|
Originally published In Press as doi:10.1074/jbc.M002953200 on May 12, 2000
J. Biol. Chem., Vol. 275, Issue 31, 24173-24184, August 4, 2000
Regulation of Na,K-ATPase 1 Subunit Gene Transcription by Low
External Potassium in Cardiac Myocytes
ROLE OF Sp1 AND Sp3*
Yong
Zhuang ,
Christine
Wendt§, and
Gregory
Gick ¶
From the Department of Biochemistry and Center for
Cardiovascular and Muscle Research, State University of New York Health
Science Center at Brooklyn, Brooklyn, New York 11203 and the
§ University of Minnesota Medical School,
Minneapolis, Minnesota 55455
Received for publication, April 5, 2000
 |
ABSTRACT |
Expression of Na,K-ATPase activity is
up-regulated in cells incubated for extended intervals in the presence
of low external K+. Our previous data showed that
exposure of cardiac myocytes to low K+ increased the
steady-state abundance of Na,K-ATPase 1 subunit mRNA. In the
present study we determined that incubation of primary cultures of
neonatal rat cardiac myocytes with low K+ augmented
Na,K-ATPase 1 gene expression at a transcriptional level and that
this effect required extracellular Ca2+. The stimulatory
effect of low K+ on Na,K-ATPase 1 gene transcription was
not dependent on increased contractile activity of cardiac myocytes.
Na,K-ATPase 1 5'-flanking region deletion plasmids used in transient
transfection analysis demonstrated that the region between nucleotides
62 to 42 of the 1 promoter contained a low K+
response element. Site-directed mutagenesis of a potential GC box core
motif GCG in the 58/ 56 region of the 1 promoter decreased basal
and low K+-mediated transcription. Mutation of the core
sequence of a putative GC box element located between nucleotides 101
and 99 further decreased the low K+ effect on 1 gene
transcription. Electrophoretic mobility shift assays using
oligonucleotides spanning the proximal and distal GC box elements of
the 1 promoter showed enhanced binding of two complexes in
response to low K+. The inclusion of a consensus GC box
sequence as a competitor in gel shift analysis reduced factor binding
to the low K+ response elements. Antibodies to
transcription factors Sp1 and Sp3 interacted with components of both
DNA-binding complexes and binding of nuclear factors was abolished in
gel shift studies using GC box mutants. Together these data indicate
that enhanced binding of Sp1 and Sp3 to two GC box elements in the rat
Na,K-ATPase 1 subunit gene promoter mediates 1 gene transcription
up-regulation in neonatal rat cardiac myocytes exposed to low
external K+.
 |
INTRODUCTION |
Na,K-ATPase1 is an
intrinsic plasma membrane enzyme that plays an essential role in animal
cell physiology (1). By its continuous function coupled to the
hydrolysis of ATP, Na,K-ATPase is directly responsible for maintaining
transmembrane gradients of Na+ and K+, resting
membrane potentials, control of cell volume, and a significant portion
of basal energy utilization. By virtue of its predominant role in the
regulation of intracellular Na+, Na,K-ATPase is also of
vital importance in the control of the intracellular concentrations of
calcium and hydrogen ions whose transport are coupled to
Na+. Na,K-ATPase consists of two noncovalently linked,
dissimilar subunits, and , present in equimolar amounts (2). The
larger subunit (112 kDa) regulates catalytic activity and contains sites for cardiac glycoside binding and phosphorylation (2). The
smaller subunit (32 kDa) is extensively glycosylated and facilitates the correct insertion of the subunit in the plasma membrane (3). While multiple isoforms of Na,K-ATPase ( 1, 2,
and 3) and ( 1, 2, and 3) subunits are expressed in a tissue-specific fashion (4-8), 1 and 1 subunits are
constitutively expressed in the majority of tissues (1).
Prolonged exposure of a variety of cells to conditions which are
inhibitory to Na,K-ATPase function, such as digitalis derivatives or
low extracellular K+, yields an initial increase in the
intracellular concentration of Na+ and a subsequent
up-regulation of Na,K-ATPase activity and subunit content (9-12).
Similar increases in Na,K-ATPase expression have been noted in
vivo with administration of digoxin to experimental animals
(13-15) and humans (16, 17). A pretranslational mechanism has been
implicated in the up-regulation of Na,K-ATPase activity based on the
finding of either low K+- or ouabain-mediated augmentation
of Na,K-ATPase subunit mRNA contents in established cell lines such
as Madin-Darby canine kidney and ARL-15 (18, 19) and in primary
cell cultures derived from adult rat kidney (20) and neonatal rat
ventricle (21). Our previous transient transfection studies
demonstrated that the region between 102 to +151 base pairs of the
rat Na,K-ATPase 1 subunit gene is necessary for up-regulation of
1 mRNA content in response to incubation of primary cultures of
neonatal rat cardiac myocytes in low extracellular K+ (21).
It is important to note, however, that neither the DNA sequence
element(s) nor the trans-acting factor(s) responsible for control of
Na,K-ATPase subunit gene expression in response to either low
K+ or ouabain have been defined.
In the present studies, we have further delineated the molecular
mechanism underlying regulation of Na,K-ATPase 1 gene expression in
response to low extracellular K+ in primary cultures of
neonatal rat cardiac myocytes. Our results indicate that low
K+ mediates an increase in 1 subunit gene transcription
that is dependent on extracellular Ca2+. Transient
transfection studies with 5' deletion and mutant constructs revealed
that two GC box elements in the proximal 1 gene promoter between
nucleotides 102 and 42 are necessary for transcriptional up-regulation mediated by low K+. The results of
electrophoretic mobility shift and transient transfection assays show
that increased binding of Sp1 and Sp3 transcription factors to these GC
box sequences are required to elicit the low K+ response.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Neonatal rats (1-day-old) of the Harlan
Sprague-Dawley strain were purchased from Charles River Laboratories
(Wilmington, MA). Dulbecco's modified Eagle's medium,
K+-free and K+- and Ca2+-free
Williams' E medium, serum, Lipofectin, oligonucleotides, and
nick-translation kits were obtained from Life Technologies, Inc. (Grand
Island, NY). Luciferase assay systems and Taq polymerase were purchased from Promega (Madison, WI). Protein assay kits were from
Bio-Rad. [ -32P]dCTP (3000 Ci/mmol) was from NEN Life
Science Products, Inc. (Boston, MA) and BA-85 nitrocellulose filters
from Schleicher & Schuell (Keene, NH). Site-directed mutagenesis kits
were from Stratagene (La Jolla, CA). Ultraspec RNA isolation systems
were from Biotecx Laboratories (Houston, TX). Sp1, Sp3, and USF-1
antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa
Cruz, CA). All chemicals were purchased from Sigma and were analytical grade or better.
Plasmids--
Construction of luciferase plasmids containing the
102 to +151 and 41 to +151 base pair regions of the rat Na,K-ATPase
1 gene was described previously (21, 22). The luciferase reporter plasmids containing the promoter regions of the chicken myosin light
chain-2 (MLC-2) ( 222 to +158) and rat angiotensinogen ( 688 to +39)
genes were provided by M. A. Q. Siddiqui and A. Brasier, respectively. The generation of a luciferase plasmid harboring the
157 to 38 base pair region of the 1 gene upstream of the minimal
promoter of the mouse mammary tumor virus (MMTV) has been reported
(22). Luciferase constructs that contain 1 promoter sequences from
84 to +151 and 62 to +151 base pairs were synthesized using
polymerase chain reaction (PCR) amplification. Oligonucleotides from
84 to +151 and 62 to +151 base pairs were generated by PCR using
the 102/+151 1 region as a template. The reactions were performed
in a total volume of 100 µl containing 1 µg of template, 0.2 mM dNTPs, 2 µM of each primer (5' primers,
GCGGATCCGATTGGCCTGCGGT and GCGGATCCTAGGCGGAGCTAC; 3' primer,
GCAAGCTTGCATGCAGG) 2.5 mM MgCl2, 50 mM K+Cl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton
X-100, and 2.5 units of Taq polymerase. 25 cycles were run,
each cycle included 94 °C for 15 s (denaturation), 70 °C for
15 s (annealing), and 72 °C for 1 min and 15 s
(elongation). The PCR fragments were digested with BamHI and
ligated into the BamHI site of the luciferase vector pXP1.
