to the corresponding sequences in IGFBP-1 (a binding protein we have shown is not transported to the nucleus) and fused these mutant sequences to EGFP (Table II). The mutations ²¹⁶K  N^(BP-3) and ²⁰²K  N^(BP-5) did not affect nuclear transport of the fusion protein giving 83.3 and 89.3% of cells, respectively, with nuclear greater than cytoplasmic fluorescence; these values are not significantly different from those seen for the wild-type sequences. A more radical mutation of IGFBP-3 and IGFBP-5 within the first basic cluster, where both the basic residues were substituted with alanine, ²¹⁵KK  AA^(BP-3) and ²⁰¹RK  AA^(BP-5), had a significant effect on nuclear transport (Table II), suggesting that the sequence responsible for nuclear accumulation had a bipartite nature. The mutations ²²⁰KKK  HSR^(BP-3) and ²⁰⁶KRK  HSR^(BP-5) also had a significant effect on nuclear transport of the fusion protein giving 62.2 and 55.2% of cells, respectively, with nuclear greater than cytoplasmic signal. The mutations ²²⁸KGRKR  MDGEA^(BP-3) (Fig. 5D) and ²¹⁴RGRKR  MDGEA^(BP-5) (Fig. 5E) abolished nuclear accumulation of the fusion protein, giving 1.2 and 0.3% of cells, respectively, with nuclear greater than cytoplasmic fluorescence (Table II). As expected, a double mutation of the IGFBP-3 NLS, which involved the first and third basic cluster prevented nuclear transport of the fusion protein (Table II). Mutation of both the first and second basic clusters resulted in a further decrease in nuclear transport (40.3%) of the fusion protein compared with the central mutant alone (62.2%). Together these results suggest that the sequences ²²⁸KGRKR^(BP-3) and ²¹⁴RGRKR^(BP-5) are essential for nuclear import of the binding proteins but that the other basic residues within the NLS probably contribute to the overall efficiency of nuclear accumulation.

IGFBP-3 and IGFBP-5 Are Recognized by the Importin / Heterodimer through the Importin  Subunit-- The  and  importin subunits constitute the high affinity NLS receptor used by many proteins to effect their nuclear import (12). The ability of full-length IGFBPs to be recognized by importin subunits was examined using dot blot (Fig. 6A) and Western ligand binding analysis (Fig. 6B) (43) to examine interactions of native and denatured binding proteins, respectively. Wild-type IGFBP-3 showed strong binding by the importin complex (Fig. 6, A, lane 6, and B, top panel). This binding was of a similar intensity to that obtained for the T-ag NLS:-galactosidase fusion protein (positive control) (Fig. 6A, lane 2). In contrast, the NLS mutant, IGFBP-3[²²⁸KGRKR  MDGEA], displayed weaker binding by the importin / heterodimer NLS (Fig. 6, A, lane 5, and B, top panel) compared with wild-type IGFBP-3. However, this binding appeared to be stronger than that obtained for -galactosidase, which does not contain an NLS (negative control) (Fig. 6A, lane 1). Of the other binding proteins tested, IGFBP-5 was also recognized by the importin heterodimer (Fig. 6B, top panel). IGFBP-1 and IGFBP-2, which are not translocated to the nucleus in intact cells (35), showed no detectable binding by the importin complex (data not shown).

View larger version (25K): [in this window] [in a new window]   Fig. 6.   IGFBP-3 and IGFBP-5 are recognized by the importin / heterodimer through the importin  subunit. IGFBPs and controls were applied directly to membrane (A) or separated on 10% SDS-polyacrylamide gel electrophoresis prior to membrane transfer (B) and hybridization with a complex of importin / (A and B, top panels) or individual importin subunits (B, middle and bottom panels). The amount of protein added is indicated as pmol (A) or µg (B), and the positions of molecular mass markers are indicated. Control proteins were -galactosidase (negative control) (A, lane 1) and the T-ag NLS fused to -galactosidase (positive control) (A, lane 2). The binding proteins analyzed were wild-type IGFBP-3 (A, lane 6, and B, lanes 1 and 2), the IGFBP-3 NLS mutant, 228KGRKR  MDGEA (A, lane 5, and B, lanes 3 and 4) and wild-type IGFBP-5 (B, lanes 5 and 6). An equimolar amount of IGF-I was preincubated with either wild-type (A, lane 4) or the mutant form of IGFBP-3 (A, lane 3) prior to membrane application. Quantitation of the Western ligand blot was carried out using a Fujifilm FLA-3000 Imager and the Image Gauge software (C), where the mean signal intensities ± S.E. (n = 4) for importin  and importin  are expressed as percentages of those for binding by importin /.

