JBC Oz Biosciences

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M001381200 on May 17, 2000

J. Biol. Chem., Vol. 275, Issue 31, 23627-23635, August 4, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/31/23627    most recent
M001381200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Íñiguez, M. A.
Right arrow Articles by Fresno, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Íñiguez, M. A.
Right arrow Articles by Fresno, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

An Essential Role of the Nuclear Factor of Activated T Cells in the Regulation of the Expression of the Cyclooxygenase-2 Gene in Human T Lymphocytes*

Miguel A. Íñiguez, Sara Martínez-Martínez, Carmen Punzón, Juan Miguel Redondo, and Manuel FresnoDagger

From the Centro de Biología Molecular, Consejo Superior de Investigaciones Científicas, Universidad Autónoma de Madrid, Cantoblanco, E-28049 Madrid, Spain

Received for publication, February 18, 2000, and in revised form, May 4, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have previously reported that transcriptional induction of cyclooxygenase-2 (COX-2) isoenzyme occurs early after T cell receptor triggering, suggesting functional implications of cyclooxygenase activity in this process. Here, we identify the cis-acting elements responsible for the transcriptional activation of this gene in human T lymphocytes. COX-2 promoter activity was induced upon T cell activation both in primary resting T lymphocytes and in Jurkat cells. This induction was abrogated by inhibition of calcineurin phosphatase with the immunosuppressive drug cyclosporin A, whereas expression of an active calcineurin catalytic subunit enhanced COX-2 transcriptional activation. Moreover, cotransfection of nuclear factor of activated T cells (NFAT) wild type protein transactivated COX-2 promoter activity. Conversely, dominant negative mutants of NFATc or c-Jun proteins inhibited COX-2 induction. Electrophoretic mobility shift assays and site-directed mutagenesis allowed the identification of two regions of DNA located in the positions -117 and -58 relative to the transcriptional start site that serves as NFAT recognition sequences. These results emphasize the central role that the Ca2+/calcineurin pathway plays in COX-2 transcriptional regulation in T lymphocytes pointing to NFAT/activator protein-1 transcription factors as essential for COX-2 promoter regulation in these cells.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Prostaglandin endoperoxide synthase or cyclooxygenase (COX)1 is the enzyme responsible for the conversion of arachidonic acid to prostaglandin H2, the main step in the prostaglandin synthesis pathway. Two forms of the enzyme, named COX-1 and COX-2, have been shown to be expressed in mammalian tissues. COX-1 is considered a housekeeping enzyme constitutively expressed in most tissues, whereas the COX-2 isoform is induced by several stimuli including cytokines and mitogens and is thought to be responsible for the increased production of prostaglandins in pathologic processes (reviewed in Refs. 1-3). Promoter regions of the COX-2 gene of mouse (4), rat (5), chicken (6), and humans (7-9) have been cloned. Regardless of the animal species, these promoters contain a classical TATA box, an E-box, and binding sites for transcription factors such as nuclear factor kappa B, nuclear factor-IL6/CCAAT-enhancer binding protein), and cyclic AMP-response element (CRE) -binding proteins. These sequences have been shown to act as positive regulatory elements for the COX gene transcription in different cell types (5, 10-14). We have recently shown that COX-2 expression is induced in T cells upon T cell receptor (TCR) activation playing an important role in controlling this process (15). However, no studies about COX-2 promoter regulation in these cells have been reported so far.

Activation of T cells triggers a complex regulatory cascade of events that culminates in the induced transcription of a variety of activation-associated genes (16-18). Many of them are cytokines that in turn regulate cell proliferation, differentiation, and acquisition of effector functions by cells of the immune system. The signal transduction pathways involved in T cell activation include those mediated by calcium and protein kinase C (PKC) that contribute to the induction and activation of several transcription factors including nuclear factor kappa B, AP-1, NFAT and octamer binding factors, known to regulate cytokine gene expression (19). The rise in intracellular calcium triggered by antigen binding to the TCR·CD3 complex leads to the activation of calcineurin phosphatase activity, which dephosphorylates cytoplasmic members of the NFAT family of transcription factors (20-23). Dephosphorylated NFAT proteins enter the nucleus and interact with Fos and Jun family members to cooperatively bind to and transactivate NFAT sites (24, 25). This process of T cell activation and transcription of cytokine genes is blocked by inhibition of calcineurin phosphatase activity by the immunosuppressive drug cyclosporin A (CsA) (26-28).

Here we have analyzed the regulation of COX-2 gene expression in human T cells, showing that COX-2 promoter activity was induced upon T cell activation in a CsA-sensitive manner. Conversely, expression of a calcineurin constitutively active catalytic subunit increased promoter activity. Further analysis involved NFAT and AP-1 transcription factors in the regulation of COX-2 expression. Finally, we localized two NFAT binding sites in the -117 and -81 positions from the transcription start site required for induction of COX-2 promoter activity. These results indicate that Ca2+/calcineurin and PKC/AP-1 signaling transduction pathways are essential for induction of COX-2 gene expression in T cells.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture and Reagents-- The Jurkat human leukemic T cell line was cultured in RPMI medium supplemented with 10% fetal bovine serum and 2 mM glutamine and antibiotics. Purified human peripheral blood T lymphocytes (PBTs) were obtained as described previously (15) from partially purified human blood by the Ficoll-Hypaque gradient. The peripheral blood lymphocyte fraction was plated, and a not adherent population was passed through a nylon fiber wool column. Cells were collected and resuspended in RPMI plus 10% fetal bovine serum and 2 mM L-glutamine and antibiotics. The purity of the PBT population, detected by flow cytometry, was always greater than 95% CD3+ cells. Cells were stimulated by phorbol 12-myristate 13-acetate (PMA; Sigma) at 15 ng/ml and/or A23187 calcium ionophore (Ion; Sigma) at 1 µM. CsA (Sandoz) (100 ng/ml) was added 1 h before the addition of PMA and Ion.