The PCR to synthesize the 55 to +151 oligonucleotide was performed in
a total volume of 50 µl containing 30 ng of template, 0.1 mM dNTPs, 0.1 nM of each primer (5' primer,
AAAGAATCCGAGCTACGGATGGTGGAGGC; 3' primer,
CTTGAATCCCCTGCTGCTTCAAG), 2 mM MgCl2, 10 mM (NH4)2SO4, 10 mM KCl, 20 mM Tris-HCl (pH 8.8), 0.1% Triton
X-100, and 2.5 units of Pfu polymerase (Stratagene). The run included
28 cycles, each cycle included: denaturation for 1 min and 30 s
(96 °C), annealing for 40 s (60 °C) and elongation for 1 min
and 30 s (68 °C). The PCR fragment was ligated into pXP1. Each
5' deletion clone was sequenced to confirm the appropriate sequence.
Site-directed Mutants--
A single GC box mutant that changed
GCG to TTT in the 58/ 56 region of the 1 promoter was generated
using the QuikChange site-directed mutagenesis kit according to the
manufacturer's protocol (Stratagene). The luciferase plasmid
containing the 1 gene 102 to +151 region was used as a template
with two synthetic oligonucleotides containing the GC box mutation
(forward primer, CGGTGCCGCCGGTAGTTTGAGCTACGGATGGTGGAG; reverse primer,
CTCCACCATCCGTAGCTCAAACTACCGGCGGCACCG). A double mutant that
changed the 58/ 56 and 67/ 65 sequences from GCG and CGC to AGA
and TCT, respectively, was produced using the Chameleon site-directed
mutagenesis kit (Stratagene) and mutant primers (forward primer,
CGATTGGCCTGCGGTGCTCTCGGTAGAGAGAGCTACGGATGG; reverse primer,
CCATCCGTAGCTCTCTCTACCGAGAGCACCGCAGGCCAATCG). PCR amplification
was carried as detailed in the manufacturer's protocol with 10 ng of
luciferase plasmid containing the 1 gene 102 to +151 region as a
template and 125 ng of each primer. This double mutant was used as a
template to generate a triple GC box mutant with the additional change
of nucleotides at 101/ 99 from CGC to TCT using the QuikChange
site-directed mutagenesis kit and mutant primers (forward primer,
GCTCAGATCTCGAGGCCCTCTCTTCTCGGCACCGGC; reverse primer,
GCCGGTGCCGAGAAGAGAGGGCCTCGAGATCTGAGC). All site-directed mutants
were confirmed by DNA sequence analysis.
Cell Culture and Transfection--
Neonatal rat cardiac myocytes
were prepared and incubated as described previously (21). Briefly,
ventricles from 1 to 3-day-old Harlan Sprague-Dawley rats were minced
and subjected to consecutive digestion with trypsin and DNase I. Cells
were preplated for 30 min at 37 °C and myocytes
(2826/mm2) remaining in suspension were added to plates
coated with 1% gelatin. Cardiac myocytes were incubated overnight in
Dulbecco's modified Eagle's medium containing 10% calf serum, 0.1 mM bromodeoxyuridine, and antibiotics at 37 °C in
humidified air with 7% CO2. In the majority of
experiments, cells were transfected by an overnight incubation at 3%
CO2 with calcium phosphate-DNA coprecipitates. To minimize
the potential effect of increased intracellular Ca2+ on
transfection analysis, in one set of experiments cardiac myocytes were
transfected overnight with Lipofectin (Life Technologies, Inc.)
according to the manufacturer's protocol. In experiments designed to
evaluate the effect of contraction on transfected gene expression,
cells were washed with 1 × phosphate-buffered saline and then
incubated for 24 h in serum-free, K+-free Willliams'
E medium supplemented to a final concentration of 5.4 mM
K+ with either 54 mM K+, 10 µM verapamil, or 7.5 mM 2,3-butanedione
monoxime (BDM). In all other transfection experiments, cardiac myocytes
were preincubated for 24 h in serum-free, K+-free
Willliams' E medium supplemented to a final concentration of 5.4 mM K+ and then exposed to reduced
concentrations of K+ for 1 day. Cells were lysed and
luciferase and -galactosidase activities were measured in cell
extracts as described previously (21). Protein concentration was
quantitated using a Bio-Rad assay system. It was determined that the
expression of a co-transfected CMV/ -galactosidase vector was
significantly regulated by exposure to low K+, high
K+, verapamil or BDM. In three experiments in which four
plates were transfected with the 102/+151 1/luciferase plasmid, we found that the variation of luciferase activity expressed relative to
total protein was 7 ± 0.7% (p < 0.05).
Luciferase activities were therefore normalized to total cellular protein.
Northern Blot Hybridization--
Neonatal rat heart cells were
incubated in Dulbecco's modified Eagle's medium containing 10% calf
serum for 2 days and then preincubated for 24 h in serum-free,
K+-free Willliams' E medium supplemented to a final
concentration of 5.4 mM K+. Cells were washed
with 1 × phosphate-buffered saline and incubated in
K+-free Williams' E medium supplemented with either 5.4 or
0.3 mM K+ for 6 h. In parallel, cardiac
myocytes were incubated with 0.1 mM EGTA in the presence
and absence of 2.1 mM Ca2+ for 6 h and the
effect of low K+ was assessed. Cells were lysed with 5 ml
of Ultraspec RNA isolation reagent (Biotecx Laboratories, Inc.)
containing guanidinium thiocyanate and phenol and Northern blot
analysis was conducted as previously detailed (21). Briefly, total RNA
(10 µg) was resolved on 1% agarose gels containing 5% formaldehyde
and RNA was transferred to nitrocellulose membranes. Blots were
prehybridized overnight at 42 °C in 5 × SSC (1 × SSC = 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0), 5 × Denhardts, 50% formamide, 1 mM EDTA, 10 mM NaH2PO4 (pH 6.9), 0.5% SDS, and
0.1 mg/ml sonicated, sperm DNA. A Na,K-ATPase 1 cDNA was labeled
with 32P by nick-translation and blots were hybridized in a
solution containing 5 × SSC, 1 × Denhardts, 50% formamide,
1 mM EDTA, 10 mM
NaH2PO4 (pH 6.9), 0.1% SDS, and 0.1 mg/ml
sperm DNA. After a 3-day incubation at 42 °C, membranes were washed
with 0.1 × SSC, 0.1% SDS twice at 55 °C for 15 min.
Na,K-ATPase 1 subunit mRNA was detected and quantitated by
PhosphorImaging analysis.
Preparation of Nuclear Extract--
The method used for
preparing nuclear extracts was a modified Dignam protocol (23). Cells
(25 × 106) were washed twice with ice-cold 1 × phosphate-buffered saline, scraped into 1.5 ml of ice-cold 1 × phosphate-buffered saline in a 1.5-ml Eppendorf tube and centrifuged at
2,000 rpm for 10 s at room temperature. To rupture cell membranes,
pellets were resuspended in 5 volumes of an ice-cold buffer containing
10 mM HEPES (pH 7.9), 10 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 0.5 µg/ml
leupeptin, incubated on ice for 10 min and vortexed vigorously for
20 s. The homogenate was subjected to centrifugation at 2,000 rpm
for 10 s. Nuclear pellets were resuspended in an equal volume of a buffer comprised of 20 mM HEPES (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 0.5 mM
phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, and
0.5 µg/ml leupeptin and incubated on ice for 20 min. After
centrifugation at 14,000 rpm for 2 min at 4 °C, the supernatant
containing nuclear proteins was aliquoted and stored at 70 °C.
Protein concentration was determined using a Bio-Rad kit.
Electrophoretic Mobility Shift Assay--
Double-stranded
oligonucleotides spanning three potential GC box elements in the rat
Na,K-ATPase 1 gene promoter were commercially synthesized. In
addition, corresponding oligonucleotides were prepared with the core
GCG sequences mutated to either TTT or AGA. Wild type and mutant
oligonucleotides were labeled using the Klenow fragment in the presence
of [ -32P]dCTP and used as probes. Nuclear extract
isolated from cardiac myocytes cultured in either 5.4 or 0.3 mM K+ for 1 day was incubated in a 15-µl
reaction with 1 ng of 32P-labeled oligonucleotide (2 to
5 × 105 cpm) in 10 mM HEPES (pH 7.9), 75 mM KCl, 1 mM EDTA, 1 mM
dithiothreitol, 10% glycerol, and 1.5 µg of poly(dI-dC) for 15 min
at room temperature. For oligonucleotide competition experiments, a
100-fold excess of unlabeled oligonucleotide competitors were
preincubated with nuclear extracts for 15 min at 4 °C prior to the
addition of labeled probe and incubation for 15 min at room
temperature. For supershift experiments, antibodies were preincubated
with nuclear extracts for 15 min at 4 °C and then incubated with
probe at 4 °C for an additional 15 min. Reaction mixtures were
applied to a 6% polyacrylamide gel and DNA-protein complexes were
separated by electrophoresis under low ionic strength conditions
(0.5 × Tris borate-EDTA buffer) at 15 mA at 4 °C. The gel was
dried under vacuum and analyzed by PhosphorImaging.
Statistical Analysis--
Student's t tests and
ANOVA were utilized to determine the significance of results.
 |
RESULTS |
Low K+ Induces a Selective,
Promoter-dependent Increase in Na,K-ATPase 1 Gene
Transcription--
Our previous study (21) showed that incubation of
primary cultures of neonatal rat cardiac myocytes with low
extracellular K+ increased the steady-state level of
Na,K-ATPase 1 mRNA and enhanced luciferase activity driven by
the 102 to +151-base pair region of the rat 1 gene. To further
delineate the molecular mechanism which underlies the low
K+ effect on Na,K-ATPase 1 gene expression, neonatal rat
cardiac myocytes were transiently transfected with luciferase reporter plasmids containing portions of the rat 1 promoter between 102 to
+151 or 41 to +151 base pairs. Exposure of cells to 0.3 mM K+ for 1 day resulted in a 2.6 ± 0.3-fold increase in luciferase activity by the 102 to +151-base pair
region, whereas the 41 to +151 portion of the 1 promoter was
unresponsive to low K+ (Fig.
1A). These data indicate that
the low K+ response is transcriptional and is mediated by a
DNA element between nucleotides 102 to 42 of the rat Na,K-ATPase
1 gene. To begin to assess the selectivity of the low K+
response, we examined the effect of low K+ on MLC-2 and
angiotensinogen transcription in transient transfection experiments
(Fig. 1B). In cells treated with 0.3 mM
K+ for 1 day, luciferase activity directed by the rat
angiotensinogen gene promoter was unaffected by low K+. By
contrast, luciferase expression was augmented 4.8 ± 0.5-fold by
low K+ in cells transfected with a reporter plasmid
containing the proximal promoter region of the chicken MLC-2 gene. To
examine whether the 102 to 42 region of the 1 gene functions as
a promoter-independent enhancer in mediating the low K+
effect, we subcloned the 157 to 38-base pair region of the 1
gene into a luciferase vector driven by the proximal promoter of MMTV
and evaluated its response to low K+ (Fig. 1C).
Interestingly, low K+ treatment had no stimulatory
effect on this heterologous promoter suggesting that the low
K+ response element requires the native 1 gene
promoter to function.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1.
Low K+ induces a selective,
promoter-dependent stimulation of rat Na,K-ATPase
1 gene transcription in neonatal rat cardiac
myocytes. Panel A, primary cultures of neonatal rat
cardiac myocytes were prepared and transfected by calcium phosphate
coprecipitation with 1 µg of luciferase plasmids containing either
the 102 to +151 or 41 to +151-base pair region of the rat
Na,K-ATPase 1 gene as detailed under "Experimental Procedures."
Cells were incubated in serum-free Williams' E medium in either 5.4 or 0.3 mM K+ for 1 day. Cardiac myocytes were lysed
and cell extracts assayed for luciferase activity. Panel B,
cardiac myocytes were transfected with 1 µg of luciferase plasmids
harboring portions of the 5' ends of the rat angiotensinogen and
chicken MLC-2 genes. Transfected cells were incubated in the presence
of either 5.4 or 0.3 mM K+ for 1 day. Values
are presented as the ratio of luciferase activity in 0.3 mM
K+ relative to 5.4 mM K+.
Panel C, a luciferase construct containing the 157 to
38-base pair region of the 1 subunit gene upstream of the MMTV
promoter was transfected into neonatal rat cardiac myocytes. Luciferase
plasmids containing either the MMTV promoter or the 102 to
+151-base pair region of the 1 subunit gene were introduced into
replicate plates of cells. Cells were cultured in serum-free medium
containing either 5.4 or 0.3 mM K+ for 1 day
and luciferase activity was determined as described above. For
panels A-C, data from three to four independent experiments
were pooled (n = 6 to 8). *, p < 0.05.
|
|
Partial Inhibition of Na,K-ATPase Activity and Extracellular
Ca2+ Are Required for Low K+ Stimulation of
Na,K-ATPase 1 Gene Expression--
A physiological reduction in
serum K+ in the range of 2 to 3 mM has been
shown to regulate Na,K-ATPase subunit gene expression in a
tissue-dependent manner (24). By contrast, incubation of cardiac myocytes in a medium containing a K+ concentration
of 1 mM or lower leads to Na,K-ATPase inhibition (10). To
determine whether Na,K-ATPase 1 subunit gene transcription was
regulated by either a physiological decrease in K+
concentration or a prolonged inhibition of Na,K-ATPase function, the
effect of several concentrations of K+ on 1 gene
activity was assessed in transient transfection experiments in primary
cultures of neonatal rat cardiac myocytes (Fig.
2). Relative to control cells incubated
with 5.4 mM K+, treatment with 2 mM
K+ had no effect on luciferase activity of the 102 to
+151 base pair construct while exposure to 1, 0.6, or 0.3 mM K+ for 1 day resulted in stimulation of
chimeric gene expression. Thus, a physiological concentration of
K+, 2 mM, did not stimulate Na,K-ATPase 1
expression, suggesting that partial inhibition of Na,K-ATPase activity
due to a limiting concentration of K+ was a necessary first
step in the signal transduction pathway which ultimately up-regulates
1 gene transcription.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 2.
Induction of 1 gene
transcription in response to various concentrations of extracellular
K+. Neonatal rat cardiac myocytes were prepared and
transfected as described in the legend to Fig. 1 with 1 µg of a
luciferase plasmid containing the 102 to +151-base pair region of the
1 gene. Cells were incubated for 1 day in serum-free medium with
lowered concentrations of K+. Luciferase activities are
expressed relative to the value derived from cells exposed to 5.4 mM K+. Data from three independent experiments
done in duplicate were pooled (n = 6). *,
p < 0.05.
|
|
Partial inhibition of Na,K-ATPase function by low external
K+ yields an increase in the intracellular concentration of
Na+ and a subsequent elevation in cytoplasmic
Ca2+ as a consequence of reduced
Na+/Ca2+ exchange activity (10). Given the
central role that Ca2+ plays in a myriad of signal
transduction systems, we evaluated the effect of the absence of
extracellular Ca2+ on the low K+-mediated
enhancement of Na,K-ATPase 1 gene expression. We first incubated
neonatal rat cardiac myocytes in the absence and presence of
Ca2+ and assessed the effect of low K+ on 1
mRNA content (Fig. 3, A
and B). In the presence of a normal concentration of
Ca2+ (2.1 mM), incubation of cells for 6 h
with 0.3 mM K+ yielded a 1.3 ± 0.1-fold
increase in Na,K-ATPase 1 mRNA abundance. The low K+
effect was abrogated, however, when cardiac myocytes were cultured in
Ca2+-free medium containing 0.1 mM EGTA and
then challenged with 0.3 mM K+ for 6 h.
Thus, low K+ stimulation of 1 mRNA levels requires
extracellular Ca2+. It is also important to note the
withdrawal of Ca2+ was associated with a significant
decrease in the content of 1 mRNA, suggesting that
Ca2+ by itself is capable of regulating Na,K-ATPase 1
gene expression. To further investigate the role of Ca2+ in
the low K+ effect on 1 gene transcription, we compared
the effect of low K+ in the absence and presence of
extracellular Ca2+ on the expression of the 102 to +151
1 gene construct (Fig. 3C). Treatment of cardiac myocytes
with 0.3 mM K+ for 6 h had no effect on
luciferase activity, either in the presence or absence of extracellular
Ca2+, when cells were transfected with a standard calcium
phosphate method. An extracellular
Ca2+-dependent 1.5 ± 0.1-fold increase in
luciferase activity was produced in response to a 6-h exposure to low
K+, however, when cells were transfected with Lipofectin.
This result is consistent with the finding that the low K+
effect on 1 mRNA requires extracellular Ca2+. The
reason for the discrepancy in the transient transfection results with
calcium phosphate versus Lipofectin transfection is not
known. We speculate that the influx of Ca2+ that occurs
with the calcium phosphate transfection procedure and the early time
point of analysis may be involved, since we have demonstrated in
transient transfection experiments utilizing either calcium phosphate
coprecipitation or Lipofectin that exposure to 0.3 mM
K+ for 24 h augments 1 chimeric gene expression to
the same extent (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 3.
Low K+ stimulation of
Na,K-ATPase 1 gene expression is dependent on
extracellular Ca2+. Panel A, replicate
plates of cardiac myocytes were incubated for 6 h in the absence
or presence of extracellular Ca2+ in serum-free medium
containing either 5.4 or 0.3 mM K+ as described
under "Experimental Procedures." A representative Northern blot
analysis of 1 mRNA content is shown. Panel B,
quantitation of the effect of extracellular Ca2+ on the low
K+-mediated increase in 1 mRNA. Na,K-ATPase 1
mRNA contents are expressed relative to the value derived from cells incubated in medium
containing 2.1 mM Ca2+ and 5.4 mM
K+. Panel C, neonatal rat cardiac myocytes were
transfected by either the calcium phosphate method or using Lipofectin
as detailed under "Experimental Procedures" with 1 µg of a
luciferase plasmid containing the 102 to +151-base pair region of
the 1 gene. Cells were incubated for 6 h in the absence or
presence of extracellular Ca2+ in serum-free medium
containing either 5.4 or 0.3 mM K+. Luciferase
activities in cells incubated in 0.3 mM K+ are
expressed relative to the value derived from cells exposed to 5.4 mM K+. Data depicted in Panels B and
C were derived from three independent experiments done in
duplicate were pooled (n = 6). *, p < 0.05.
|
|
A 21-Base Pair Sequence of the Na,K-ATPase 1 Gene Promoter Is
Necessary for Low K+-mediated Stimulation of 1 Gene
Transcription--
To initiate an investigation of the DNA sequence
motif involved in low K+-induced activation of Na,K-ATPase
1 gene expression, we carried out a computer-assisted examination of
the 102 to 42 base pair low K+ response region for the
presence of potential transcription factor binding elements (Fig.
4A). Putative CAAT and AP-2
motifs were identified at positions 84 and 78, respectively,
relative to the transcription start site of the 1 gene. In addition,
a potential GC box and E box were located at positions 61 and 49,
respectively.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
Sequence of the 102 to 42-base pair
region of the rat Na,K-ATPase 1 gene and the
effect of contraction on 1 gene
transcription. Panel A, potential transcription factor
binding sites in the low K+ response region are
underlined. R refers to the reverse complement.
Panel B, neonatal rat cardiac myocytes were transfected with
a luciferase plasmid containing the 102/+151 1 gene region and
incubated in serum-free medium as described under "Experimental
Procedures." Cells were exposed to either 10 µM
verapamil or 7.5 mM BDM in the presence of 5.4 mM K+ or incubated with 54 mM
K+ for 1 day. Luciferase activities are expressed relative
to the value derived from cells exposed to 5.4 mM
K+. Data from four independent experiments done in
duplicate were pooled (n = 8). *, p < 0.05.
|
|
E box elements are binding sites for members of the basic
helix-loop-helix leucine zipper family of transcription factors (25).
Moreover, the binding of a basic helix-loop-helix leucine zipper
protein to an E box motif has been shown to be necessary for
contractile-mediated up-regulation of the rat -myosin heavy chain
promoter (26). Since low K+ treatment of neonatal rat
cardiac myocytes leads to enhanced contractile activity and the low
K+ response region contains a potential E box element, we
evaluated the effect of contraction on Na,K-ATPase 1 gene
transcription in transient transfection studies (Fig. 4B).
Cultures of spontaneously contracting neonatal rat cardiac myocytes
were transfected with the 102 to +151 1 promoter construct and
treated for 24 h with 54 mM K+, 10 µM verapamil, or 7.5 mM BDM in serum-free
medium. All three interventions inhibit contractile activity of
cultured cardiac myocytes; however, they exert distinct effects on
intracellular Ca2+ (27). High K+ causes
membrane depolarization and elevates intracellular Ca2+
whereas verapamil and BDM decrease the intracellular concentration of
Ca2+ and reduces Ca2+ transients, respectively.
Relative to luciferase expression in spontaneously contracting control
cells incubated with 5.4 mM K+, luciferase
activity in cardiac myocytes exposed to 54 mM
K+ increased 3.7 ± 0.4-fold. By contrast, verapamil
and BDM treatment resulted in a significant decrease in Na,K-ATPase
1 promoter activity. Since all three agents effectively suppressed
contractile activity, it appears that low K+ up-regulation
of Na,K-ATPase 1 gene transcription is
contraction-independent.
To determine the precise DNA motif within the 102 to 42-base pair
region of the 1 promoter which mediates low K+
up-regulation of Na,K-ATPase 1 subunit gene transcription,
additional 5'-flanking deletion constructs were prepared. We first
quantitated basal expression of 1 promoter deletion plasmids in
serum-free medium containing 5.4 mM K+
(Fig. 5A). The 1 84
and 62 deletion constructs exhibited 60 and 42%, respectively, of
the promoter activity of the 102 plasmid. Further deletion of 1
5'-flanking sequence to 41 resulted in 9% luciferase expression
relative to the 102 to +151 base pair construct. In cells exposed to
0.3 mM K+ for 1 day, 1 promoter activity was
stimulated 1.8-1.9-fold in 1 deletion constructs containing
5'-flanking sequences from 102 to 62, whereas, consistent with data
presented in Fig. 1, low K+ treatment had no affect on the
41 to +151 1 construct (Fig. 5B). These data
demonstrate that a low K+ response element resides in the
62 to 42-base pair region of the 1 gene. To examine whether the
putative GC box located between nucleotides 61 and 52 of the 1
promoter is necessary for the low K+ effect, an additional
deletion mutant containing the 55 to +151-base pair region of the
Na,K-ATPase 1 gene was prepared and used in transient transfection
studies (Fig. 5C). Basal expression of the 55 plasmid in
the presence of 5.4 mM K+ was reduced 77%
relative to the 62 base pair reporter construct, and the low
K+-mediated stimulation of luciferase expression was
abolished in the 55 1 deletion mutant. Taken together, these
results indicate that a functional GC box in the 61 to 52 region of
the Na,K-ATPase 1 promoter plays a major role in basal expression
and mediates stimulation of 1 gene transcription in response to low
K+.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 5.
Basal and low K+-induced
transcription of 5' deletion constructs of the
1 promoter. Panel A, neonatal rat
cardiac myocytes were incubated and transfected as described in the
legend to Fig. 1 with 1 µg of luciferase plasmids harboring 5'
deletions of the 5'-flanking region of the 1 gene. Luciferase
activities are expressed relative to the value determined for the 102
to +151 plasmid which is set to 1.0. Panel B, cells were
transfected as in A and incubated in the presence of either
5.4 or 0.3 mM K+ for 1 day. Luciferase
activities in cells incubated in 0.3 mM K+ are
expressed relative to the value derived from cells exposed to 5.4 mM K+. Panel C, cardiac myocytes
were incubated and transfected as in A with 5 µg of
luciferase plasmids containing either the 62 to +151 or 55 to
+151-base pair region of the 1 gene. Cells were exposed to either
5.4 or 0.3 mM K+ for 1 day and luciferase
activity was assayed. Luciferase activities are expressed relative to
the value obtained for the 62 to +151 plasmid in cells treated with
5.4 mM K+. Panel D, cells were
transfected as in C and incubated in either 5.4 or 54 mM K+ for 1 day. Luciferase activities are
expressed relative to the value derived from cells exposed to 5.4 mM K+. Data shown in Panels A and
B were derived from seven to eight independent experiments
done in duplicate (n = 14-16). Data depicted in
Panels C and D were from three independent
experiments done in duplicate (n = 6). *,
p < 0.05.
|
|
To assess whether an increase in the intracellular concentration of
Ca2+ by itself is the underlying mechanism of the effect of
low K+, neonatal rat cardiac myocytes were transfected with
the 62 and 55 1 deletion constructs and cells were incubated
with either 5.4 or 54 mM K+ for 1 day (Fig.
5D). Exposure to 54 mM K+ and the
resultant increase in intracellular Ca2+ stimulated
luciferase expression from both deletion constructs; thereby suggesting
that elevated intracellular Ca2+ is not solely responsible
for up-regulation of Na,K-ATPase 1 gene transcription in response to
low K+. This result also indicated that Ca2+
responsiveness is mediated by the 55 to +151-base pair region of the
1 gene.
Sp1 and Sp3 Bind to a Na,K-ATPase 1 Gene Low K+
Response Element--
To investigate protein binding to the region of
the 1 promoter which is necessary for low K+-induced
augmentation of 1 gene transcription, nuclear extracts were prepared
from neonatal rat cardiac myocytes incubated in either 5.4 or 0.3 mM K+ for 1 day. Electrophoretic mobility shift
assays were conducted with nuclear extracts and an oligonucleotide
corresponding to the 67 to 35-base pair region of the Na,K-ATPase
1 gene. In both control and low K+-treated cells two
classes of protein-DNA complexes were detected and binding was enhanced
by low K+ (Fig.
6A). Quantitation of repeated
electrophoretic mobility shift assays revealed that low K+
yielded a 2.1 ± 0.4- and 3.0 ± 0.6-fold increase in the
intensity of lower and upper protein-DNA complexes, respectively
(Fig. 6B). Interestingly, incubation of neonatal rat
cardiac myocytes with low K+ for 1 day was associated with
a 26 ± 7% increase in the recovery of total nuclear protein
(n = 10, p < 0.05).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 6.
Low K+ increases binding to the
67 to 35-base pair region of the 1
promoter. Panel A, exposure of cardiac myocytes to low
K+, nuclear extract preparation and electrophoretic
mobility shift assay are described under "Experimental Procedures."
Representative binding of 3 µg of nuclear extracts derived from
control cells (lanes 1 and 2) and cardiac
myocytes exposed for 1 day to 0.3 mM K+
(lanes 3 and 4) to the labeled 67/ 35 1
oligonucleotide. Panel B, quantitation of the effect of low
K+ on upper and lower band formation
on the 67/ 35 1 oligonucleotide. Binding activities in cells
incubated in 0.3 mM K+ for 1 day are expressed
relative to the value derived from cells exposed to 5.4 mM
K+. Data from five independent experiments done in
duplicate were pooled (n = 10). *, p < 0.05.
|
|
To identify proteins that bind to the low K+ response
element of the 1 promoter, oligonucleotide competition analysis was conducted (Fig. 7A). Both
lower and upper protein-DNA complexes were significantly reduced when
gel shift assays contained either unlabeled 67 to 35 1 gene
oligonucleotide (lanes 3 and 4) or oligonucleotide Sp1 containing the consensus GC box sequence
(lanes 7 and 8). By contrast, the formation of
the two complexes was not affected when an oligonucleotide containing
an USF-1-binding site was used as a competitor (lanes 5 and
6). These results suggest that low K+-induced
protein binding occurs within the GC box of the low K+
response region of the 1 promoter.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 7.
Enhanced binding of Sp proteins to the
1 gene 67 to 35-base pair region in response to
low K+. Electrophoretic mobility shift assay
conditions and probe were the same as described in the legend to Fig.
6. Panel A, the effect of addition of competitor
oligonucleotides on upper and lower band formation was evaluated in 1 µg of nuclear extracts derived from control cells and cardiac
myocytes exposed to 0.3 mM K+ for 1 day.
Lanes 1 and 2 depict binding in the absence of
competitor oligonucleotides, lanes 3 and 4 show
the effect of preincubation with the unlabeled 67/ 35 1
oligonucleotide, lanes 5 and 6 represent factor
binding in the presence of an USF-1 oligonucleotide, and lanes
7 and 8 show the effect of addition of a Sp1
oligonucleotide containing a consensus GC box sequence. In these
experiments a 100-fold excess of competitor oligonucleotides was used.
Panel B, electrophoretic mobility shift assay was performed
with 1 µg of nuclear extracts (lanes 1 and 2),
or with extracts preincubated with 1 µg of anti-Sp1 (lanes
3 and 4), anti-Sp3 (lanes 5 and
6), anti-USF-1 (lanes 7 and 8), or
rabbit IgG (lanes 9 and 10). Panel C,
quantitation of the effect of inclusion of antibodies on upper band
formation. Panel D, binding of 1 µg of nuclear extracts
derived from control cells and cardiac myocytes exposed for 1 day to
0.3 mM K+ to either the wild type 67/ 35
1 oligonucleotide (lanes 1 and 2) or a GC box
mutant 67/ 35 oligonucleotide (lanes 3 and 4).
A minimum of three independent electrophoretic mobility shift assays
were performed.
|
|
To determine which member of the GC box-binding proteins was involved
in the low K+ response, electrophoretic mobility shift
assays were performed with 1 µg of nuclear extracts and 1 µg of
antibodies for Sp1, Sp3, and USF-1 (Fig. 7, B and
C). The lower protein-DNA complex was abolished in the
presence of anti-Sp3 antibody (Fig. 7B, lanes 5 and
6). By contrast, lower band formation was unaffected by either anti-Sp1 antibody (lanes 3 and 4),
anti-USF-1 antibody (lanes 7 and 8), or IgG
(lanes 9 and 10). Quantitation of the effect of
anti-Sp1 antibody on the upper protein-DNA complex revealed a 30%
decrease in DNA binding in nuclear extracts derived from low
K+-treated cardiac myocytes (Fig. 7C). Inclusion
of Sp3-specific antibody reduced the upper protein-DNA complex 42 and
60% in extracts from control and low K+-treated cells,
respectively (Fig. 7C). Neither anti-USF-1 antibody nor
IgG affected upper band formation. Essentially identical results were
obtained in electrophoretic mobility shift assays conducted with 1 µg
of nuclear extract and 4 µg of anti-Sp1 and anti-Sp3 antibodies (data
not shown). These data indicated that the lower protein-DNA complex was
formed by the binding of Sp3 while the upper complex represented a
combination of both Sp1 and Sp3. When the core GCG motif of the GC box
was mutated to TTT (Fig. 7D, lanes 3 and 4), both
lower and upper band formation were abolished, supporting the
contention that binding of Sp1 and Sp3 are necessary to mediate the
up-regulation of Na,K-ATPase 1 gene transcription in response to low
K+.
Role of Additional Putative GC Box Motifs in Regulation of 1
Gene Transcription by Low K+--
Within the 102 to
42-base pair region of the promoter of the rat Na,K-ATPase 1 gene
there exists multiple potential GC box elements (Fig.
8A). To assess the functional
role of these putative GC box motifs in low K+-mediated
transcriptional up-regulation of the 1 gene, we mutated the core GCG
sequence to generate the luciferase reporter constructs GC.1 Mut,
GC.1,2 Mut, and GC.1,2,3 Mut (Fig. 8A). Wild type and GC box
mutant reporter constructs were transiently transfected into neonatal
rat cardiac myocytes and the effect of incubation in 0.3 mM
K+ for 1 day was examined (Fig. 8B). Mutation of
the core sequence of the proximal GC box at 58 to 56 (GC.1 Mut)
decreased the magnitude of the low K+ effect by 31%. A
3-base pair mutation of both the proximal GC box and the adjacent
putative GC element at 67 to 65 (GC.1, 2 Mut) resulted in no
further decrease in low K+-mediated 1 gene
transcription. Interestingly, the stimulatory effect of low
K+ was abolished with reporter construct GC.1,2,3 Mut in
which the core sequence of all three potential GC box motifs was
altered. These results indicate that within the native 1 proximal
promoter two distinct regions are necessary for complete activation of transcription in response to low K+, the proximal GC box at
59/ 55 and a potential GC element at 102/ 98. Gel-mobility shift
analysis with wild type and mutant oligonucleotides indicated that the
Sp family of transcription factors bound the distal GC box (Fig.
9A). By contrast, the putative GC box at 68/ 64 does not appear to be functional in binding Sp
transcription factors. In addition, the functional GC box element at
59/ 55 appears to demonstrate higher affinity for Sp factors compared with the distal 102/ 98 site. Importantly, the distal GC
box at 102/ 98 binds transcription factors Sp1 and Sp3 (Fig. 9B) and binding of these factors is increased in response to
low K+ (Fig. 9C).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of GC box mutations on low
K+-induced transcription of the 1
promoter. Panel A, sequence of the 1 gene low
K+ response region with potential GC box motifs underlined.
R refers to the reverse complement. Wild type and GC box
mutant promoter constructs are shown. Panel B, neonatal rat
cardiac myocytes were incubated and transfected as described in the
legend to Fig. 1 with 5 µg of luciferase plasmids containing mutated
core GC box motifs. Cells were exposed to either 5.4 or 0.3 mM K+ for 1 day and luciferase activity was
assayed. Data shown was derived from three to five independent
experiments (n = 8-10). *, p < 0.05.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 9.
Binding of Sp1 and Sp3 to the distal GC box
in the 1 gene promoter. Electrophoretic
mobility shift assay conditions were the same as described in the
legend to Fig. 6. Panel A, the effect of addition of either
a competitor GC box oligonucleotide or a GC box mutation on
upper and lower band formation was evaluated in 5 µg of nuclear extracts derived from control cardiac myocytes
incubated in serum-free medium containing 5.4 mM
K+. Lanes 1, 4, and 7 depict binding
to oligonucleotides containing the 114/ 82, 86/ 62,
and 66/ 42 regions of the 1 promoter. The effect of preincubation
with a 100-fold excess of an oligonucleotide containing a consensus GC
box sequence on binding to the three oligonucleotides noted above is
shown in lanes 2, 5, and 8. Lanes 3, 6, and
9 represent binding to 114/ 82, 86/ 62 and 66/ 42
oligonucleotides each containing a 3-base pair mutation of the core GCG
motif. Panel B, the effect of preincubation with Sp1 and Sp3
antibodies on binding to the 114/ 82 oligonucleotide was evaluated
in 5 µg of nuclear extracts derived from control cardiac myocytes
incubated as in Panel A. 5 µg of nuclear extracts was
either incubated in the absence of antibody (lane 1), or
with extracts preincubated with 5 µg of anti-Sp1 (lane 2)
or anti-Sp3 (lane 3). Panel C, binding of 5 µg
of nuclear extracts derived from control cells (lane 1) and
cardiac myocytes exposed for 1 day to 0.3 mM K+
(lane 2) to the 114/ 82 1 oligonucleotide. Three
independent electrophoretic mobility shift assays were performed.
|
|
 |
DISCUSSION |
It is well established that extended incubation of mammalian cells
in medium containing a low external concentration of K+ is
associated with an up-regulation of Na,K-ATPase activity, content, and
subunit mRNA abundance; however, the underlying mechanism(s) remains to be determined at a molecular level. Previous work in our
laboratory (21) demonstrated that stimulation of Na,K-ATPase 1
subunit mRNA content in primary cultures of neonatal rat cardiac myocytes exposed to low K+ was mediated by the 102 to
+151-base pair region of the 1 promoter. In the present study, we
first determined that nucleotides between 102 and 42 in the 1
promoter were sufficient to confer low K+ responsiveness to
the luciferase reporter gene. The location of the low K+
response region within the non-transcribed, 5'-flanking region of the
Na,K-ATPase 1 gene indicates an augmentation of the rate of 1
gene transcription is responsible for low K+-mediated
increased abundance of 1 mRNA. This finding is consistent with
previous studies in which increased intracellular Na+ (28)
and exposure to ouabain (29) stimulated Na,K-ATPase 1 and 1 gene
transcription; thereby supporting the contention that elevated
intracellular Na+ is a common proximal signal in low
K+ and ouabain-mediated regulation of Na,K-ATPase subunit
gene transcription.
To begin to elucidate the molecular signal transduction pathway that
leads to up-regulation of Na,K-ATPase 1 subunit gene expression, we
determined that extracellular Ca2+ was necessary for low
K+-induced increases in 1 mRNA content and rate of
1 gene transcription. There are conflicting reports concerning the
requirement for Ca2+ in regulation of Na,K-ATPase subunit
gene expression following persistent inhibition of Na,K-ATPase
function. For example, a role of increased intracellular
Ca2+ in the ouabain-induced, transient augmentation of
Na,K-ATPase 1 and 1 gene transcription in rat kidney tubule cells
has been proposed (29). Similarly, Huang et al. (30)
found that Na,K-ATPase 3 subunit mRNA abundance was repressed by
ouabain treatment of neonatal rat cardiac myocytes in a
Ca2+-dependent manner. By contrast, Yamamoto
et al. (12) demonstrated that incubation of primary cultures
of neonatal rat cardiac myocytes with 1 mM ouabain yielded
a transient, Ca2+-independent increase in 1 mRNA
content. The discrepancy in the requirement for extracellular
Ca2+ in the ouabain-mediated effects on Na,K-ATPase 1
and 3 mRNA content may reflect an isoform-specific difference in
signal transduction pathways. Alternatively, as discussed previously
(30), the apparent Ca2+ independence of the
ouabain-mediated up-regulation of 1 mRNA abundance described by
Yamamoto et al. (12) might represent a nonphysiological
response to a toxic concentration of ouabain.
Our observation that incubation of neonatal rat cardiac myocytes in the
presence of 1 mM or lower concentrations of external K+ resulted in a stimulation of Na,K-ATPase 1 reporter
gene expression is consistent with an earlier study which demonstrated
an increase in Na,K-ATPase content in cardiac myocytes exposed to 1 mM K+ (10). Moreover, the lack of an effect of
2 mM K+ on 1 promoter activity conforms to
the contention that acute Na,K-ATPase inhibition, rather than low
K+ by itself, is the proximal event in the signal
transduction pathway that leads to regulation of Na,K-ATPase
expression. The molecular events underlying low K+ control
of 1 promoter activity are therefore likely to be distinct from the
mechanism(s) responsible for tissue-specific alterations in Na,K-ATPase
subunit gene expression in response to hypokalemia in vivo
that yield serum K+ concentrations in the range of 2 to 3 mM (24).
In the current study we examined the possibility that either an
increase in the intracellular concentration of Ca2+ or an
enhanced rate of myocyte contraction might be responsible for the low
K+-mediated augmentation in Na,K-ATPase 1 gene
expression. Our finding of increased 1 reporter gene expression in
contractile-arrested cardiac myocytes incubated with 54 mM
K+ is not consistent with the hypothesis that increased
contraction is the stimulus which promotes 1 up-regulation in
response to low K+. Similarly, we provide evidence that
elevated intracellular Ca2+ is not solely responsible for
the low K+ effect on Na,K-ATPase 1 gene expression.
Specifically, we show that the low K+ response region is
present within the 102 to 42-base pair region of the 1 promoter,
whereas nucleotides between 55 to +151 of the 1 gene are necessary
for increased 1 promoter activity in response to elevated
intracellular Ca2+ in myocytes cultured in the presence of
54 mM K+. It is important to note, however,
that our findings of increased Na,K-ATPase 1 gene expression as a
result of elevated intracellular Ca2+ are consistent with a
reported Ca2+-dependent stimulation of 1
mRNA content in rat kidney outer medullary tubular suspensions
(31).
To further investigate the molecular basis of low
K+-induced Na,K-ATPase 1 gene transcription, we carried
out a detailed transient transfection analysis of the effect of
5'-flanking region deletions of the 1 promoter on low K+
responsiveness. This approach lead to the localization of a low K+ response element to the 62 to 42-base pair region of
the 1 promoter. Importantly, 1 promoter activation by low
K+ was lost with a deletion construct that disrupted a GC
box motif at 61/ 52. The role of additional potential GC box
elements within the 102 to 42-base pair region of the 1 gene in
the low K+ response was evaluated in transient transfection
studies with luciferase plasmids containing 3-base pair mutations in
core GCG motifs at 58/ 56, 67/ 65, and 101/ 99. A reduction in
the degree of low K+-mediated stimulation of 1 gene
transcription demonstrated with the 58/ 56 mutation supports the
contention that the proximal GC box is necessary for the low
K+ response. It is important to note, however, that
mutation of the distal GC box at 101/ 99 yielded a significant
diminution of the low K+-induced increase in 1 gene
expression. Taken together, these results suggest that a cooperative
interaction between two functional GC box elements is required to
elicit maximal stimulation of Na,K-ATPase 1 gene transcription in
neonatal rat cardiac myocytes incubated in medium containing low
external K+.
To determine whether GC box-binding proteins were involved in the
stimulation of Na,K-ATPase 1 gene transcription by low K+, we examined binding of nuclear factors to
oligonucleotides containing both the proximal and distal GC boxes in
electrophoretic mobility shift assays. Two protein-DNA complexes were
detected and determined to increase in nuclear extracts derived from
low K+-treated cardiac myocytes. The observation of a low
K+-mediated increase in both complexes suggests a molecular
mechanism in which a stimulatory effect of nuclear factor binding to
the low K+ elements, rather than the release of a
repressor, is responsible for an enhanced rate of 1 gene
transcription. Inclusion of antibodies against transcription factors
Sp1 and Sp3 in mobility shift assays revealed that both Sp1 and Sp3
directly bound the 1 gene low K+ response elements. To
our knowledge, these findings represent the first definition of the
cis-element and transcription factors that are necessary for low
K+-mediated transcriptional regulation of a Na,K-ATPase
subunit gene. Sp1 and Sp3 proteins are ubiquitously expressed and both recognize GC box motifs to modulate rates of gene transcription in many
mammalian cells (32). Typically, Sp1 plays a stimulatory role in basal
transcription while Sp3 may either activate or repress transcription
(32). In our study, we provide evidence that binding of Sp1and Sp3 to
proximal and distal GC boxes in the 102 to 42-base pair region of
the Na,K-ATPase 1 gene leads to a stimulation of 1 gene
transcription in response to low K+. Whether enhanced
binding of Sp1 and Sp3 transcription factors to 1 gene GC box
elements is a consequence of either increased abundance of these
trans-acting proteins or post-translational modification remains to be
elucidated in future studies.
It is noteworthy that the recovery of nuclear protein increased 26% in
cardiac myocytes incubated for 1 day in medium containing low
K+ compared with controls. Moreover, we have found a
significant increase in total cellular protein and RNA content in
neonatal rat cardiac myocytes cultured for 3 days in the presence of
low K+ (data not shown). These observations suggest that
exposure of cardiac myocytes to low K+ results in cell
hypertrophy. Indeed, our findings are consistent with the report of
Huang et al. (33) that describes hypertrophy of neonatal rat
cardiac myocytes in response to incubation with ouabain. Interestingly,
GC box elements have been implicated in 1-adrenergic
regulation of atrial natriuretic factor (34, 35) and skeletal -actin
(36) gene transcription and associated hypertrophy of neonatal rat
cardiac myocytes. In addition, the nuclear content of Sp1 and Sp3 were
shown to be increased in a murine model of cardiac hypertrophy (37).
Taken together, it is tempting to speculate a general role for Sp
family transcription factors in mediating specific gene transcription
during the development of cardiac hypertrophy.
We contend that the delineation of the intracellular signal
transduction pathway associated with low
K+-dependent, up-regulation of Na,K-ATPase 1
subunit gene expression will provide physiologically relevant
information since partial inhibition of Na,K-ATPase function by several
distinct biomolecules has been implicated in the physiological and
pharmacological control of Na,K-ATPase activity. For example, digitalis
derivatives are widely used to reduce Na,K-ATPase function in the
pharmacological treatment of congestive heart failure and atrial
fibrillation (38). Furthermore, increased content of endogenous
digitalis-like factors has been demonstrated in several
pathophysiological conditions including essential hypertension (39,
40), pregnancy-induced pre-eclampsia (41), and acute myocardial
infarction (42). In addition, endothelin and interleukin-1 have both
been shown to inhibit Na,K-ATPase activity via augmentation of
prostaglandin E2 production (43, 44). Finally,
phosphorylation of the subunit of Na,K-ATPase by protein kinase A
(45), protein kinase C (46), or
Ca2+/calmodulin-dependent protein kinase (47)
decreases Na,K-ATPase activity. It is our contention that up-regulation
of Na,K-ATPase 1 gene expression in response to acute Na,K-ATPase
inhibition represents a highly conserved adaptive mechanism that is
responsible for maintaining ion homeostasis in a wide variety of cell types.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. J. Lingrel at the
University of Cincinnati for the gift of rat Na,K-ATPase 1 cDNA
and Dr. M. A. Q. Siddiqui at SUNY Health Science Center at
Brooklyn for the chicken MLC-2 luciferase construct. We thank Dr. A. Brassier at the University of Texas at Galveston for the gift of a rat
angiotensinogen luciferase plasmid.
 |
FOOTNOTES |
*
This work was supported by the New York City Affiliate of
the American Heart Association.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: State University
of New York Health Science Center at Brooklyn, Dept. of Biochemistry, 450 Clarkson Ave., Brooklyn, NY 11203. Tel.: 718-270-1265; Fax: 718-270-3316; E-mail: gickg11@bklynhsc.edu.
Published, JBC Papers in Press, May 12, 2000, DOI 10.1074/jbc.M002953200
 |
ABBREVIATIONS |
The abbreviations used are:
Na, K-ATPase, sodium
and potassium transport-dependent adenosine triphosphatase;
MMTV, mouse mammary tumor virus;
PCR, polymerase chain reaction;
MLC-2, myosin light chain-2;
BDM, 2,3-butanedione monoxime.
 |
REFERENCES |
| 1.
|
Lingrel, J. B.,
Orlowski, J.,
Shull, M. M.,
and Price, E. M.
(1990)
Prog. Nucleic Acids Res.
38,
37-89
|
| 2.
|
Jorgensen, P. L.
(1982)
Biochim. Biophys. Acta
694,
27-68
|
| 3.
|
Fambrough, D. M.,
Lemas, M. V.,
Hambrick, M.,
Emerick, M.,
Renaud, K. J.,
Inman, E. M.,
Hwang, B.,
and Takeyasu, K.
(1994)
Am. J. Physiol.
266,
C579-C589
|
| 4.
|
Young, R. M.,
and Lingrel, J. B
(1986)
Biochem. Biophys. Res. Commun.
145,
52-58
|
| 5.
|
Orlowski, J.,
and Lingrel, J. B
(1988)
J. Biol. Chem.
263,
10436-10442
|
| 6.
|
Martin-Vassalo, P.,
Dackowski, W.,
Emmanuel, J. R.,
and Levenson, R.
(1989)
J. Biol. Chem.
264,
4613-4618
|
| 7.
|
Malik, N.,
Canfield, V. A.,
Beckers, M.-C.,
Gross, P.,
and Levenson, R.
(1996)
J. Biol. Chem.
271,
22754-22758
|
| 8.
|
Arystarkhova, E.,
and Sweadner, K. J.
(1997)
J. Biol. Chem.
272,
22405-22408
|
| 9.
|
Boardman, L. J.,
Lamb, J. F.,
and McCall, D.
(1972)
J. Physiol.
225,
619-635
|
| 10.
|
Kim, S. D.,
and Smith, T. W.
(1984)
J. Clin. Invest.
74,
1481-1488
|
| 11.
|
Kennedy, D. G.,
Aronson, J. K.,
Bloomfield, J. G.,
and Grahame-Smith, D. G.
(1990)
Biochim. Biophys. Acta
1027,
218-224
|
| 12.
|
Yamamoto, K.,
Ikeda, U.,
Seino, Y.,
Tsuruya, Y.,
Oguchi, A.,
Okada, K.,
Ishikawa, S.,
Saito, T.,
Kawakami, K.,
Hara, Y.,
and Shimada, K.
(1993)
J. Clin. Invest.
92,
1889-1895
|
| 13.
|
Bluschke, V.,
Bonn, R.,
and Greeff, K.
(1976)
Eur. J. Pharm.
37,
189-191
|
| 14.
|
Whittaker, J.,
Hawkins, M.,
and Swaminathan, R.
(1983)
Life Sci.
32,
747-754
|
| 15.
|
Li, P. W. C.,
Ho, C. S.,
and Swaminathan, R.
(1993)
Int. J. Cardiol.
40,
95-100
|
| 16.
|
Ford, A. R.,
Aronson, J. K.,
Grahame-Smith, D. G.,
and Carver, J. G.
(1979)
Br. J. Clin. Pharmacol.
8,
135-142
|
| 17.
|
Cumberbatch, M.,
Zareian, K.,
Davidson, C.,
Morgan, D. M.,
and Swaminathan, R.
(1981)
Br. J. Clin. Pharmacol.
11,
565-570
|
| 18.
|
Bowen, J. W.,
and McDonough, A.
(1987)
Am. J. Physiol.
252,
C179-C189
|
| 19.
|
Pressley, T. A.,
Ismail-Beigi, F.,
Gick, G. G.,
and Edelman, I. S.
(1988)
Am. J. Physiol.
255,
C252-C260
|
| 20.
|
Tang, M. J.,
and McDonough, A. A.
(1992)
Am. J. Physiol.
263,
C436-C442
|
| 21.
|
Qin, X.,
Liu, B.,
and Gick, G.
(1994)
Am. J. Hypertens.
7,
96-99
|
| 22.
|
Wendt, C. H.,
Towle, H.,
Sharma, R.,
Duvick, S.,
Kawakami, K.,
Gick, G.,
and Ingbar, D. H.
(1998)
Am. J. Physiol.
274,
C356-C364
|
| 23.
|
Andrews, N. C.,
and Faller, D. V.
(1991)
Nucleic Acids Res.
19,
2499
|
| 24.
|
Azuma, K. K.,
Hensley, C. B.,
Putnam, D. S.,
and McDonough, A. A.
(1991)
Am. J. Physiol.
29,
C958-C964
|
| 25.
|
Dang, C. V.,
Dolde, C.,
Gillison, M. L.,
and Kato, G. J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
599-602
|
| 26.
|
Ojamaa, K.,
Samarel, A. M.,
and Klein, I.
(1996)
J. Biol. Chem.
270,
31276-31281
|
| 27.
|
Eble, D. M.,
Cadre, B. M.,
Qi, M.,
Bers, D. M.,
and Samarel, A. M.
(1998)
J. Cell. Mol. Cardiol.
30,
55-60
|
| 28.
|
Taormino, J. F.,
and Fambrough, D. M.
(1990)
J. Biol. Chem.
265,
4116-4123
|
| 29.
|
Rayson, B. M.
(1993)
J. Biol. Chem.
268,
8851-8854
|
| 30.
|
Huang, L.,
Kometiani, P.,
and Xie, Z.
(1997)
J. Mol. Cell. Cardiol.
29,
3157-3167
|
| 31.
|
Rayson, B. M.
(1991)
J. Biol. Chem.
266,
21335-21338
|
| 32.
|
Lania, L.,
Majello, B.,
and De Luca, P.
(1997)
Int. J. Biochem. Cell Biol.
29,
1313-1323
|
| 33.
|
Huang, L.,
Li, H.,
and Xie, Z.
(1997)
J. Mol. Cell. Cardiol.
29,
429-437
|
| 34.
|
Ardati, A.,
and Nemer, M.
(1993)
EMBO J.
12,
5131-5139
|
| 35.
|
Sprenkle, A. B.,
Murray, S. F.,
and Glembotski, C. C.
(1995)
Circ. Res.
77,
1060-1069
|
| 36.
|
Karns, L. R.,
Kariya, K.,
and Simpson, P. C.
(1995)
J. Biol. Chem.
270,
410-417
|
| 37.
|
Sack, M. N.,
Disch, D. L.,
Rockman, H. A.,
and Kelly, D. P.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
6438-6443
|
| 38.
|
Lee, C. O.
(1985)
Am. J. Physiol.
249,
C367-C378
|
| 39.
|
Blaustein, M. P.
(1993)
Am. J. Physiol.
264,
C1367-1387
|
| 40.
|
Gonick, H. C.,
Weiler, E. W. J.,
Khalil-Manesh, F.,
and Weber, M. A.
(1993)
Am. J. Hypertens.
6,
680-687
|
| 41.
|
Graves, S. W.,
Lincoln, K.,
Cook, S. L.,
and Seely, E. W.
(1995)
Am. J. Hypertens.
8,
5-11
|
| 42.
|
Bagrov, A. Y.,
Fedorova, O. V.,
Maslova, M. N.,
Roukoyatkina, N. I.,
Ukhanova, M.,
and Zhabko, E. P.
(1991)
Cardiovasc. Res.
25,
371-377
|
| 43.
|
Zeidel, M. L.,
Brady, H. R.,
Kone, B. C.,
Gullans, S. R.,
and Brenner, B. M.
(1989)
Am. J. Physiol.
257,
C1101-C1107
|
| 44.
|
Zeidel, M. L.,
Brady, H. R.,
and Kohan, D. E.
(1991)
Am. J. Physiol.
261,
F1013-F1016
|
| 45.
|
Fisone, G.,
Cheng, S. X. J.,
Nairn, A. C.,
Czernik, A. J.,
Hemmings, H. C., Jr.,
Hoog, J. O.,
Bertorello, A. M.,
Kaiser, R.,
Bergman, T.,
Jornvail, H.,
Aperia, A.,
and Greengard, P.
(1994)
J. Biol. Chem.
269,
9368-9373
|
| 46.
|
Fisone, G.,
Synder, G. L.,
Fryckstedt, J.,
Caplan, M. J.,
Aperia, A.,
and Greengard, P.
(1995)
J. Biol. Chem.
270,
2427-2430
|
| 47.
|
Netticadan, T.,
Kato, K.,
Tappia, P.,
Elimban, V.,
and Dhalla, N. S.
(1997)
Biochem. Biophys. Res. Commun.
238,
544-548
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. M. Dorrance, D. M. Pollock, O. P. Romanko, and D. W. Stepp
A high-potassium diet reduces infarct size and improves vascular structure in hypertensive rats
Am J Physiol Regulatory Integrative Comp Physiol,
January 1, 2007;
292(1):
R415 - R422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Barre, N. Venkatesan, J. Magdalou, P. Netter, S. Fournel-Gigleux, and M. Ouzzine
Evidence of calcium-dependent pathway in the regulation of human {beta}1,3-glucuronosyltransferase-1 (GlcAT-I) gene expression: a key enzyme in proteoglycan synthesis
FASEB J,
August 1, 2006;
20(10):
1692 - 1694.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Azakie, J. R. Fineman, and Y. He
Sp3 inhibits Sp1-mediated activation of the cardiac troponin T promoter and is downregulated during pathological cardiac hypertrophy in vivo
Am J Physiol Heart Circ Physiol,
August 1, 2006;
291(2):
H600 - H611.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Matlhagela, M. Borsick, T. Rajkhowa, and M. Taub
Identification of a Prostaglandin-responsive Element in the Na,K-ATPase {beta}1 Promoter That Is Regulated by cAMP and Ca2+: EVIDENCE FOR AN INTERACTIVE ROLE OF cAMP REGULATORY ELEMENT-BINDING PROTEIN AND Sp1
J. Biol. Chem.,
January 7, 2005;
280(1):
334 - 346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-E. Gingras, K. Larouche, N. Larouche, S. Leclerc, C. Salesse, and S. L. Guerin
Regulation of the Integrin Subunit {alpha}5 Gene Promoter by the Transcription Factors Sp1/Sp3 Is Influenced by the Cell Density in Rabbit Corneal Epithelial Cells
Invest. Ophthalmol. Vis. Sci.,
September 1, 2003;
44(9):
3742 - 3755.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhou, W. Yin, S. Q. Doi, S. W. Robinson, K. Takeyasu, and X. Fan
Stimulation of Na,K-ATPase by low potassium requires reactive oxygen species
Am J Physiol Cell Physiol,
August 1, 2003;
285(2):
C319 - C326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Gaudreault, P. Carrier, K. Larouche, S. Leclerc, M. Giasson, L. Germain, and S. L. Guerin
Influence of Sp1/Sp3 Expression on Corneal Epithelial Cells Proliferation and Differentiation Properties in Reconstructed Tissues
Invest. Ophthalmol. Vis. Sci.,
April 1, 2003;
44(4):
1447 - 1457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Flesch
On the trail of cardiac specific transcription factors
Cardiovasc Res,
April 1, 2001;
50(1):
3 - 6.
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|