Because IGFBP-3 has been shown to act as a carrier for IGF-I nuclear transport (34), we investigated whether the binary complex would bind more strongly to the importin subunits. However, when equimolar amounts of IGFBP-3 and IGF-I were equilibrated and subjected to dot blotting, there was no discernible difference in binding of either wild-type (Fig. 6A, lane 4) or mutant IGFBP-3 (Fig. 6A, lane 3) to the importin complex compared with these proteins in the absence of IGF-I (Fig. 6A, lanes 5 and 6). In addition, when IGF-I was added to the hybridization mix containing importin /, there was no change in the binding of importin to wild-type or mutant IGFBP-3 analyzed by Western ligand binding (data not shown).

Because nuclear transport of IGFBP-3 appears to be mediated by importin  (independently of importin ), we examined whether the observed importin / heterodimer binding was mediated by the importin  (Fig. 6B, middle panel) or  (Fig. 6B, bottom panel) subunit. The Western ligand binding assay clearly showed that IGFBP-3 and IGFBP-5 were both recognized by importin  (Fig. 6B, bottom panel). In contrast, neither binding protein was recognized to any great extent by importin  (Fig. 6B, middle panel), nor did mutant IGFBP-3 exhibit significant binding to either importin subunit (Fig. 6B, middle and bottom panels). Quantitation of binding indicated that, in the case of IGFBP-3, importin  binding accounted for almost 40% of the binding of the importin heterodimer (Fig. 6C). Although importin  binding to IGFBP-3 represented only a small proportion of importin / binding, it was still an appreciable amount compared with importin  binding only. However, in the case of IGFBP-5, importin  binding accounted for essentially all of the binding of the importin heterodimer (Fig. 6C). The mutant form of IGFBP-3 displayed less than 50% binding to the importin / heterodimer and the individual importin subunits, compared with wild-type IGFBP-3. It was concluded that importin , but not importin , was able to recognize IGFBP-3 and IGFBP-5 and that there appeared to be a quantifiable difference in importin subunit binding to these IGFBPs.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

This study identifies an 18-amino acid region of IGFBP-3 and IGFBP-5 that is necessary and sufficient for nuclear transport and accumulation. Our results suggest that nuclear import of IGFBP-3, and probably by analogy IGFBP-5, is an energy-dependent process mediated by importin  and following nuclear entry, IGFBP-3 can actively accumulate through binding to detergent-insoluble nuclear components. Mutation of the basic regions within the C-terminal domain of IGFBP-3 and IGFBP-5 attenuates nuclear import and/or accumulation and, as shown for IGFBP-3, reduces importin binding.

We have studied nuclear transport of IGFBP-3 using an in vitro nuclear transport assay that allows the role of individual components of the transport system to be examined. As a control, we examined the nuclear uptake of -galactosidase fused to the N1N2 bipartite NLS (46). In the presence of cytosolic factors and an ATP-regeneration system, full-length wild-type IGFBP-3 was capable of nuclear uptake in all cells where the plasma membrane had been permeabilized, but the nuclear envelope remained intact. Previous studies in intact cells have shown that nuclear transport of IGFBP-3 is detected only in a low percentage of cells in the monolayer (33-36). Therefore, these data suggest that the plasma membrane is an important regulator of nuclear uptake of IGFBP-3 and consequently also of its subsequent function in the nucleus.

Nuclear protein import directed by bipartite NLSs conventionally requires cytosolic factors such as importin /, Ran, and nuclear transport factor 2 (44). However, we show here that nuclear transport of IGFBP-3 can occur efficiently in the absence of added soluble transport factors. Analogous observations have been reported for nuclear transport conferred by the HIV-I Tat NLS (26) and the heterogeneous nuclear ribonucleoprotein (hnRNP) K sequence KNS (28). The Wnt signal transduction pathway component -catenin (27), which appears to be able to bind directly to nucleoporins, similarly appears not to require soluble factors for nuclear import; interestingly, nuclear transport of -catenin appears to occur through a Ran-independent pathway (51). However, unlike IGFBP-3, the targeting signals of Tat and hnRNP K represent novel nuclear targeting signals not resembling the T-ag or bipartite NLSs and, furthermore, do not appear to be recognized by importin /. Previous studies have found that sufficient importin , but not importin , may remain associated with the nuclear pore complex to support a basal level of nuclear import subsequent to digitonin permeabilization (12, 47, 48). Therefore, nuclear import in the absence of added cytosol suggests that the adapter, importin , is not required for nuclear transport but does not rule out the possibility that importin  alone is mediating uptake. Our findings that inclusion of an antibody specific to importin , both in the presence and absence of added cytosol, inhibited nuclear import of IGFBP-3, suggests that importin , but not importin , is required to sustain basal nuclear import. Similarly, addition of the nonhydrolyzable GTP analogue, GTPS, to the transport assay significantly reduced nuclear import of IGFBP-3. Together these results suggest that both importin  alone, and GTP hydrolysis are required for efficient transport. Importin  appears to be the sole nuclear targeting signal receptor used by parathyroid hormone-related protein (24), T-cell protein tyrosine phosphatase (25), and the yeast transcription factor, GAL4 (23). Finally, we cannot exclude the possibility that the cytosolic-independent nature of IGFBP-3 nuclear import is effected by other factors that, like importin , may not be completely solubilized during digitonin permeabilization.