Plasmid Constructs-- Human COX-2 promoter constructs were generated by cloning BamHI-BglII-flanked PCR products derived from Jurkat genomic DNA into the BglII-digested pXP2LUC reporter plasmid (29). An unique reverse primer starting from +104 bp was used for PCR amplification (5'-gggagatctGGTAGGCTTTGCTGTCTGAGG-3'). Different forward primers lying in the 5'-region of the transcription start site of the promoter were used to obtain the deletion constructs: -1796, 5'-gggggatccGGATTCTAACATGGCTTCTAACCC-3'; -998, 5'-gggggatccTTACCAGTATCTCCTATGAAGGGC-3'; -521, 5'-gggggatccCCAGTCTGTCCCGACGTGACTTCC-3'; -327, 5'-gggggatccGCGCTCGGGCAAAGACTGCGAAG-3'; -170, 5'-gggggatccCTCATTTCCGTGGGTAAAAAACCC-3'; -88, 5'-gggggatccGGTACGAAAAGGCGG-3'; -46, 5'-gggggatccGCTTGGTTTTCAGTC-3'. The sequence of all PCR-derived constructs was confirmed by fluorescent automatic sequencing (Centro de Biología Molecular, DNA facility, Madrid, Spain).

The Delta CAM-AI plasmid encoded a deletion mutant of a murine calcineurin catalytic subunit (27). The IL-2-LUC plasmid containing the region -326 to +45 of the human IL-2 promoter (30), the full-length human NFATc (p1SH107c), and the dominant negative NFATc (pSH102CDelta 418) expression plasmids (31) were generously provided by G. Crabtree. The pCMV-TAM67 plasmid encoding a dominant negative mutant variant of c-Jun (32) was a gift of C. M. Zacharchuck.

mRNA Analysis-- Total RNA was prepared from Jurkat T cells by the TRIzol reagent RNA protocol (Life Technologies, Inc.). Total RNA (1 µg) was reverse transcribed into cDNA and used for PCR amplification with either human COX-2, or glyceraldehide-3-phosphate dehydrogenase specific primers by the RNA PCR core kit (Perkin-Elmer) as described previously (15). Briefly, the PCR reaction was amplified by 20-35 cycles of denaturation at 94 °C for 1 min, annealing at 60 °C for 1 min, and extension at 72 °C for 1 min. Amplified cDNAs were separated by agarose gel electrophoresis and bands visualized by ethidium bromide staining. The data shown correspond to a number of cycles where the amount of amplified product is proportional to the abundance of starting material.

Transfection and Luciferase Assays-- Transcriptional activity was measured using luciferase reporter gene assays in transiently transfected Jurkat cells or PBTs. Jurkat cells were transfected by Lipofectin reagent as recommended by the manufacturer (Life Technologies, Inc.). Briefly, exponential growing cells (1.5 × 106) were incubated for 8 h at 37 °C with a mixture of 1.5 µg/ml of the correspondent reporter plasmid and 3 µg/ml Lipofectin in 1 ml of Opti-MEM. In cotransfection experiments, 0.15-1.5 µg/ml of the correspondent expression plasmid was included. The total amount of DNA in each transfection was kept constant by using the corresponding empty expression vectors. Cells were then resuspended in complete medium and incubated at 37 °C an for additional 16 h. PBT transfection was performed by electroporation at 320 V and 1500 microfarads with a Bio-Rad Gene Pulser II (Bio-Rad). For electroporation, cells were resuspended at 1 × 107 cells/0.5 ml in complete medium with 10 µg of plasmid DNA. After electroporation cells were cultured in fresh medium at 37 °C for 16 h. Transfected cells were exposed to different stimuli as indicated. Then, cells were harvested and lysed. Luciferase activity was determined by using a luciferase assay kit (Promega) with a luminometer Monolight 2010 (Analytical Luminescence Laboratory, San Diego, CA). Transfection experiments were performed either in duplicate or triplicate. The data presented are expressed as the mean of the determinations in relative luciferase units (RLUs) ± S.D. A representative experiment from the several performed is shown in all cases.

Site-directed Mutagenesis-- In vitro-directed mutagenesis was performed by the QuickChange site-directed mutagenesis kit (Stratagene). Synthetic oligonucleotide primers containing the desired mutation and complementary to opposite strands of the corresponding COX-2 promoter constructs were extended by using Pfu turbo DNA polymerase, generating a mutated plasmid: COX-2 dNFAT mutant primer 5'- GGGGAGAGGAGttAAcAATTTGTGGGGGGTACG-3', COX-2 pNFAT mutant primer 5'- GGGGTACGAAAAGGCGtctAGAAACAGctgTTTCGTCACATGGG -3', and COX-2 CRE mutant primer 5'- GAAACAGTCATTTgagCtCATGGGCTTGGTTTTCAG - 3'. The oligonucleotide 5'- GAAACAGctgTTTgagCtCATGGGCTTGGTTTTCAG- 3' was used to generate the double mutant P2-192 pNFAT and CRE-MUT by using the construct P2-192 pNFAT MUT as the template. Lowercase letters in the sequence of the primers indicate mutated positions. Mutagenesis of more than one site was done by subsequent mutation of the corresponding previously mutated construct. The nucleotide sequence of the mutants was confirmed by automatic DNA sequencing.

Electrophoretic Mobility Shift Assays-- Nuclear extracts from Jurkat cells unstimulated or stimulated with 15 ng/ml PMA plus 1 µM Ion were prepared as described previously (33). Cells were resuspended in 400 µl of ice-cold buffer A (10 mM HEPES, pH 7.6, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.75 mM Spermidine, 0.15 mM Spermine, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 10 mM Na2MoO4, 1 µg/ml pepstatin, and leupeptin and aprotinin at 2 µg/ml each). After 15 min on ice, cells were lysed with 0.6% (v/v) Nonidet P-40. The nuclear pellet was extracted with 50 µl of buffer C (20 mM HEPES, pH 7.6, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 10 mM Na2MoO4, 1 µg/ml pepstatin, and leupeptin and aprotinin at 4 µg/ml each). Nuclear extracts were collected and stored at -80 °C. Protein concentration was determined by the Bradford assay (Bio-Rad).