Nuclear import mediated by conventional NLSs such as those found in T-ag and retinoblastoma (42), as well as by novel NLSs of HIV-I Tat (26) and the hnRNP K (28) and hnRNP A1 M9 sequences (52), has been shown to be ATP-dependent; cytosolic factor-independent nuclear import of -catenin has also been shown to require ATP (27). In the case of HIV-I Tat, ATP hydrolysis is believed to effect its release from cytoplasmic retention factors and enhance binding to nuclear components. Because nuclear import of IGFBP-3 was not observed in the absence of an ATP-regenerating system, IGFBP-3 may also require ATP for cytoplasmic release and/or enhanced nuclear binding. Alternatively, as is the case for many proteins transported to the nucleus, ATP may be involved in other, unknown actions that augment nuclear uptake.

In the presence of a permeabilized nuclear envelope, proteins are free to diffuse between the cytoplasmic and nuclear compartments and are only able to accumulate in the nucleus through binding to insoluble nuclear components such as chromatin and lamin (42). Under conditions where the nuclear envelope was permeabilized, IGFBP-3, but not the mutant, IGFBP-3[²²⁸KGRKR  MDGEA], was capable of nuclear accumulation. These results support the proposal that, upon entry into the nucleus, IGFBP-3 accumulates through nuclear binding and suggest that residues 228-232 are required for these nuclear interactions. The ability of IGFBP-3 to bind to structures within the nucleus supports the hypothesis that it may have a role in the nucleus, possibly in direct regulation of gene transcription (33-36). This has been suggested for granzyme A and B (53, 54) and parathyroid hormone-related protein (24), which can also accumulate in the nucleus even in the absence of an intact nuclear envelope.

Fusion of EGFP to isolated motifs has been used to study changes in subcellular distribution directed by these sequences (50). Using this approach, we investigated the role of the basic motifs of IGFBP-3 and IGFBP-5 in their nuclear transport. As the fusion proteins are expressed in living CHO cells, the proteins, factors and metabolic pathways present and active in living cells are able to exert their effects on nuclear transport, thus representing an in vivo nuclear transport assay. EGFP is small enough to enter the nucleus by passive diffusion, and as expected, the fluorescent signal derived from recombinant EGFP expressed in CHO cells was evenly distributed between the nucleus and cytoplasm. Fusion of the basic region within the C-terminal domain of IGFBP-3 and IGFBP-5 to EGFP caused nuclear accumulation of the fusion protein in greater than 90% of transfected cells, indicating that the basic regions are sufficient for nuclear import. However, these results do not distinguish between active nuclear transport and nuclear binding. Thus, there may be passive diffusion into the nucleus followed by accumulation resulting from interaction between these basic sequences and nuclear binding sites, as well as interaction of the basic residues with importins, leading to active nuclear import.

Mutation of the three basic clusters within the putative NLS of IGFBP-3 and IGFBP-5 caused different degrees of attenuation of nuclear transport of the EGFP fusion proteins. As was observed for the mutant form of full-length IGFBP-3, ²²⁸KGRKR  MDGEA, the same mutation of both the IGFBP-3 and IGFBP-5 NLS when fused to EGFP, abolished nuclear uptake of EGFP. Mutation of both amino acids within the N-terminal basic cluster had a significant effect on nuclear transport of the EGFP fusion proteins, suggesting that the basic region may represent a classical bipartite NLS similar to that described for other proteins (9, 21). However, mutation of the central basic cluster reduced nuclear transport of the fusion proteins by approximately 60%, implying that these basic clusters also influence nuclear accumulation and that the NLS is more complex than a classical bipartite NLS. As discussed above, the ability of the fusion protein to diffuse freely into the nucleus means that a distinction cannot be drawn between enhancement of nuclear import and accumulation because of nuclear binding. Therefore, mutations affecting nuclear transport may relate to either or both effects. However, in vitro studies on the mutant, IGFBP-3[²²⁸KGRKR  MDGEA], suggest these sequences are involved in both effects. In this assay the basic sequences derived from IGFBP-5 behaved identically to those derived from IGFBP-3, suggesting that IGFBP-5, which is small enough to diffusion through the nuclear pore complex (molecular mass, 30 kDa), accumulates in the nucleus by a similar mechanism.