Gel retardation assays were performed as in Martínez-Martínez et al. (33). Nuclear extracts (3-5 µg) were incubated with 1 mg/ml of poly(dI-dC) in DNA binding buffer (2% (w/v) polivinyl ethanol, 2.5% (v/v) glycerol, 10 mM Tris, pH 8, 0.5 mM EDTA, 0.5 mM dithiothreitol on ice for 10 min. Then, 100,000 cpm of 32P-labeled double-stranded oligonucleotides was added and incubated at room temperature for 40 min. In competition experiments, a 20-fold molar excess of unlabeled oligonucleotides was added to the binding reaction mixture prior to the probe. Supershift assays were performed by incubating nuclear extracts with either preimmune serum or anti-all NFATs antisera prior to the addition of the probe. Anti-all NFATs 674 rabbit antiserum was raised against the synthetic peptide NH2- SDIELRKGETDIGRKNTRC coupled to carrier protein hemocyanin as described by Liu et al. (34). This peptide has been previously used to generate the anti-all NFATs 796 antiserum that efficiently recognized NFAT-1, -2, -3, and -4 members (35). DNA·protein complexes were resolved by polyacrylamide gel electrophoresis on a 4% nondenaturing gel. The sequences of the oligonucleotides (5' to 3') used were: gatcGGAGGAAAAACTGTTTCATACAGAAGGCGT (distal NFAT site of the human IL-2 promoter), CGCTTGATGAGTCAGCCGGGAA (AP-1 consensus oligonucleotide), ATTCGATCGGGGCGGGGCGAGC (SP-1 consensus oligonucleotide), tcgaCAAGGGGAGAGGAGGGAAAAATTTGTGGC (nucleotides -117 to -91 containing the putative NFAT distal site of the COX-2 promoter), tcgaCAAAAGGCGGAAAGAAACAGTCATTTC (nucleotides -82 to -58 including the putative NFAT/AP-1 proximal site of the COX-2 promoter).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Analysis of COX-2 Promoter Activity in T Cells-- We have previously shown that COX-2 gene expression is induced in T cells by stimuli resembling T cell activation such as TCR cross-linking or phorbol ester plus calcium ionophore treatment (15, 36). To further explore the transcriptional regulation of this gene, we studied the COX-2 promoter-driven transcription in transiently transfected Jurkat T cells and human PBTs. For this purpose we cloned a region spanning from -1796 to +104 bp relative to the transcription start site of the human COX-2 gene in the reporter plasmid pXP2 (P2-1900). As shown in Fig. 1A, luciferase activity of this construct was strongly up-regulated upon activation by PMA plus Ion, a treatment that mimics T cell activation. To map the regions responsible for this induction, subsequent 5'-deletions ranging from -998 down to -170 bp were generated. Although absolute values for basal activity of these constructs slightly varied, inducibility for all of them were similar. It was also noticeable that basal activity of a construct spanning -898 bp from the transcription start site of the COX-1 promoter (P1-1009) was not induced upon PMA plus Ion treatment (Fig. 1A).


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 1.   Analysis of COX-2 transcriptional activity in T cells. Jurkat cells or PBTs were transfected with the indicated COX-2 promoter constructs as described under "Experimental Procedures" and cultured in the absence (Control) or presence of PMA (15 ng/ml), Ion (1 µM), or both (PMA+Ion) for 16 h and assayed for luciferase activity. Results from duplicate assays were shown in RLUs ± S.D. Results are representative of at least three different experiments. A, luciferase activity of the full series of 5'-truncations ranging from -1796 to -170, the pXP2 promoterless vector, and the COX-1 promoter reporter vector (P1-1006) in Jurkat cells. Cis-acting consensus sequences are denoted by boxes. The extent of the 5'-truncations are shown with numbers indicating their length relative to the transcription start site. B, luciferase activity in Jurkat cells after PMA, Ion, or PMA + Ion treatment of the constructs P2-1900, P2-625 and P2-274. C, luciferase activity in human PBTs after PMA, Ion, or PMA + Ion treatment for the COX-2 promoter constructs P2-1900 and P2-274. D, reverse transcriptase-PCR analysis of COX-2 mRNA expression in T cells. Total RNA (1 µg) from Jurkat T cells was analyzed by reverse transcriptase-PCR to measure COX-2 and glyceraldehide-3-phosphate dehydrogenase mRNA levels. An aliquot of the amplified DNA was separated on an agarose gel and stained with ethidium bromide for qualitative comparison. Cells were cultured in the absence of stimuli (Control) or treated with PMA (15 ng/ml), Ion (1 µM), or PMA plus Ion, as indicated. CsA (100 ng/ml) was added 1 h prior to stimulation.

Combined treatment with PMA plus Ion was required to get the maximal induction (8-12-fold) of COX-2 promoter constructs in Jurkat T cells. PMA treatment alone led a 2-3-fold induction, whereas single treatment with calcium ionophore did not induce transcription from this promoter at all (Fig. 1B). Moreover, no differences were observed again among the different COX-2 promoter constructs. Similar results were obtained when these COX-2 promoter constructs were transfected in purified human resting T lymphocytes isolated from peripheral blood. As shown in Fig. 1C, luciferase activity of transfected constructs P2-1906 and P2-274 was induced by PMA or PMA plus Ion in purified T lymphocytes thus confirming the data obtained in the Jurkat T cell line in a more physiological setting.

To compare the regulation of the promoter with the expression of the endogenous gene in T cells, RNA isolated from Jurkat cells was analyzed by reverse transcriptase-PCR. Whereas PMA treatment slightly induced COX-2 expression, maximal induction occurred after PMA plus Ion treatment. However, treatment with Ion alone did not increase COX-2 expression (Fig. 1D). These results demonstrated that regulation of COX-2 promoter activity paralleled transcriptional activation of the endogenous gene in T cells.

Involvement of the Ca2+/Calcineurin Pathway in the Transcriptional Activation of COX-2 Promoter-- COX-2 mRNA induction was completely abolished by treatment with the immunosuppressive drug CsA in Jurkat T cells (Fig. 1D). To determine whether this CsA-mediated inhibition occurred by interference with the transcriptional activity of the human COX-2 promoter, we transfected T cells with the P2-1906 and P2-274 promoter constructs and analyzed their activity upon activation in the presence of CsA. Treatment with CsA abrogated induced luciferase activity of the P2-1900 and P2-274 promoter constructs both in Jurkat cells and PBTs (Fig. 2, A and B).


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 2.   Effects of CsA on the inducibility of the COX-2 promoter. (A) Jurkat cells or (B) human PBTs were transiently transfected with P2-1900 and P2-274 reporter constructs and stimulated with PMA (15 ng/ml) or PMA plus Ion (1 µM) in the presence or absence of CsA (100 ng/ml) for 16 h. Luciferase activity is expressed as the mean of triplicate determinations in RLUs ± S.D. Independent experiments yielded similar results.

The fact that COX-2 promoter activity was CsA-sensitive pointed to an involvement of the Ca2+/calmodulin phosphatase calcineurin, the major target of CsA, in the transcriptional induction of the COX-2 gene in T lymphocytes. Calcineurin is responsible for NFAT dephosphorylation and subsequently for the NFAT-dependent transactivation of genes (20-23, 37). To further confirm the role of calcineurin in the regulation of COX-2 expression, we cotransfected the P2-274 promoter construct along with an expression plasmid (Delta CAM-AI) encoding a deletion mutant of a murine constitutively active calcineurin catalytic subunit. Delta CAM-AI has been previously described to efficiently substitute the calcium signal for activation of NFAT-driven transcription. Cotransfection of Delta CAM-AI is sufficient to fully activate the IL-4 promoter that can be maximally induced by a calcium signal alone (38). Moreover, this mutant is able to act in synergy with PMA bypassing the calcium requirement for induction of NFAT-mediated transcription of the IL-2 promoter that requires costimulation of calcium and PKC-mediated signaling pathways for full activation (27). Cotransfection of Delta CAM-AI slightly induced P2-274 COX-2 promoter basal activity but strongly cooperated with PMA to activate the COX-2 promoter in a similar way as for the IL-2 promoter (Fig. 3).


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 3.   Calcineurin participates in the transcriptional induction of the COX-2 gene. Jurkat cells were transiently transfected with the P2-274 COX-2 promoter construct or the IL-2 LUC reporter plasmid plus empty vector or an expression vector for a catalytic subunit of calcineurin (Delta CAM-AI). Cells were stimulated with PMA or PMA plus Ion as described previously. CsA was added 1 h before stimulation. Data shown are the mean of replicate determinations expressed as RLUs ± S.D. Results are representative of two independent experiments.

Requirement of NFAT and AP-1 Transcription Factors in the Activation of the COX-2 Promoter in T Cells-- The above results indicate that COX-2 promoter regulation was very similar to that described for the IL-2 promoter because of the inhibition by CsA and the induction by calcineurin. It has been shown that two functional NFAT sites in the IL-2 promoter are essential for the calcineurin-mediated regulation of the expression of this gene (19, 37, 39). To tested whether NFAT might be important for the regulation of COX-2 promoter activity as well, we performed cotransfection experiments using an NFATc (NFAT2 and NFATc1) expression vector together with the P2-274 construct or the IL2-LUC reporter plasmid included as a control. In agreement with the proposed role of NFAT as a critical regulator of the IL-2 gene (31), overexpression of the NFAT protein efficiently transactivated the IL-2 promoter. Interestingly, COX-2 promoter activity was similarly enhanced by NFATc cotransfection (Fig. 4A). Moreover, cotransfection of Jurkat T cells with a dominant negative version of NFATc previously described to abolish IL-2 promoter activity (31) resulted in more than 90% inhibition of the induced activity of both the COX-2 and the IL-2 promoter (Fig. 4A), supporting the hypothesis that NFAT was required in the regulation of COX-2 gene expression in T cells.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 4.   Role of NFATc and c-Jun in the regulation of COX-2 promoter. Jurkat cells were cotransfected with the P2-274 construct or IL-2-LUC reporter plasmid plus empty vector, wild type (wt) NFATc expression vector, or dominant negative (dn) NFATc expression vector in A or dominant negative c-Jun expression plasmid (dn c-Jun) in B. Transfected cells were treated with PMA, PMA + Ion, or CsA as indicated. The means of replicate determinations expressed as luciferase activity in RLUs ± S.D. are shown. Results are representative of two independent experiments.

Because NFAT-dependent transcriptional activation of several promoters such as IL-2 requires the cooperation with AP-1 to efficiently drive transcription (37, 40), we next examined the role of AP-1 in the regulation of COX-2 promoter activity. For this purpose we used a dominant negative mutant version of c-Jun named TAM67 that lacks the transactivation domain. In agreement with previous work (32), co-expression of TAM67 in T cells markedly inhibited the induction of IL-2 promoter by PMA plus Ion (Fig. 4B). Similarly, cotransfection of the c-Jun dominant negative isoform in Jurkat cells along with the P2-274 reporter plasmid resulted in a clear suppression of COX-2 promoter inducibility by PMA plus Ion (Fig. 4B). These data supported the hypothesis that AP-1 transcription factors played an important role in PMA plus Ion-mediated transcriptional induction of the human COX-2 gene in T cells.

Identification of Functional NFAT Sites within the COX-2 Promoter-- To localize the minimal regions involved in the inducibility by PMA plus Ion of the COX-2 promoter, further 5'-deletions were created from the P2-274 construct (Fig. 5A). Deletion of a region of 83 bp generated the P2-192 construct, which displayed a reduced ability to be induced by PMA plus Ion both in Jurkat cells and PBTs. This induction was still abrogated with CsA treatment. However, a shorter construct (P2-150) could not be induced at all (Fig. 5, B and C). Thus, the regions between -170 to -88 and -88 to -46 might include sequences important for the CsA-sensitive induction of COX-2 promoter in T cells by PMA plus Ion. Sequence analysis of these regions revealed the presence of two putative NFAT cis-acting elements named COX-2 NFAT distal (COX-2 dNFAT) and COX-2 NFAT proximal (COX-2 pNFAT) elements. Both sequences contained the minimal GGAAA NFAT core consensus sequence. In addition, the COX-2 pNFAT element contained an adjacent AP-1-like site. Noteworthy, both regions were extremely conserved among human, rat, and mouse genomic sequences not only in nucleotide composition but also in their relative localization from the transcription start site (Fig. 6).


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 5.   Identification of cis-acting regions required for COX-2 promoter activation. A, deletions ranging from -88 to -46 bp relative to the transcription start site of the COX-2 promoter were obtained using the P2-274 construct as the parental vector. Cis-acting consensus sequences are denoted by boxes. The extent of the 5'-truncations are shown with numbers indicating their length relative to the transcription start site. Jurkat cells (B) or PBTs (C) were transfected with COX-2 promoter constructs P2-274, P2-192, and P2-150 and cultured in the absence or presence of PMA, PMA + Ion, and CsA as indicated and then assayed for luciferase activity. Assays were performed in duplicate, and the results are shown as RLUs ± S.D.


View larger version (43K):
[in this window]
[in a new window]
  		Fig. 6.   Comparison of the -117/-87 and -82/-58 nucleotide sequences of the human COX-2 5'-flanking region with those of rat and mouse genes. Uppercase letters indicate identical bases between human and rat or mouse sequences, whereas lowercase letters show aligned nonidentical bases. The boxed areas show comparison between NFAT and AP-1 consensus sequences and those corresponding for distal (COX-2 dNFAT) and proximal (COX-2 pNFAT) NFAT sites in the 5'-flanking sequence of the human COX-2 gene.

To analyze the functionality of these sequences as NFAT binding elements, we performed electrophoretic mobility shift assays with nuclear extracts of Jurkat T cells using DNA probes of this sites and of the distal NFAT site in the IL-2 gene for comparison. As expected, a retarded complex was resolved in nuclear extracts from Jurkat stimulated by PMA plus Ion with the IL-2 NFAT probe. This band was efficiently competed with a 20-fold molar excess of unlabeled IL-2 NFAT an AP-1 consensus oligonucleotides and also by both COX-2 NFAT proximal and distal oligonucleotides but not by an heterologous SP-1 consensus oligonucleotide (Fig. 7A). Moreover, both distal and proximal NFAT sequences of the COX-2 promoter bound proteins of nuclear extracts from PMA plus Ion-stimulated Jurkat cells. Efficient competition with cold COX-2 NFAT oligonucleotides and not with an unrelated sequence as the SP-1 consensus motif indicated the specificity of the complexes (Fig. 7, B and C). In addition, binding to the COX-2 NFAT probes was efficiently competed with an excess of cold oligonucleotides corresponding to the proximal NFAT site of the IL-2 promoter and, in the case of the COX-2 pNFAT site, by a consensus AP-1 response element oligonucleotide (Fig. 7C). However, AP-1 consensus oligonucleotides did not compete for the binding to the distal site, indicating the absence of proteins of the Jun and Fos family in this retarded band (Fig. 7B). Furthermore, these inducible complexes were severely diminished when nuclear extracts from cells stimulated in the presence of CsA were used (Fig. 7, B and C, lane 7).


View larger version (68K):
[in this window]
[in a new window]
  		Fig. 7.   Electrophoretic mobility shift assays of the COX-2 dNFAT and pNFAT probes. Nuclear extracts from Jurkat cells stimulated with PMA + Ion or pretreated with CsA were analyzed by electrophoretic mobility shift assay. The specific PMA + Ion-induced complexes are indicated by arrows. Gel shift assays were performed using oligonucleotides corresponding to: (A) the distal NFAT site of the IL-2 promoter, (B) the human COX-2 distal NFAT site (nucleotides -117 to -91), and (C) the human COX-2 proximal NFAT site (nucleotides -82 to -58). A 20-fold molar excess of unlabeled IL-2 NFAT, COX-2 dNFAT, COX-2 pNFAT, SP-1, and AP-1 consensus oligonucleotides was added to the binding reaction mixtures to determine the specific binding.

To unambiguously determine the presence of NFAT proteins in the retarded complex, we performed electrophoretic mobility shift assays with nuclear extracts from Jurkat cells and COX-2 NFAT probes in the presence of polyclonal antisera specific for NFAT-1, -2, -3, and -4 isoforms directed against a common epitope located in the DNA binding domain. As shown in Fig. 8, whereas the preimmune serum did not alter substantially the retarded complexes in samples with nuclear extracts of PMA plus Ion-treated cells, incubation with either the anti-all NFATs 796 or 674 antisera efficiently prevented the binding. These results demonstrate the binding of NFAT proteins to the COX-2 NFAT distal and proximal sites in response to PMA plus Ion treatment of T cells.


View larger version (104K):
[in this window]
[in a new window]
  		Fig. 8.   Serological analysis of the DNA·protein complexes bound to the COX-2 dNFAT and pNFAT probes. Nuclear extracts from Jurkat cells treated with PMA plus Ion were analyzed by electrophoretic mobility shift assay using oligonucleotide probes for (A) COX-2 dNFAT or (B) COX-2 pNFAT sites. Anti-all NFATs 796 or 674 antisera were added to the extracts prior to incubation with the probes. Retarded complexes are indicated by arrows.

To investigate the role that both COX-2 NFAT sites played in COX-2 induction, mutations were introduced into each of these sites (Fig. 9). Transient transfections with the P2-274 promoter construct containing either COX-2 dNFAT or pNFAT sites mutated showed around 40-50% loss in the inducibility by PMA plus Ion, whereas mutation of both sites resulted in more than 80% reduction (Fig. 9). These results were consistent with the observed inducible response of the P2-192 construct, which lacks the entire dNFAT site (around 40% of P2-274). Consistently, mutation of the remaining pNFAT site in P2-192 further decreased the inducibility by PMA plus Ion to the levels observed with the P2-274 double mutant. These results clearly indicated that both COX-2 distal and proximal NFAT sites significantly contributed to the activation of the human COX-2 promoter in T cells. To determine the possible contribution of the CRE element to the induction of the COX-2 promoter, CRE mutant constructions were generated. As shown in Fig. 9, mutation of this site did not significantly alter the induction of COX-2 promoter by PMA + Ion in T cells.


View larger version (35K):
[in this window]
[in a new window]
  		Fig. 9.   Mutational analysis of the NFAT sites in the COX-2 promoter region. A, sequences of the oligonucleotides used for site-directed mutagenesis of the NFAT distal (COX-2 dNFAT-MUT) and proximal (COX-2 pNFAT-MUT) sites corresponding to regions -115 to -83 or -90 to -47 of the human COX-2 promoter. Bases mutated in the NFAT-MUT oligonucleotides are indicated by lowercase letters. B, Jurkat T cells were transiently transfected with COX-2 promoter constructs P2-274, P2-192, and same constructs containing dNFAT, pNFAT, and/or CRE sites mutated. Cells were cultured in the absence or presence of PMA + Ion and then assayed for luciferase activity. Assays were performed in triplicate and results are shown as RLUs ± S.D.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Recently, we have demonstrated that COX-2 is transcriptionally up-regulated in T cells and that it behaves as an early inducible gene involved in the T cell activation process. Moreover, blockade of COX-2 enzymatic activity by nonsteroidal anti-inflammatory drugs down-regulates T cell activation (15, 36). In the present work we have extended our observations by analyzing the regulation of the activity of the COX-2 promoter in T cells. Our results clearly show that COX-2 promoter activity was markedly induced after T cell activation. Conversely, COX-1 promoter-driven luciferase activity was not augmented upon activation. It is known that the pattern of expression of these isoforms in mammalian tissues is different. Whereas COX-1 is constitutively expressed in almost all tissues, COX-2 is rapidly induced by serum, phorbol esters, mitogens, and cytokines in many cell types including synoviocytes, endothelial cells, fibroblasts, and monocyte/macrophages (reviewed in Refs. 1-3). The analysis of the 5'-flanking regions of these genes reveals little similarity, which likely contributes to their differential pattern of expression (4-9, 41). COX-1 has a TATA-less promoter that does not display any significant inducible transcription. On the other hand, the promoter region of the COX-2 gene contains a TATA box and binding sites for transcription factors including nuclear factor-kappa B (12, 14), nuclear factor IL-6/CCAAT-enhancer binding protein (5, 42, 43) and cyclic AMP-response element-binding proteins (10, 11). In addition to these sites, in this work we have identified two NFAT binding sites that are essential for the induction of COX-2 expression in T cells.

Maximal induction of COX-2 promoter activity in T cells occurred with stimuli mimicking T cell activation through the TCR·CD3 complex such as the simultaneous treatment with the phorbol ester PMA plus the calcium ionophore A23187. However, the contribution of these agents to COX-2 up-regulation is different; whereas PMA treatment was able to promote COX-2 gene transcriptional activation up to 4-fold, single treatment with Ion was not sufficient to induce COX-2 gene expression either measured by the activity of its promoter or by analyzing COX-2 mRNA levels. These results pointed to a synergistic cooperation of both PKC and Ca2+ pathways for full activation. Similar requirements have been reported for the activation of many important T cell activation genes including IL-2 (4, 5, 22, 46). It has been shown that PMA rapidly induces COX-2 mRNA in human epithelial cells, endothelial cells, and monocytes (44-46) and also in murine fibroblasts (47, 48). In addition, activation of components of the AP-1 transcription factor complex such as Fos/Jun proteins by PMA has been reported to be important for the activation of the transcription of the COX-2 gene in non-T cells (46, 49, 50). Both AP-1 activity and COX-2 mRNA expression are induced in T cells by engagement of the TCR·CD3 complex with antigens or specific antibodies as well as by phorbol esters or mitogens (51-53), which is consistent with the potential role of AP-1 in the induction of COX-2 promoter in T cells. In support of this was the fact that a c-Jun dominant negative mutant efficiently abrogated this induction. Besides, the efficient competition of AP-1 oligonucleotides for the binding of NFAT to the proximal NFAT site of this promoter pointed to an important role of AP-1 components in the induction of the COX-2 promoter by the interaction with NFAT. Although regulation of COX-2 promoter activity by AP-1 transcription factor has been reported to occur through a CRE element in the COX-2 promoter in NIH 3T3 cells (50), our results discard the involvement of this element in the induction of the COX-2 promoter in T cells.

We have shown that COX-2 mRNA induction was abrogated by treatment with the immunosuppressive drug cyclosporin A. Even more, co-expression of a constitutively active calcineurin catalytic subunit cooperated synergistically with PMA in COX-2 promoter induction, therefore confirming the involvement of the Ca2+/calcineurin pathway in the regulation of this gene in T cells. As reported for the IL-2 promoter and NFAT-dependent reporter constructs, the presence of this mutant bypasses the requirements of Ca2+ (27, 38). CsA was able to inhibit both endogenous Ca2+/calcineurin activation and PMA/Delta CAM-AI-mediated transcription confirming that the calcineurin signaling pathway is the CsA-sensitive component in TCR signal transduction required for COX-2 induction in T lymphocytes. Activation of calcineurin results in dephosphorylation and activation of NFAT proteins (19, 37), which enter the nucleus where they bind to NFAT-responsive elements in the 5'-flanking sequence of several genes such as IL-2, IL-4, granulocyte-macrophage colony-stimulating factor, and tumor necrosis factor alpha  among others (37). As a consequence, transcriptional activation of these genes occurs. In agreement with that pathway, we have shown here that overexpression of the NFATc (NFAT2 and NFATc1) isoform in T cells enhanced PMA and PMA plus Ion COX-2 promoter activity in a similar fashion as in the case of the IL-2 promoter. On the other hand, expression of a dominant negative NFAT version abolished PMA plus Ion-induced transcription, thus evidencing the involvement of NFAT transcription factor in the induction of the COX-2 promoter. Moreover, we have identified two NFAT binding sites located in a highly conserved region both in sequence composition as well as in relative position to the transcription start site among rat, mouse, and human genes, suggesting common mechanisms of transcriptional regulation of COX-2 gene in T cells among mammalian species. Furthermore, our results may provide an explanation of previous data describing a CsA-sensitive induction of COX-2 mRNA by IL-1 or tumor necrosis factor in rat mesangial cells (54). The COX-2 NFAT distal site appears to be a pure NFAT site, evidenced for the absence of any surrounding predicted AP-1 binding sequences and for the lack of competition of an AP-1 consensus oligonucleotide for the protein binding to this sequence. On the other hand, the COX-2 NFAT proximal site contains a highly homologous AP-1 site adjacent to the NFAT core GGAAA motif. Both NFAT sites lie within the first 170 bp upstream of the transcription initiation site, which contains most of the sites previously described to be important for induced transcription of COX-2 in non-T cells such as the TATA box, an E-box (13), a nuclear factor IL-6/CCAAT-enhancer binding protein motif (5, 42, 43), and a cyclic AMP-response element (10, 11). However, the importance of these cis-acting acting elements in COX-2 transcriptional induction depends on the cell type and the stimuli used (5, 10, 11, 14, 42, 46). In this context, it is noteworthy that the previously described nuclear factor-kappa B-dependent elements of the COX-2 promoter were absent in this region. Our results assign a predominant role to the NFAT and AP-1 sites for COX-2 promoter regulation in human T cells. Thus, selective mutation of these sites diminished more than 80% the inducibility of the promoter in these cells. Both distal and proximal NFAT sites seemed to be required for full transcriptional activation of the human COX-2 gene. The presence of multiple NFAT sites is a common feature of NFAT-dependent promoters as shown for the IL-2, IL-4, granulocyte-macrophage colony stimulating factor, and tumor necrosis factor alpha  promoters (reviewed in Ref. 37).

In conclusion, our results implicate the CsA-sensitive Ca2+/calcineurin/NFAT and PKC/AP-1 pathways in the regulation of COX-2 gene expression in T lymphocytes in a similar manner to that reported for other NFAT-dependent genes important in the T cell activation process such as IL-2. Growing evidence supports the role of COX-2, eicosanoids, and nonsteroidal anti-inflammatory drugs in the homeostasis of the immune system, regulating both humoral and cell-mediated immunity and modulating cytokine production as well as T cell proliferation and activation (15, 55-60). Moreover, COX-2 inhibitors have been proven to be useful in T-cell-mediated inflammatory diseases such as rheumatoid arthritis (61, 62). In addition, cyclosporin A has been demonstrated to have beneficial symptomatic effects in inflammatory diseases like psoriasis and rheumatoid arthritis (63). Our data identify COX-2 as a new target for the immunosuppressive and anti-inflammatory actions of CsA in T-cell-mediated inflammatory diseases like psoriasis and rheumatoid arthritis. Data presented here may provide an explanation of the effectiveness of CsA treatment in rheumatoid arthritis through the inhibition of COX-2 induction in addition to the known immunosuppressive effects of the drug.

    ACKNOWLEDGEMENTS

We are very grateful to Drs. G. Crabtree and C. M. Zacharchuck for providing reagents and N. Rice for providing us the antiserum anti-all NFATs 796 used to titrate the antiserum 674 that we have generated. We also thank María Chorro for excellent technical assistance.

    FOOTNOTES

* This work was supported by grants from Laboratorios Dr. Esteve, Dirección General de Enseñanza Superior e Investigación Científica of Spain Grants PM97-0130 and FD97-0275, Comunidad Autónoma de Madrid, and Fundación Ramón Areces.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Tel.: 34-91-3978413; Fax: 34-91-3974799; E-mail: Mfresno@cbm.uam.es.

Published, JBC Papers in Press, May 17, 2000, DOI 10.1074/jbc.M001381200

    ABBREVIATIONS

The abbreviations used are: COX, cyclooxygenase; IL, interleukin; CRE, cyclic AMP response element; TCR, T cell receptor; PKC, protein kinase C; AP, activator protein; NFAT, nuclear factor of activated T cells; CsA, cyclosporin A; PBT, peripheral blood T lymphocyte; PMA, phorbol 12-myristate 13-acetate; Ion, A23187 calcium ionophore; PCR, polymerase chain reaction; bp, base pair(s); LUC, luciferase; RLU, relative luciferase unit.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Smith, W., and DeWitt, D. (1996) Adv. Immunol. 62, 167-215
2. Griswold, D. E., and Adams, J. L. (1996) Med. Res. Rev. 16, 181-206
3. Herschman, H. R. (1996) Biochim. Biophys. Acta 1299, 125-140
4. Fletcher, B. S., Kujubu, D. A., Perrin, D. M., and Herschman, H. R. (1992) J. Biol. Chem. 267, 4338-4344
5. Sirois, J., and Richards, J. S. (1993) J. Biol. Chem. 268, 21931-21938
6. Xie, W., Merrill, J. R., Bradshaw, W. S., and Simmons, D. L. (1993) Arch. Biochem. Biophys. 300, 247-252
7. Appleby, S. B., Ristimaki, A., Neilson, K., Narko, K., and Hla, T. (1994) Biochem. J. 302, 723-727
8. Kosaka, T., Miyata, A., Ihara, H., Hara, S., Sugimoto, T., Takeda, O., Takahashi, E., and Tanabe, T. (1994) Eur. J. Biochem. 221, 889-897
9. Tazawa, R., Xu, X. M., Wu, K. K., and Wang, L. H. (1994) Biochem. Biophys. Res. Commun. 203, 190-199
10. Xie, W., Fletcher, B. S., Andersen, R. D., and Herschman, H. R. (1994) Mol. Cell. Biol. 14, 6531-6539
11. Inoue, H., Nanayama, T., Hara, S., Yokoyama, C., and Tanabe, T. (1994) FEBS Lett. 350, 51-54
12. Inoue, H., and Tanabe, T. (1998) Biochem. Biophys. Res. Commun. 244, 143-148
13. Morris, J. K., and Richards, J. S. (1996) J. Biol. Chem. 271, 16633-16643
14. Yamamoto, K., Arakawa, T., Ueda, N., and Yamamoto, S. (1995) J. Biol. Chem. 270, 31315-31320
15. Iniguez, M. A., Punzon, C., and Fresno, M. (1999) J. Immunol. 163, 111-119
16. Ullman, K., Northrop, J., Verweij, C., and Crabtree, G. (1990) Annu. Rev. Immunol. 8, 421-452
17. Weiss, A., and Littman, D. R. (1994) Cell 76, 263-274
18. Altman, A., Coggeshall, K. M., and Mustelin, T. (1990) Adv. Immunol. 48, 227-360
19. Crabtree, G. R., and Clipstone, N. A. (1994) Annu. Rev. Biochem. 63, 1045-1083
20. Clipstone, N. A., and Crabtree, G. R. (1992) Nature 357, 695-697
21. Loh, C., Shaw, K. T., Carew, J., Viola, J. P., Luo, C., Perrino, B. A., and Rao, A. (1996) J. Biol. Chem. 271, 10884-10891
22. Jain, J., McCaffrey, P. G., Miner, Z., Kerppola, T. K., Lambert, J. N., Verdine, G. L., Curran, T., and Rao, A. (1993) Nature 365, 352-355
23. Park, J., Yaseen, N. R., Hogan, P. G., Rao, A., and Sharma, S. (1995) J. Biol. Chem. 270, 20653-20659
24. Shaw, K. T., Ho, A. M., Raghavan, A., Kim, J., Jain, J., Park, J., Sharma, S., Rao, A., and Hogan, P. G. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 11205-11209
25. Shibasaki, F., Price, E. R., Milan, D., and McKeon, F. (1996) Nature 382, 370-373
26. Schreiber, S., and Crabtree, G. (1992) Immunol. Today 13, 136-142
27. O'Keefe, S. J., Tamura, J., Kincaid, R. L., Tocci, M. J., and O'Neill, E. A. (1992) Nature 357, 692-694
28. Liu, J. (1993) Immunol. Today 14, 290-295
29. Nordeen, S. K. (1988) BioTechniques 6, 454-458
30. Durand, D. B., J.-P., S., Bush, M. R., Peplogle, R. E., Belagaje, R., and Crabtree, G. R. (1988) Mol. Cell. Biol. 8, 1715-1724
31. Northrop, J. P., Ho, S. N., Chen, L., Thomas, D. J., Timmerman, L. A., Nolan, G. P., Admon, A., and Crabtree, G. R. (1994) Nature 369, 497-502
32. Petrak, D., Memon, S. A., Birrer, M. J., Ashwell, J. D., and Zacharchuk, C. M. (1994) J. Immunol. 153, 2046-2051
33. Martinez-Martinez, S., Gomez del Arco, P., Armesilla, A. L., Aramburu, J., Luo, C., Rao, A., and Redondo, J. M. (1997) Mol. Cell. Biol. 17, 6437-6447
34. Liu, F. T., Zinnecker, M., Hamaoka, T., and Katz, D. H. (1979) Biochemistry 18, 690-693
35. Lyakh, L., Ghosh, P., and Rice, N. R. (1997) Mol. Cell. Biol. 17, 2475-2484
36. Pablos, J. L., Santiago, B., Carreira, P. E., Galindo, M., and Gomez-Reino, J. J. (1999) Clin. Exp. Immunol. 115, 86-90
37. Rao, A., Luo, C., and Hogan, P. G. (1997) Annu. Rev. Immunol. 15, 707-747
38. Kubo, M., Kincaid, R. L., Webb, D. R., and Ransom, J. T. (1994) Int. Immunol. 6, 179-188
39. Jain, J., Lom, C., and Rao, A. (1995) Curr. Opin. Immunol. 7, 333-342
40. Cockerill, P. N., Bert, A. G., Jenkins, F., Ryan, G. R., Shannon, M. F., and Vadas, M. A. (1995) Mol. Cell. Biol. 15, 2071-2079
41. Wang, L. H., Hajibeigi, A., Xu, X. M., Loose, M. D., and Wu, K. K. (1993) Biochem. Biophys. Res. Commun. 190, 406-411
42. Inoue, H., Yokoyama, C., Hara, S., Tone, Y., and Tanabe, T. (1995) J. Biol. Chem. 270, 24965-24971
43. Kim, Y., and Fischer, S. M. (1998) J. Biol. Chem. 273, 27686-27694
44. Hla, T., and Neilson, K. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7384-7388
45. Jones, D. A., Carlton, D. P., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M. (1993) J. Biol. Chem. 268, 9049-9054
46. Subbaramaiah, K., Chung, W. J., Michaluart, P., Telang, N., Tanabe, T., Inoue, H., Jang, M., Pezzuto, J. M., and Dannenberg, A. J. (1998) J. Biol. Chem. 273, 21875-21882
47. Kujubu, D. A., Fletcher, B. S., Varnum, B. C., Lim, R. W., and Herschman, H. R. (1991) J. Biol. Chem. 266, 12866-12872
48. Kujubu, D. A., Reddy, S. T., Fletcher, B. S., and Herschman, H. R. (1993) J. Biol. Chem. 268, 5425-5430
49. Subbaramaiah, K., Chung, W. J., and Dannenberg, A. J. (1998) J. Biol. Chem. 273, 32943-32949
50. Xie, W., and Herschman, H. R. (1995) J. Biol. Chem. 270, 27622-27628
51. Gomez del Arco, P., Martinez-Martinez, S., Calvo, V., Armesilla, A. L., and Redondo, J. M. (1996) J. Biol. Chem. 271, 26335-26340
52. Kvanta, A., Kontny, E., Jondal, M., Okret, S., and Fredholm, B. B. (1992) Cell. Signalling 4, 275-286
53. Makover, D., Cuddy, M., Yum, S., Bradley, K., Alpers, J., Sukhatme, V., and Reed, J. C. (1991) Oncogene 6, 455-460
54. Martin, M., Neumann, D., Hoff, T., Resch, K., DeWitt, D. L., and Goppelt-Struebe, M. (1994) Kidney Int. 45, 150-158
55. Goodwin, J. S. (1989) Curr. Opin. Immunol. 3, 295-315
56. Della Bella, S., Molteni, M., Compasso, S., Zulian, C., Vanoli, M., and Scorza, R. (1997) Prostaglandins Leukotrienes Essent. Fatty Acids 56, 177-184
57. Kumar, G. S., and Das, U. N. (1994) Prostaglandins Leukotrienes Essent. Fatty Acids 50, 331-334
58. Phipps, R. P., Stein, S. H., and Roper, R. L. (1991) Immunol. Today 12, 349-352
59. Hall, V. C., and Wolf, R. E. (1997) J. Rheumatol. 24, 1467-1470
60. Zhou, L., Ritchie, D., Wang, E., Barbone, A., Argentier, D., and Lau, C. (1994) J. Immunol. 153, 5026-5037
61. Moulton, P. (1996) Br. J. Biomed. Sci. 53, 317-324
62. Harris, E., Jr. (1990) N. Engl. J. Med. 322, 1277-1288
63. Dougados, M. (1994) Clin. Exp. Rheumatol. 12, S75-S78

Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
B. K. Robbs, A. L. S. Cruz, M. B. F. Werneck, G. P. Mognol, and J. P. B. Viola
Dual Roles for NFAT Transcription Factor Genes as Oncogenes and Tumor Suppressors
Mol. Cell. Biol., December 1, 2008; 28(23): 7168 - 7181.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
R. J. Flockhart, B. L. Diffey, P. M. Farr, J. Lloyd, and N. J. Reynolds
NFAT regulates induction of COX-2 and apoptosis of keratinocytes in response to ultraviolet radiation exposure
FASEB J, December 1, 2008; 22(12): 4218 - 4227.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
L. Wang, P. J. Flannery, P. B. Rosenberg, T. A. Fields, and R. F. Spurney
Gq-Dependent Signaling Upregulates COX2 in Glomerular Podocytes
J. Am. Soc. Nephrol., November 1, 2008; 19(11): 2108 - 2118.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Blanco, S. Alvarez, M. Fresno, and M. A. Munoz-Fernandez
Extracellular HIV-Tat Induces Cyclooxygenase-2 in Glial Cells through Activation of Nuclear Factor of Activated T Cells
J. Immunol., January 1, 2008; 180(1): 530 - 540.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
D. Schunke, P. Span, H. Ronneburg, A. Dittmer, M. Vetter, H.-J. Holzhausen, E. Kantelhardt, S. Krenkel, V. Muller, F. C.G.J. Sweep, et al.
Cyclooxygenase-2 Is a Target Gene of Rho GDP Dissociation Inhibitor {beta} in Breast Cancer Cells
Cancer Res., November 15, 2007; 67(22): 10694 - 10702.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
W. Ouyang, Y. Hu, J. Li, M. Ding, Y. Lu, D. Zhang, Y. Yan, L. Song, Q. Qu, D. Desai, et al.
Direct evidence for the critical role of NFAT3 in benzo[a]pyrene diol-epoxide-induced cell transformation through mediation of inflammatory cytokine TNF induction in mouse epidermal Cl41 cells
Carcinogenesis