We found that the importin  subunit recognized both wild-type IGFBP-3 and IGFBP-5 but recognized only to a limited extent the mutant form of IGFBP-3. This suggests that transport of these binding proteins occurs by a signal-mediated pathway, consistent with the observation that importin  is required to effect in vitro nuclear transport of IGFBP-3. Interestingly, all the importin / binding to IGFBP-5 could be accounted for by importin  binding, whereas for IGFBP-3 importin  binding appeared significantly lower compared with its binding to the heterodimer. This was not compensated for by an appropriate increase in importin  binding. The explanation for this is unclear but may relate to differing affinities or accessibility of the binding proteins for the importin subunits. Alternatively, importin  may be binding to importin  in this assay and increasing the strength of its interactions with IGFBP-3. However, an essential role for importin  in IGFBP-3 nuclear transport is not supported by our findings that nuclear import occurs in the absence of exogenous cytosol.

An interesting question raised by this study is why IGFBP-5, and to a lesser extent IGFBP-3, possess functional NLSs when, because of their size, they have the potential to diffuse from the cytoplasm into the nucleus. There are several reasons why smaller proteins possess NLS-dependent mechanisms for nuclear import. As has been described for interleukin-5 (55), a functional NLS enables the cotransport of larger non-NLS containing proteins to the nucleus. In analogous fashion, IGFBP-3 or IGFBP-5 may possess functional NLSs to facilitate entry when part of a high molecular mass complex. Thus, they may require an NLS-dependent mechanism when cotransporting IGFs or other signaling molecules to the nucleus. Interestingly, a preliminary report suggests that IGFBP-3 interacts specifically with the retinoic acid X receptor- (56). IGFBP-3 may thereby modulate the activity of nuclear transcription factors or have a specific signal transduction role in the nucleus. It may also regulate gene expression directly by binding to chromatin as has been reported for basic fibroblast growth factor (57) and the growth hormone receptor (58). Apart from the selective use of an NLS-dependent mechanism for the transport of high molecular mass complexes, the kinetics of nuclear import of IGFBP-3 and IGFBP-5 may be enhanced by their ability to interact effectively with importin. A major focus of future work in this laboratory is to distinguish between these possibilities. Understanding of the mechanisms of nuclear import of IGFBP-3 and IGFBP-5 should greatly assist in defining their nuclear functions.

	ACKNOWLEDGEMENTS

We thank Drs. Phil Poronnik and David Cook for providing the adenoviral system for expression of wild-type and mutant IGFBP-3. We also thank Prof. Jürgen Zapf (Zürich, Switzerland) for providing the recombinant human IGFBP-5 used in this study and Chenoa Barton for skilled technical assistance. This research has been facilitated by access to the Australian Proteome Analysis Facility.

	FOOTNOTES

^* This work was supported by the Sydney University Medical Foundation and the National Health and Medical Research Council. The CLSM was purchased with the support of the Wellcome Trust.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence should be addressed: Kolling Inst. of Medical Research, Royal North Shore Hospital, St. Leonards, New South Wales 2065, Australia. Tel.: 61-2-9926-8486; Fax: 61-2-9926-8484; E-mail: lyns@med.usyd.edu.au.

Published, JBC Papers in Press, May 12, 2000, DOI 10.1074/jbc.M002208200

	ABBREVIATIONS

The abbreviations used are: IGF, insulin-like growth factor; IGFBP, insulin-like growth factor-binding protein; NLS, nuclear localization signal; T-ag, SV40 large tumor antigen; N1N2 NLS:-gal, -galactosidase fused to the NLS derived from N1N2; RRL, rabbit reticulocyte lysate; CLSM, confocal laser scanning microscopy; EGFP, enhanced green fluorescent protein; hnRNP, heterogeneous nuclear ribonucleoprotein; FITC, fluorescein isothiocyanate; GTPS, guanosine 5'-O-(3-thiotriphosphate); CHAPS, 3-[(3-cholamidopropyl)-dimethylammonio]-1-propane-sulfonate; BSA, bovine serum albumin; CHO, Chinese hamster ovary.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES