 |
INTRODUCTION |
Human mitochondrial DNA
(mtDNA)1 is a 16.5-kb
circular double-stranded DNA molecule (1) that depends on many
nuclear-coded proteins for its maintenance and expression. A working
hypothesis for the mechanism of mtDNA replication was published almost
two decades ago (2), yet little is known about the key enzymes involved
in this essential cellular process. Synthesis of mtDNA is apparently
asymmetrical, with two-thirds of the leading strand being synthesized
before the lagging strand initiates. The displaced parental strand is
believed to be protected from intra-strand recombination and
illegitimate initiation events by the mitochondrial single-stranded
DNA-binding protein, mtSSB (3).
The human POLG gene encodes the catalytic subunit of what is
believed to be the only DNA polymerase active in mitochondria, polymerase 
, POLG (4-6). However, clear evidence that this enzyme functions in mtDNA replication in vivo remains lacking. POLG
and homologous enzymes, such as Mip1p in yeast (7), are related to the
Family A DNA polymerases, which include Pol I from Escherichia coli and phage T7 DNA polymerase (4, 5, 8, 9). The regions of
highest similarity between POLG and the Family A polymerases include an
NH2-terminal 3'-5' exonuclease domain involved in
proofreading, and a COOH-terminal region that in eubacterial members of
the family is essential for polymerase activity. Residues essential for
DNA polymerase activity have not yet been identified in any mitochondrial enzyme. A feature unique to human POLG is the presence of
a repeat of 13 glutamines, partly encoded by a run of 10 CAG codons
near to the NH2 terminus of the coding region. Population analysis implies that active selection maintains the CAG tract at or
near 10 repeats (10), which may indicate a stringent dependence of
catalytic activity on glutamine tract-length.
In Saccharomyces cerevisiae, specific Mip1p
residues have been shown to be critical for exonuclease activity
(11-13). In recombinant human POLG the double mutant
D198A/E200A is also exonuclease deficient in vitro
(14). Mutations that abolish Mip1p exonuclease activity in yeast result
in the accumulation of base substitutions in mtDNA, and in some cases
also in a significantly increased frequency of generation of
rho
cells carrying defective mtDNA (12, 13,
15). Exonuclease-deficient mip1 mutations are at least
partially dominant (13), meaning that even in the presence of wild-type
Mip1p, mutations accumulate in mtDNA. However, a role for the
exonuclease domain of POLG in maintaining the integrity of mtDNA in
humans has not been demonstrated. A mitochondrial mutator for human
cells would be an invaluable tool for studying the mechanisms involved
in the generation, accumulation, and phenotypic effects of human mtDNA
mutations, which are an important cause of human disease.
DNA replication requires the combined action of many proteins,
including those involved in nucleotide metabolism, DNA unwinding, priming of DNA synthesis, decatenation, and stabilization of
intermediary structures. Such proteins are predicted to assemble in a
large replication complex with DNA polymerase, but few of them have been identified in vertebrate mitochondria. Two examples are the mtSSB,
which can stimulate POLG activity in vitro (16-19) and the accessory (
) subunit of DNA polymerase (20), that enhances processivity in vitro (21) and has been proposed to play a
role in primer recognition, on the basis of structural considerations (22).
Thus far, human POLG has been characterized only in vitro,
via access to the purified or recombinant enzyme (5, 14, 16-18, 21,
23-25). We therefore set out to analyze the functions of the protein
and its constituent domains in vivo, using an episomal expression system in cultured cells. In this study we confirm, using
reporter constructs, that POLG is targeted in vivo to the inner face of the inner mitochondrial membrane and is functional as a
DNA polymerase. Long-term overexpression does not, however, affect
mtDNA levels, indicating that the polymerase is not limiting for the
overall rate of mtDNA synthesis. Via the expression of mutated versions
of the enzyme, we further demonstrate that the D198A mutation abolishes
detectable proofreading exonuclease activity in mitochondrial extracts
and promotes the accumulation of mtDNA mutations, leading to selection
in long-term cell culture. Mutations at either of 2 aspartate residues
in the COOH-terminal domain abolish DNA polymerase activity, inhibit
the endogenous enzyme, and cause mtDNA depletion. Catalytic activity is
unaffected by deletion of the CAG repeat, although expression is
modestly up-regulated. These results represent the first demonstration
of the functional roles and importance of POLG in the maintenance and
integrity of mtDNA in human cells.
| |
MATERIALS AND METHODS |
Cell Culture and Transfection--
HeLa and HEK293T cells were
cultured in Dulbecco's modified Eagle's medium containing 4.5 g/liter glucose, 2 mM L-glutamine, 1 mM sodium pyruvate, 50 µg/ml uridine, and 10% fetal
bovine serum, at 37 °C in a humidified atmosphere with 8.5%
CO2 in air. No antibiotics were added. HEK293T cells were
routinely detached by pipetting alone, and split 1:10-1:20. HeLa cells
were split after detaching the cells by a 5-min incubation in 10 mM EDTA. Cells transfected in 6-well culture plates were
seeded 1-2 days prior to transfection at 40-70% density.
Transfection routinely used 1 µg of DNA and 10 µl of LipofectAMINE
(Life Technologies, Inc.), diluted in 1 ml of Opti-MEM (Life
Technologies, Inc.) according to the manufacturer's protocol. Five
hours following transfection, 2 ml of fresh medium was added and, when
necessary, was replaced 24 h after transfection. Transfection
efficiency for HEK293T cells was routinely high (approximately 50%),
based on co-transfection with a -galactosidase-encoding construct,
but for HeLa cells was less than 1%. Transfections in 100-mm plates
were scaled up from these procedures. Following transfection, cells
were either processed after 24-48 h, or put under
GeneticinTM (Life Technologies, Inc.) selection (2 mg/ml,
prepared as a stock solution in PBS at 100 mg/ml) 48 h after
transfection. To improve selection, cells were successively replated to
eliminate untransfected cells. Geneticin-resistant clones were picked
by ringcloning, regrown in multiwell plates, and subsequently tested
for the presence of an expressed transgene by reverse transcriptase-PCR
or by Western blot analysis. Whole cell oxygen consumption was measured
essentially as described previously (26).
Plasmid DNA Constructs and in Vitro
Mutagenesis--
Site-directed mutagenesis of single residues of the
POLG cDNA (4) was carried out using the Altered SitesTM
II mutagenesis system (Promega), essentially according to the manufacturer's protocols. For this purpose, full-length POLG cDNA originally cloned in pcDNAI/Amp (4) was recloned in the pAlter-1 vector, and subjected to site-directed mutagenesis and ampicillin selection. Appropriate POLG fragments derived from selected plasmids were re-inserted into full-length POLG in pBluescript SK+
(Stratagene) and sequenced to confirm the presence of the mutation and
to ensure that no other mutations had occurred during the procedure.
Deletion of the CAG10 repeat was effected using a PCR-based method, and the resulting PCR product was also recloned into the pBluescript SK+-POLG construct. All constructs were finally
recloned in pcDNA3.1(
)/Myc-His A (Invitrogen) using a
high-fidelity PCR-based method. These final constructs contain the full
coding sequence plus 61 nucleotides from the 5'-untranslated region,
cloned in-frame with the Myc-His tag sequence using the
EcoRI and BamHI restriction sites of the vector.
The resulting fusion protein contains the 1239 amino acids of the POLG
precursor, followed by an additional 31 amino acids of the Myc-His tag,
with a predicted total molecular mass of 143 kDa. A similar
fusion was created for TUFM cDNA (27). GFP fusion proteins were
constructed by recloning cDNAs for POLG, TUFM, and mtTFA (kind gift
of Dr. R. Wiesner) in the pEGFP-N3 vector
(CLONTECH). All constructs were confirmed by DNA sequencing.
Monitoring of GFP Reporter Gene Expression by Fluorescence
Microscopy--
Cells were washed with Dulbecco's modfied Eagle's
medium 24 h after transfection and incubated in medium containing
100 nM Mitotracker Red (Molecular Probes) for 10-15 min.
The cells were washed twice in PBS, after which normal medium was
replaced and cells were incubated for a further 2 h at 37 °C.
They were then washed twice in PBS and fixed in 4% formaldehyde, 5%
sucrose in PBS for 10 min at 37 °C. After two final PBS washes the
coverslips were mounted on slides using Vectashield mounting medium
(Vector Laboratories) and visualized using an Olympus BX-50 microscope, with appropriate filters for Mitotracker Red (U-MWG, wavelength 510-550 nm) and enhanced green fluorescent protein (U-MWB,
wavelength 450-480 nm) fluorescence.
Polyacrylamide Gel Electrophoresis and Western
Blotting--
SDS-PAGE used 7.5-12% polyacrylamide (Laemmli) gels
run under standard conditions (28). All samples were heated prior to loading at 95 °C for 5 min in SDS-PAGE sample buffer (29) containing dithiothreitol (50 mM Tris-HCl, pH 6.8, 12% glycerol, 4%
SDS, 0.01% Serva Blue G, 0.1 M dithiothreitol).
Wetblotting to HybondTM-C extra nitrocellulose membrane
(Amersham Pharmacia Biotech) was carried out at 100 V for 1 h at
4 °C (30). Blots were blocked for 1 h at room temperature in
TBS-T (0.1% Tween) containing 5% freeze-dried fat-free milk powder,
washed several times with TBS-T, and reacted with primary antibody in
TBS-T overnight at room temperature. Primary antibodies and dilutions
used were: mouse anti-Myc monoclonal 9E10 (Roche Molecular
Biochemicals), 1:15,000 dilution of a 5 mg/ml stock, rabbit anti-mtSSB
(kind gift of Dr. M. Zeviani), 1:1000, rabbit anti--subunit of DNA
polymerase (kind gift of Dr. P. Lestienne), 1:5000, rabbit
anti-human mtTFA (kind gift of Dr R. Wiesner), 1:10000, rabbit
anti-complex IV (31, 32), 1:10000, and a mouse anti-COXII monoclonal
(kind gift of Dr. R. Capaldi), 1:10000. Blots were washed 2 × 10 s, 1 × 15 min, and 2 × 5 min in TBS-T, and then
incubated for 1 h at room temperature with peroxidase-conjugated
goat or horse secondary antibody (anti-mouse IgG (Bio-Rad or Vector
Laboratories, Inc.), 1:10000, or anti-rabbit IgG (Vector Laboratories,
Inc.)) in TBS-T. Blots were re-washed as above and finally with PBS. 5 ml of luminol solution (0.25 mg/ml sodium luminol (Sigma), 0.009%
H2O2, 0.1 M Tris-Cl, pH 6.8) and 50 µl of enhancer solution (1.1 mg/ml para-hydroxycoumaric acid (Sigma) in dimethyl sulfoxide) were mixed and incubated on each
blot for 1 min. Film (Kodak BiomaxTM ML) was exposed for
periods from 15 s to 45 min, as necessary. Silver staining was
carried out as described by Morrissey (33). Other gels were stained for
30 min in 0.1% Coomassie Brilliant Blue (Sigma) in 40% methanol, 10%
acetic acid. Destaining was carried out in 40% methanol, 10% acetic
acid followed by 10% methanol, 10% acetic acid.
Cell Lysis, Subcellular Fractionation, and
Immunoprecipitation--
Cell pellets, obtained by centrifugation at
1200 × gmax for 1 min, were lysed in PBS
containing 1.5% (w/v) lauryl maltoside and 2.5 mM
phenylmethylsulfonyl fluoride at 4 °C for 30 min, then centrifuged
at 16,000 × gmax for 1 min at 4 °C.
Supernatant and pellet were either stored at 80 °C or used
immediately for SDS-PAGE. Finer subcellular fractionation used a
standard procedure for mitochondrial isolation (34). Essentially, cells
were washed once with PBS, dislodged from the plate by pipetting up and
down in ice-cold NKM (1 mM Tris-HCl, pH 7.4, 0.13 M NaCl, 5 mM KCl, 7.5 mM
MgCl2) and centrifuged at 400 × gmax for 3 min at 4 °C. The cell pellet was
resuspended by gentle pipetting in 2 volumes of ice-cold 0.1 × homogenization buffer (4 mM Tris-HCl, pH 7.8, 2.5 mM NaCl, 0.5 mM MgCl2), kept on ice
for 5 min, then homogenized in a glass homogenizer with 20 strokes of a
tight-fitting pestle. Disruption of the cells was monitored by
microscopy. One-ninth volume of 10 × homogenization buffer was
added and nuclei and cell debris were pelleted by two sequential
centrifugations at 1,200 × gmax for 3 min
at 4 °C. Mitochondria from the post-nuclear supernatants were
recovered by centrifugation at 16,000 × gmax for 3 min at 4 °C. Mitochondrial pellets
from 1 ml of cytoplasm were washed once with 1 ml of ice-cold PBS and
either directly processed further or frozen at 80 °C.
Submitochondrial fractionation was carried out essentially as described
elsewhere (35, 36). Protease resistance of imported mitochondrial
proteins was verified as follows. A mitochondrial pellet obtained from
one or two 80% confluent, 175 cm2 cell culture flasks was
resuspended in PBS. An equal volume of 4 mg/ml digitonin (heat
solubilized in PBS), was added and samples were vortexed vigorously,
split into three equal portions, and incubated on ice for 5 min. An
additional 9 volumes of ice-cold PBS were added and samples were
centrifuged at 16,000 × gmax for 3 min at
4 °C, then washed twice in 1 ml of PBS. The resulting mitoplast
pellets were resuspended in a small volume of PBS and incubated for 10 min at room temperature either without any further additions, with 50 µg/ml trypsin (Fluka), or with 0.15% lauryl maltoside plus 50 µg/ml trypsin. 2 × SDS-PAGE sample buffer was added directly to
the last sample. The first two samples were pelleted, washed three
times with PBS, and finally resuspended in SDS-PAGE sample buffer.
Immunoprecipitations were carried out essentially as described
elsewhere (36). In brief, mitochondrial pellets containing up to 1 mg
of protein were lysed in PBS, 1.5% lauryl maltoside, 2.5 mM phenylmethylsulfonyl fluoride, incubated for 30 min on
ice, and centrifuged at 16,000 × gmax for
1 min at 4 °C. The supernatant was incubated on a rotary shaker at
4 °C for 2 h or overnight with 20-100 µl of 10% Protein
A-Sepharose CL-4B (Amersham Pharmacia Biotech), prepared in PBS, 1 mM EDTA, 1 mg/ml bovine serum albumin, and preincubated for
15 min with the appropriate antibody. The beads were pelleted at
14,000 × gmax for 10 s, washed once
with 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.5 M NaCl and three times with 10 mM Tris-HCl, pH
8.0, 1 mM EDTA, 0.05% lauryl maltoside. The final pellet
was resuspended in 1-2 volumes of SDS-PAGE sample buffer.
POLG DNA Polymerase and Exonuclease Assays--
POLG activity
was measured by means of an RNA-dependent DNA polymerase
(reverse transcriptase) assay, adapted from Longley et al.
(14). Freshly isolated mitochondria were lysed in 25 mM
Hepes-KOH, pH 8.0, 100 mM NaCl, 1% Triton X-100 so that
the final protein concentration was between 2.5 and 10 mg/ml. After incubation on ice for 30 min and centrifugation at 16,000 × gmax for 1 min at 4 °C, activity was assayed
in 10-µg aliquots of lysate in a final volume of 50 µl containing
25 mM Hepes-KOH, pH 8.0, 100 mM NaCl, 2.5 mM 2-mercaptoethanol, 10 µg/ml acetylated bovine serum
albumin, 0.5 mM MnCl2, 2.5 µg of
poly(rA)·oligo(dT) (Amersham Pharmacia Biotech), and 50 µg/ml
Aphidicolin. Reactions containing either no further inhibitor, or else
ddTTP as indicated, were preincubated for 5 min at room temperature
before the addition of 5 µl of a mixture of
[
-32P]dTTP (Amersham Pharmacia Biotech, 3000-6000
Ci/mmol) diluted 0.6:10 with 100 µM dTTP. Samples were
then incubated for 15 min at 37 °C, after which 10 µl was spotted
on a GFC filter, air-dried, washed three times with 5% trichloroacetic
acid then once with 70% ethanol, air-dried and counted using liquid
scintillation counting. For each lysate a control assay without
template was used to measure the background trichloroacetic
acid-precipitable counts. A method for exonuclease activity measurement
was adapted from existing protocols (12, 14, 24), using
primer-activated single-stranded M13mp18(+) (Amersham Pharmacia
Biotech). 50 pmol of paired or 3'-nucleotide-mispaired oligo (paired,
AB353: GTAAAACGACGGCCAGT; mispaired, AB354: GTAAAACGACGGCCAGA) were
5'-labeled using [-32P]ATP (Amersham Pharmacia
Biotech, 3000-6000 Ci/mmol) and T4 polynucleotide kinase (New England
Biolabs) according to the manufacturer's recommended procedure.
Polynucleotide kinase was inactivated for 10 min at 65 °C.
Hybridization of radiolabeled oligonucleotide and single-stranded M13
was carried out in a 25 µl of mixture containing 0.1 M
NaCl, 25 mM Hepes-KOH, pH 7.6, ~0.6 pmol of M13mp18 ssDNA
(1.5 µg), and 20 pmol of 32P-labeled AB353 or AB354. The
mixture was incubated for 10 min at 75 °C and allowed to cool slowly
to room temperature. Primer-hybridized M13 was further purified using
Sephadex G-50 spin columns (Roche Molecular Biochemicals) in a final
volume of approximately 50 µl. For each measurement 10 µg of
mitochondrial lysate (prepared as for the reverse transcriptase assay)
was used in a final volume of 100 µl containing: 25 mM
Hepes-KOH, pH 7.6, 5 mM 2-mercaptoethanol, 1 µg/ml
acetylated bovine serum albumin, 5 mM MgCl2, 2 µl of template (~25 fmol of primed M13mp18(+)) and 50 µg/ml
Aphidicolin. In some experiments 0.1 M NaCl was added,
which inhibits the exonuclease activity of POLG (24). Samples were
incubated at 37 °C and 10-µl aliquots were taken and directly
added to 10 µl of formamide sample buffer (95% formamide, 0.6% SDS,
25 mM EDTA, 0.05% w/v bromphenol blue and 0.05% (w/v)
xylene cyanol), at various time points varying from 0 to 20 min.
Samples were boiled for 2 min and run on a 15% polyacrylamide, 7 M urea sequencing gel. The gel was fixed in 10% acetic
acid, 15% ethanol, dried, and autoradiographed. Control reactions were
carried out without the addition of mitochondrial lysate.
Protein and Peptide Analysis--
For amino-terminal sequence
analysis, proteins separated by gel electrophoresis and electroblotted
on polyvinylidene difluoride, the membranes were sequenced by automatic
Edman degradation on an Applied Biosystems pulsed liquid-phase
sequencer (model 477A). At the end of each cycle of Edman degradation,
the phenylthiohydantoin-derivative was separated from reaction
by-products products using an Applied Biosystems HPLC apparatus (model
120A) on a Browlee C18 reverse phase column (Spheri-5
phenylthiohydantoin, 5 m, 220 × 2.1 mm). Data were analyzed
with the Applied Biosystems Data Analysis System software (model 610A,
version 1.2.2). For MALDI analysis, protein-containing gel slices were
S-alkylated, digested with trypsin (Roche Molecular Biochemicals,
sequencing grade), and extracted according to Shevchenko et
al. (37). Only the peptides eluted with 20 mM
NH4HCO3 were used in the MALDI analysis. After
drying in a vacuum centrifuge the peptides were dissolved in 10 µl of
0.5% trifluoroacetic acid, 50% acetonitrile. 0.5 µl of the this
solution was mixed with 0.5 µl of a 10 mg/ml
-cyano-4-hydroxycinnamic acid (Sigma)/acetone solution. Prior to
dissolving the -cyano-4-hydroxycinnamic acid was washed briefly with
1/10 of the final volume of acetone. 0.5 µl of the mixture was
spotted on the target and allowed to dry at room temperature. MALDI
spectra were acquired on a Micromass Tof Spec 2EC (Micromass,
Wythenshawe, UK), equipped with a 2 GHz LeCroy LSA-1000 digitizer
(LeCroy Corp., Chestnut Ridge, NY). The resulting peptide spectra were
used to search a nonredundant protein sequence data base
(SWISS-PROT/TREMBL) using the Proteinprobe program.
Miscellaneous DNA and RNA Manipulations--
Total cellular DNA
was isolated, EcoRI digested, and subjected to Southern
analysis as described elsewhere (38, 39). Total cellular RNA was
isolated using TRIzolTM reagent (Life Technologies) by the
manufacturer's recommended procedure and Northern blots were carried
out as described previously (40). Northern hybridization probes for
POLG and for glyceraldehye-3-phosphate dehydrogenase
(CLONTECH) were synthesized by random-primed
labeling of coding region PCR products in the presence of
[-32P]dCTP (Amersham Pharmacia Biotech, 3000-6000
Ci/mmol). Hybridization and final wash were at 65 °C.
Autoradiographic signals were analyzed using a PhosphorImager
(Molecular Dynamics). DNA sequencing used either DuPont
35S-Sequetide or dye-terminator chemistry on the
Perkin-Elmer ABI 310 Genetic Analyzer, with kit reagents supplied by
the manufacturer and vector- or POLG-specific primers.
mtDNA Sequence Analysis--
EcoRI digested total
cellular DNA (as above) was phenol extracted, ethanol precipitated, and
resuspended at a concentration of 50 ng/µl. Mitochondrial DNA
fragments of either 685 bp (np 3013-3698 of the Cambridge Reference
Sequence, Ref. 1) or 481 bp (np 2977-3457) were amplified from
100 ng of total cellular DNA or 1 ng of plasmid DNA containing the
previously cloned fragment, in a 50-µl reaction containing 250 µM dNTPs, 2.5 units of Pfu DNA polymerase
(StratageneTM), and 100 ng of each of the following
oligonucleotide primer pairs: 685-forward, GGTGCAGCCGCTATTAAAGGTCG, and
685-reverse, CCGATCAGGGCGTAGTTTG; or 481-Forward, GTTTACGACCTCGATGTTGG
and 481-Reverse, CAGCGAAGGGTTGTAGTAGC. Amplification conditions were as
follows: initial denaturation 45 s at 94 °C; 20 cycles of
45 s at 94 °C, 45 s at 55 °C, and 2 min at 72 °C;
final cycle of 10 min at 72 °C. PCR products and water controls were
checked by agarose gel electrophoresis. 4 µl of appropriate PCR
reactions were used subsequently for direct cloning using the Zero
BluntTM TOPOTM PCR cloning kit
(InvitrogenTM) according to the manufacturer's
instructions. DNA was isolated from individual clones grown overnight.
Part of the mtDNA insert (np 3036-3380) was sequenced as above,
using vector-specific primers. All sequences were manually checked and
aligned using DNASTAR SeqManTM II software (DNASTAR Inc.)
for easy identification of the mutations. Identified mutations were
rechecked on the original electrophoretograms.
| |
RESULTS |
Tagged POLG Is Targeted to Mitochondria in Vivo--
To confirm
that the POLG protein is targeted to mitochondria we constructed
reporter gene fusions of full-length POLG, fused at the COOH terminus
to a Myc tag (POLG-myc), or to green fluorescent protein
(POLG-GFP). Transient expression by liposome-mediated transfection of
POLG-GFP into a variety of human cell lines showed a specific green
fluorescent staining pattern typical of mitochondria (Fig.
1). This was confirmed by co-staining
with Mitotracker Red (a mitochondrion-specific dye). Similar staining
patterns were observed with equivalent reporter constructs for several
known mitochondrial proteins, including the mitochondrial transcription factor mtTFA, and mitochondrial translational elongation factor EF-Tu,
TUFM (not shown). No nuclear staining was observed in any of the
experiments. Mitochondrial green fluorescence was uniform, i.e. no subfraction of mitochondria, such as in a
perinuclear location, showed more intense or specific fluorescence.
Transfection with the unmanipulated GFP vector resulted in uniform,
diffuse staining in the cytosol, with no evidence of specific
localization to mitochondria (data not shown).
View larger version (50K):
[in this window]
[in a new window]
|
Fig. 1.
Fluorescence micrographs of cells transiently
transfected with the POLG-GFP construct and counterstained with
Mitotracker Red. a, green fluorescent protein
expression is clearly visible in filamentous cytoplasmic structures of
2 cells in the field. b, Mitotracker Red stains the
same structures in these cells, revealing them as mitochondria.
|
|
HEK293T cells stably expressing POLG-myc (see below) were used in
subcellular and submitochondrial fractionation studies, with analysis
by Western blotting against the anti-Myc monoclonal antibody that
recognizes the epitope tag. Lauryl maltoside lysis revealed that
POLG-myc, like the LacZ-myc control, was mainly cytoplasmic rather than
nuclear (Fig. 2). Further fractionation (Fig. 3) showed that the majority of
POLG-myc co-purifies with mitochondria, being found mainly in the inner
mitochondrial membrane fraction, together with COXII (subunit II of
cytochrome c oxidase), but absent from the matrix fraction,
which is heavily enriched for glutamate dehydrogenase. A small
proportion of the POLG-myc was also detected in the outer membrane
fraction, a pattern similar to that exhibited by endogenous mtTFA,
mtSSB, and also the putative -subunit of DNA polymerase (Fig.
3a).
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
Episomal expression of POLG-myc fusion genes
in permanently transfected cell lines. a and
b, Western blots from SDS-7.5% PAGE gels probed using the
anti-Myc monoclonal antibody. a, lauryl maltoside
(cytoplasmic) extracts from untransfected HEK293T cells, cells
transfected with the vector only (293T-myc), or Myc-tagged proteins.
D198A-myc2 and -3 denote two independent cell
clones expressing the D198A-myc variant. b, pellets and
supernatants after lauryl maltoside extraction from cells expressing
LacZ-myc and POLG-myc. c, Northern blot of approximately 20 µg of total RNA from the same cell lines, plus a line expressing a
POLG-myc variant with a large (2 kb) in-frame deletion within the
coding sequence ( 2POLG-myc). The top panel was probed for
POLG, the bottom panel is the same blot stripped and
reprobed for glyceraldehye-3-phosphate dehydrogenase (G3PDH)
as a loading control. Autoradiographic exposure time was 2 h in
both cases. The 3-kb POLG-reactive band from cell line 2POLG-myc was
faintly visible after overnight exposure, but not the endogenous
POLG mRNA.
|
|
View larger version (9K):
[in this window]
[in a new window]
|
Fig. 3.
Western blot analysis of submitochondrial
localization of POLG-myc fusion protein. Blots from SDS-PAGE gels
were probed using the anti-Myc monoclonal antibody, polyclonal
antibodies against human mtTFA, mtSSB, the putative -subunit of DNA
polymerase or glutamate dehydrogenase, or a monoclonal antibody
against COXII. a, proteins from submitochondrial fractions
as indicated (OM, outer membrane; IM, inner
membrane), separated on a 7.5% polyacrylamide gel (each lane
represents an equal amount of the starting material prior to
fractionation). Blots probed with the anti-Myc antibody and, after
stripping, with the anti-glutamate dehydrogenase antibody. For
successive detection of mtTFA, mtSSB, COXII, and the putative
-subunit the proteins were separated on a 12% polyacrylamide gel
(IM lane represents twice as much unfractionated starting
material as the other lanes). Membrane localized proteins such as COXII
are not found in the matrix fraction (data not shown). b,
protease accessibility of POLG-myc in mitochondria and mitoplasts (see
"Materials and Methods"). Analysis was via a 7.5% polyacrylamide
gel, probed by Western blotting with the anti-Myc monoclonal.
|
|
The POLG-myc found in intact mitoplasts was resistant to trypsin
digestion, but lysis of either mitochondria or mitoplasts with low
concentrations of lauryl maltoside rendered it trypsin-sensitive (Fig.
3b). These results imply that POLG-myc is imported into mitochondria and localized mainly on the inner face of the inner membrane. Similar results were obtained for TUFM-myc (data not shown).
Expressed POLG-myc was immunoprecipitated from mitochondrial lysates as
a 140-kDa polypeptide whose identity was confirmed by MALDI mass
spectrometry. NH2-terminal sequencing failed, however, indicating that the amino terminus is blocked. Parallel analysis of
TUFM-myc revealed an unblocked, processed NH2 terminus
(data not shown). The most NH2-terminal tryptic peptide
found in the MALDI analysis began with glutamine 43, a short distance
downstream of a processing site predicted by PSORT. Crucially,
the detection of this peptide confirms that the polyglutamine
tract is included in the mature protein. Overall, these results
indicate that POLG-myc expressed in cultured human cells appears
to be appropriately targeted and processed.
POLG-myc Can Be Stably Overexpressed in Cultured Human HEK293T
Cells--
We constructed Myc-tagged variants of POLG each carrying
one of the following mutations: D198A in the exonuclease domain, a
position analogous to residue Asp171 of yeast Mip1p
previously demonstrated to be essential for proofreading exonuclease
activity (13), D890N and D1135A in the putative polymerase domain,
proposed to be analogous to catalytically essential residues
Asp705 and Asp882 of E. coli Pol I
(29, 41), and deletion of the 10 glutamine residues encoded by the CAG
repeat. Each variant was transfected into human HEK293T cells, which
express the SV40 large T-antigen thus facilitating high level
expression via episomal maintenance of the multicopy vector that
contains the SV40 replication origin. Using this approach, several
independent cell lines were established expressing each of wild-type
POLG-myc, POLG-myc with the D198A mutation (hereafter abbreviated as
D198A-myc), or POLG-myc containing the polyglutamine repeat deletion
(Q10-myc), plus vector, TUFM-myc, and LacZ-myc controls
(Fig. 2). In two additional cases, clonal cell lines expressed an
internally deleted variant of POLG-myc. These were not studied further.
Expression of POLG-myc transgenes was verified by Western and Northern
blotting (Fig. 2), and was stably maintained in all cell lines over a
period of at least 3 months.
Transfection of constructs encoding the D890N-myc and D1135A-myc
variants did not give rise to any clones expressing the transgene, despite repeated attempts to isolate such clones. We analyzed 50 geneticin-resistant colonies from several transfections using each of
the mutant constructs, but found none positive for expression. This was
not due to any inherent problem in the expression of these variants,
such as a frameshift mutation not detected by DNA sequencing, since
they were successfully expressed transiently, at approximately the same
level as wild-type POLG-myc (Fig.
4c). However, expression of
the mutant transgenes declined sharply during the 2 weeks following
transfection, even under geneticin selection.
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
DNA polymerase activity in mitochondrial
extracts. a, POLG RNA-dependent DNA
polymerase (reverse transcriptase) activity (arbitrary units AU,
normalized to template-dependent 32P
incorporation in extracts from control cells transfected with episomal
vector). All assays contained the same amount of mitochondrial protein.
b, sensitivity of RNA-dependent DNA polymerase
activity to inhibition by ddTTP. c, Western blot of lauryl
maltoside extracts from HEK293T cells transiently transfected with the
vector only (293T-myc), or POLG-myc variants, prepared either 2 days
after transfection (2d), or after 2 weeks of culture in the
presence of geneticin (2w). The Myc-tagged POLG polypeptide
is indicated by an arrow. d, POLG
RNA-dependent DNA polymerase activity, as in panel
a, of mitochondrial protein extracts prepared from transiently
transfected cells 2 days after transfection. The higher polymerase
activity seen in Q10-myc extracts reflects a higher
concentration of the protein in this extract, confirmed by
immunoprecipitation from the extract, followed by SDS-PAGE and
Coomassie staining (not shown).
|
|
Overexpressed POLG-myc Is Catalytically Active as a Mitochondrial
DNA Polymerase--
Mammalian mtDNA polymerase activity is routinely
measured by its rate of incorporation of radioactive dTTP on a primed
RNA template, poly(rA):oligo(dT), i.e. by its reverse
transcriptase activity, in the presence of aphidicolin. Crude
mitochondrial fractions were prepared from stable or transiently
transfected cell lines using hypotonic lysis and differential
centrifugation. The polymerase activity was measured in Triton X-100
lysates of the freshly prepared mitochondria. Cell lines stably
expressing POLG-myc, D198A-myc, or Q10-myc, exhibited
7-15-fold increased polymerase activity, compared with
vector-transfected cells (Fig. 4a). Immunoprecipitation of
the same lysates with the anti-Myc monoclonal antibody, followed by
SDS-PAGE and Coomassie staining, showed a correspondence between the
DNA polymerase activity and the amount of POLG-myc present in the
lysate (data not shown). Extracts from cells expressing the
Q10-myc variant consistently showed elevated levels of
protein and polymerase activity compared with all other lines.
Expression of Q10-myc at the RNA level (Fig.
2c) may also be elevated, compared with cells expressing the
other variants. The polymerase activity was almost completely inhibited
by ddTTP (Fig. 4b) under similar conditions to those previously published for the purified POLG protein in vitro
(14).
The D198A Mutation Abolishes Detectable POLG Proofreading
Exonuclease Activity--
Proofreading (3'-5') exonuclease activity
was studied in the same extracts from stably transfected cells (Fig.
5), using a primed M13 DNA substrate,
with either a perfectly matched or a 3' terminal mismatched primer.
Significant activity was not detected in extracts from
vector-transfected cells, but was easily detected in extracts from
cells expressing wild-type POLG-myc or Q10-myc. As
predicted for the POLG-associated 3'-5' exonuclease, the reaction yielded a ladder of products whose mean size declined with time (Fig.
5c). In addition, activity was greater on a 3' mismatched than a perfectly base paired substrate (Fig. 5a), and, as
expected from previous studies of purified POLG (14, 24) was inhibited by 100 mM NaCl (Fig. 5b). High salt did appear
to activate another nuclease activity already present in lysates from
control cells, that did not give a ladder of products (Fig.
5b and other data not shown). The enhanced 3'-5' exonuclease
activity was not found in mitochondrial extracts of two independent
clonal cell lines expressing D198A-myc, consistent with the prediction
that this mutation alone results in exonuclease deficiency.
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5.
Exonuclease activity in mitochondrial
extracts, assayed by degradation of labeled oligonucleotides base
paired to M13 ssDNA. Reaction products were analyzed on 7 M urea, 15% polyacrylamide gels. a, adjacent
narrow lanes of a gel loaded with ice-quenched reactions representing a
time course for each extract, using the two 17-nucleotide
(nt) substrates (arrows) described under
"Materials and Methods." A separate time course for the wild-type
POLG-myc extract is shown in panel c, indicating the
ladder of shorter products. Note that the enhanced activity of the
Q10-myc variant reflects its greater expression at the
protein level. b, salt inhibition of the exonuclease
activity. Reactions containing 100 mM NaCl (10 min
incubation with each lysate, loaded in adjacent narrow lanes): compare
with panel a. A large excess of the unreacted substrate is
also shown in panel b, to indicate that the ladder of
products is not generated except when mitochondrial lysate from
transfected cells is present.
|
|
In summary, POLG-myc expressed episomally at high levels had the
catalytic properties expected of mitochondrial DNA polymerase. The
stably expressed D198A-myc mutant was defective in exonuclease activity, whereas the Q10-myc variant was catalytically
indistinguishable from wild-type, although with a somewhat higher expression.
Stable Overexpression of POLG-myc Does Not Disturb Mitochondrial
Function--
Cell lines stably expressing POLG-myc, D198A-myc, and
Q10-myc were analyzed over a period of several months
following transfection, in order to determine whether mitochondrial
function was affected by transgene expression. Fig.
6 shows the results of these experiments, in which mtDNA content and whole cell oxygen consumption were studied.
The values were generally within the range of variation seen over
comparable time periods or for sister clones of control cells, although
cells expressing Q10-myc had a relatively low mtDNA
content (Fig. 6b). Oxygen consumption for two lines
expressing D198A-myc was at the low end of the normal range.
Two-dimensional blue native-SDS-PAGE (42-44) did not reveal any
difference in the amount, composition, or assembly state of the
mitochondrial redox complexes in stably transfected cells expressing
wild-type POLG-myc, D198A-myc, or Q10-myc (data not
shown). Western blots (Fig. 3 combined with other data not shown)
indicated that there was no up-regulation of the expression of mtTFA,
mtSSB, or the putative -subunit of DNA polymerase .
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of long-term expression of
POLG-myc. a, oxygen consumption of cell lines as
described in the legend to Fig. 2. b, relative amounts of
mitochondrial DNA in untransfected (293T) and POLG-myc transfected
cells, based on Southern blotting and co-hybridization to a
mitochondrial and an 18 S rDNA probe for normalization. Hybridizations
were analyzed by PhosphorImaging and arbitrarily normalized to the
mtDNA, 18 S rDNA ratio for a DNA extract from untransfected
cells.
|
|
However, two observations suggest that cell clones expressing D198A-myc
were less healthy than POLG-myc, Q10-myc, or control cells. First, the cells grew significantly more slowly (approximately 30% longer doubling times) than the other cell lines, and also appeared to acidify their media more rapidly. Second, they were more
sensitive to ethidium bromide treatment, which is routinely used to
deplete cultured human cells of their mtDNA (45). These observations
are consistent with a mild impairment of mitochondrial metabolism in
D198A-myc cells.
Polymerase-deficient POLG-myc Variants Inhibit mtDNA Replication in
vivo--
Because the D890N-myc and D1135A-myc variants could not be
obtained as stably expressing cell lines, they were studied by transient expression in HEK293T cells. The amounts of expressed protein
in these extracts was comparable with that from wild-type POLG-myc-transfected cells (Fig. 4c), indicating that the
mutant proteins are stable. Crude mitochondrial extracts prepared from cells 48 h after transfection with wild-type POLG-myc showed
approximately 5-fold enhancement of polymerase activity compared with
vector-transfected cells (Fig. 4d). By contrast, extracts
from cells transfected with the D890N-myc and D1135A-myc mutant
proteins consistently showed inhibition of the endogenous polymerase
activity comparable with that produced by ddTTP. Mixing experiments
(data not shown) indicated that the inhibition was indirect,
i.e. that synthesis by a given amount of wild-type POLG-myc
extract was not directly inhibited by extracts from D890N-myc or
D1135A-myc transfected cells, other than as a result of dilution. The
inhibition of endogenous activity in extracts from D890N-myc or
D1135A-myc transfected cells is therefore most likely due to the fact
that expression from the mutant constructs overwhelms that of the
endogenous enzyme and competes with it for recruitment into
mitochondrial DNA synthesis complexes.
Compared with vector-transfected cells, cells transfected with
D890N-myc or D1135A-myc also showed a reproducible and sustained decrease in mtDNA levels, over the 96 h following transfection (Fig. 7). Relative mtDNA levels fell
progressively to approximately 60-70% of control values. Given that
about half of all cells in such cultures were successfully transfected,
this must indicate a complete or almost complete inhibition of mtDNA
replication in cells expressing the polymerase-deficient POLG-myc
variants. This is also consistent with the polymerase activity
measurements at 48 h, indicating an inhibition of endogenous
activity.
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 7.
Mitochondrial DNA depletion by transient
expression of polymerase-deficient POLG-myc. a, time
course of mtDNA depletion in cells transiently transfected with
POLG-myc (filled circles) and the two polymerase-deficient
variants D890N-myc (open circles) and D1135A-myc (open
squares), based on PhosphorImager analysis of Southern blots such
as shown in panel b. The ratio of hybridization signals for
mitochondrial and nuclear DNA at each time point was normalized to that
for cells transiently transfected with the vector (293T-myc), analyzed
in parallel. The data plotted are the mean and S.E. of three
independent experiments, except for the 48-h time point which was taken
only on one occasion. Note that the S.E. for the D1135A-myc 96-h time
point cannot be plotted since it was very small. Variation between
experiments is probably attributable to small differences in
transfection efficiency, which was generally close to 50%, based on
the use of internal -galactosidase controls. b, Southern
blot showing relative mtDNA levels in cells transiently transfected
with vector only (293T-myc), POLG-myc, and the two polymerase-deficient
variants D890N-myc and D1135A-myc, alongside a DNA sample from A549
lung carcinoma  0 cells, to indicate the identity of the
mtDNA-derived band. DNA samples were extracted 96 h after
transfection.
|
|
Exonuclease-deficient POLG-myc Promotes Accumulation of mtDNA
Mutations in Vivo--
If overexpressed POLG-myc is functional in
mtDNA replication or repair in vivo, long-term expression of
the D198A-myc variant that lacks proofreading exonuclease activity is
expected to result in the accumulation of mtDNA mutations. Cells
expressing D198A-myc showed evidence of only a very mild impairment of
mitochondrial function. Nevertheless, we reasoned that the lack of a
clear mitochondrial phenotype in cells expressing D198A-myc could be
masked if most mtDNA mutations are functionally recessive and hence
complemented by wild-type sequences present in other mtDNA molecules.
We therefore analyzed a short region of the mitochondrial genome, by
means of a carefully controlled high-fidelity PCR approach using
Pfu DNA polymerase. We amplified through 20 cycles a region
of mtDNA spanning portions of the 16 S rRNA, tRNA-leu(UUR), and ND1
genes from bulk cultures of cells expressing D198A-myc, wild-type
POLG-myc, and 293T-myc (vector only), grown continuously for 3 months.
The PCR products were cloned, and randomly selected insert-containing clones sequenced. To estimate the maximum rate of PCR-induced mutation,
we amplified a previously sequenced clone of the same fragment using
the same procedure, and picked and sequenced a set of clones.
After correcting for the background of PCR-induced mutations
(approximately 1 mutated base per 20 kb of sequence), there was no
significant mtDNA diversity in the cell lines transfected either with
vector or with wild-type POLG-myc (Table
I). By contrast, two independent clones
of D198A-myc cells grown for 3 months had each accumulated a
significant mutation load in mtDNA, equivalent to 1 mutated base every
1700 bp. Assuming an upper limit for the background of PCR-induced
mutations in our assay of 1 per 15 kb, Poisson statistics indicate that
the chance of finding 37 or more mutations in 61 kb of sequence would
be less than 1022. All three deviations from the
reference sequence detected in the clone control or in
vector-transfected cells were transversions, whereas mtDNA mutations in
the D198A-myc expressing cells (Table II)
were mainly transitions (29 out of 37), with half of all mutations representing the replacement of heavy strand C residues by T. Only one
was a deletion (of 1 bp). Four mutations were found twice, all others
just once only, and none has previously been reported as a
polymorphism. The frequency and pattern of mutations in the two cell
clones were very similar.
View this table:
[in this window]
[in a new window]
|
Table II
Pattern of mitochondrial mutations detected in D198A-myc expressing
cells
The light-strand nucleotide of the Cambridge reference sequence (Ref.
1) is shown on the left (top to bottom), while the mutated light-strand
nucleotide in cell-lines D198A-myc3 or D198A-myc2, each cultured for 3 months, is shown along the top (right to left). denotes a missing
nucleotide (i.e. deletion or insertion). The light-strand
nucleotide composition of the sequenced region was: A 103 (30%), G 54 (16%), C 95 (28%), and T 92 (27%). The two "background"
mutations found in the vector-transfected 293T-myc cell-line were A to
T and G to C, respectively. The one mutation picked up by PCR analysis
of cloned DNA was a C to A change. Note that the cell line carries a
rare polymorphism, T3197C (Ref. 57), that was found in all clones. The
mutational patterns for the two cell-lines considered individually are
very
similar.
|
|
Cells Expressing the POLG Mutator Undergo Selection after 3 Months
in Culture--
We reasoned that a continuing accumulation of mtDNA
mutation at this rate would eventually lead to a frank impairment of
mitochondrial respiration and a selective crisis in the cell
population. This can be predicted on the assumption that a deleterious
mutation would eventually be introduced into every copy of at least one mitochondrial gene in each mitochondrial genetic unit. We therefore cultured the cells for longer times, periodically re-examining the
mutation spectrum and the status of the D198A-myc transgene. In one
experiment, a culture of line D198A-myc3 manifested a drop in growth
rate after 4 months and eventually stopped growing. Other cultures of
the same cell line were still growing after 6 or 8 months. A culture of
clone D198A-myc2 also survived at least 6 months.
Using the same procedure as earlier, we re-sampled the mtDNA mutation
spectrum in these cultures (Table III).
In line D198A-myc3, the mutational load, as represented by the total
frequency of deviations from the Cambridge reference sequence, was
lower at both 4 and 8 months than at 3 months, suggesting that
selection was operating. This hypothesis was supported by studies of
the POLG transgene. Western blotting showed that transgene expression at the protein level in line D198A-myc3 had fallen to low levels by 5.5 months (Fig. 8a) and also in a
parallel culture analyzed at 8 months (not shown). Complete sequence
analysis of the POLG transgene revealed the presence of a novel
mutation (Fig. 8b), causing a non-conservative amino acid
substitution (R832S). All vertebrates sequenced have arginine or lysine
at this position. At the 3-month time point, the R832S substitution was
already evident by direct sequencing (Fig. 8b) but at a
lower level. No other transgene mutations were found.
View this table:
[in this window]
[in a new window]
|
Table III
Changes in mtDNA mutation frequencies in POLG-myc expressing cells
Total number of mutations found, i.e. total number of
differences from Cambridge reference sequence, divided by number of bp
sequenced. Numbers in parentheses indicate the total number of
different mutations found in each sampling (some being found more than
once, see text).
|
|
View larger version (32K):
[in this window]
[in a new window]
|
Fig. 8.
. Consequences of long-term expression of
D198A-myc. a, Western blots as in Fig.
2a, using extracts from cells cultured continuously for 5.5 months, with equal amounts of protein (10 µg) loaded in each track.
Compare relative signals with those in Fig. 2a, which shows
extracts prepared shortly before the 3-month time point. Extracts were
analyzed from bulk cultures of lines D198A-myc2 and D198A-myc3, plus
two subclones of each (D2-4, D2-6 and D3-1, D3-2), isolated at 4 months, and verified to have retained the D198A mutation. b,
sequencing traces for a region of the POLG transgene
(np 2629-2621, antisense strand, GenBank U60325) from POLG-myc
cells (wild type sequence), plus D198A-myc3 cells after 3 and 8 months
of continuous culture. Arrow denotes the mutation that
accumulated in the cells, causing amino acid substitution R832S.
c, POLG DNA polymerase activities in mitochondrial extracts
(as in Fig. 4a) of bulk cultures and subclones of mutator
cells at 5.5 months. Subclone D3-1 was 100% wild type at residue R832,
whereas subclone D3-2 was 100% mutant for the R832S substitution.
d, mitochondrial DNA mutations detected in D198A-myc2 and
D198-myc3 cells after 3 months of continuous culture. Only the L-strand
is shown. The reference sequence exhibits two differences (denoted by
asterisks) from the original Cambridge reference sequence (1), namely a
C deletion at np 3106, now designated as a sequencing error in
the original report (56), and a rare polymorphism T3197C (Ref. 57),
present in all clones we analyzed that were derived from cell line
HEK293T. denotes a 1-bp deletion. The boundaries of tRNA-leu(UUR)
and of the ND1 coding sequence are shown.
|
|
These observations are consistent with inactivation of the mutator
polymerase via selection for a mutant form of the enzyme with greatly
reduced stability. In support of this, POLG DNA polymerase activity in
mitochondrial extracts from D198A-myc3 cells at the 5.5-month time
point had fallen almost to the same level as in vector-transfected
(293T-myc) cells (Fig. 8c). Transgene expression was
undetectable by Western blotting in 9 out of 22 individual subclones of
D198A-myc3 cells derived at 4 months, whereas all 23 subclones of
wild-type POLG-myc cells analyzed at this time point remained positive.
Subclones of D198A-myc3 cells that were negative for transgene
expression (e.g. subclone D3-2, Fig. 8a) also
carried the R832S mutation, and had low levels of POLG DNA polymerase
activity (Fig. 8c), whereas subclones still positive for
transgene expression at 5.5 months (e.g. subclone D3-1)
were wild-type at this position and retained polymerase activity.
Analysis of mtDNA from line D198A-myc2 at the 4-month time point also
suggested a decline in mutation load (Table III). In this cell line,
expression of the transgene at the protein level was retained in the
bulk culture when tested at 5.5 months (Fig. 8a), although 2 out of 19 subclones isolated at 4 months no longer expressed it (data
not shown). However, POLG DNA polymerase activity was low in one out of
two randomly selected subclones from line D198A-myc2 that did continue
to express the transgene at the protein level (Fig. 8, a and
c).
| |
DISCUSSION |
The experiments presented here provide confirmation, via a
reporter gene approach, that POLG encodes a mitochondrially localized protein that is functional in mtDNA synthesis in vivo. POLG
variants create dominant-negative cellular phenotypes, including a
mtDNA mutator that indicates the limits of mtDNA mutation load that mammalian cells can tolerate.
Highly Expressed POLG-myc Is Functionally Active inside
Mitochondria--
High level, episomal expression of the POLG-myc
transgene is associated with greatly enhanced DNA polymerase and 3'-5'
exonuclease activity in mitochondrial extracts. These activities have
characteristics that resemble those of the purified or recombinant POLG
enzyme and are abolished by point mutations that alter key conserved residues analogous to those found previously to be essential for catalysis in other members of the Family A DNA polymerases. Inside mitochondria, the protein is localized to the inside face of the inner
membrane, which is believed to be the compartment in which mtDNA is
also located. As in yeast (15), enzymatic activities were not impaired
by COOH-terminal tagging.
Enhanced polymerase activity does not alter mtDNA copy number during
long-term culture. Therefore, availability of POLG is not a limiting
factor for mtDNA synthesis, consistent with observations that the gene
is unregulated developmentally (46), and that POLG gene
dosage does not affect mtDNA levels (47). Other proteins involved in
mtDNA maintenance, e.g. mtTFA (48, 49) or mtSSB (46), must
regulate copy number.
Expression of POLG-myc Variants Creates Dominant Phenotypes in
Vivo--
The main aim of this study was to test the functional
effects in vivo of expressing POLG variants mutated in each
of three different regions, namely the proofreading exonuclease domain, the putative polymerase domain, and the polyglutamine repeat. By
overwhelming the expression of the endogenous enzyme, we were able to
evaluate both the enzymatic properties of the mutated polypeptides, as
well as other dominant effects on cell phenotype. We infer that the DNA
polymerase activity of POLG is essential for mtDNA maintenance, and
that its exonuclease activity is essential for mtDNA integrity. By
contrast, the polyglutamine repeat does not contribute to the enzymatic
properties of POLG.
The D198A Substitution Creates a Mitochondrial Mutator in
Vivo--
Previous in vitro analysis of recombinant POLG
carrying the D198A mutation in combination with an additional
substitution (E200A) indicated a loss of 3'-5' exonuclease activity
(14). Our results indicate that the D198A substitution alone is
sufficient to abolish detectable proofreading exonuclease activity in
mitochondrial extracts. In yeast, the analogous substitution D171G
causes a 104-fold drop in 3'-5' exonuclease activity, and a
100-fold increase in the rate of accumulation of point mutations in
yeast mtDNA (15).
Overexpression of the D198A-myc variant for 3 months in culture
generated a much higher frequency of mtDNA mutations than the minimal
level found in control cultures, or the background of "PCR noise."
The pattern of substitutions, being mainly G-C to A-T transitions, was
also distinct from that caused by Pfu polymerase on a mtDNA
template, which in our hands and elsewhere seems to give mainly
transversions (Table II, Ref. 50). Expression of wild-type POLG-myc
alone did not create a mtDNA mutator. We can exclude the possibility
that nuclear pseudogenes were being detected, since most mutations
detected were unique, and occurred on different individual clones. A
nuclear pseudogene of this region (GenBank accession number
AF047836) can be detected by PCR, but it shows many
sequence differences from bona fide human
mtDNA,2 allowing any
pseudogene-derived clones to be easily excluded from analysis. None of
the sequence variants found specifically in D198A-myc expressing cells
was held in common with this nuclear pseudogene. The D198A-myc variant
therefore appears to function in vivo as a mtDNA mutator, as predicted.
Dynamics of mtDNA Mutation, Segregation, and Selection in POLG
Mutator Cells--
Two independently derived cell clones expressing
the POLG mutator accumulated mtDNA mutations over 3 months to a very
similar extent, but with only a minimal detriment to respiratory
phenotype. At a later time point, selection is inferred to have
occurred in these cell lines, leading to the recovery of surviving
cells with a mutated and inactivated POLG transgene, plus a much more restricted mtDNA mutation profile. The R832S transgene substitution in
line D198A-myc3 was already detectable at 3 months, was found in 9 out
of 22 subclones at 4 months, and had practically taken over the culture
by 8 months. The selection that has occurred in these cultures makes it
difficult to extrapolate an exact or absolute rate of mtDNA mutation.
The fact that the R832S transgene mutation was already detectable at 3 months strongly suggests that significant selection was already
occurring. Since such selection must limit the mtDNA diversity of the
cell population, the accumulation of a mutation load of approximately
1:1700 over 3 months is therefore a minimum estimate of the mutation
rate. Given that selection was already significant at 4 months, the
maximum tolerable mutation load in mtDNA may also not be much greater
than 1:1700 bp.
The simplest hypothesis is that selection was operating at the level of
respiratory metabolism. However, such selection can clearly take more
than one course. In line with D198A-myc3 one culture of cells appeared
to enter a terminal crisis after 4 months in culture, whereas another
survived till 8 months, with concomitant loss of transgene expression
and a modest reduction in mutation load. This can be interpreted as the
emergence, within the population, of a cell clone in which mutator
transgene expression was lost relatively late, i.e. in which
significant mtDNA mutations had already accumulated, but were
presumably not sufficient to compromise growth rate.
Further analysis will be required to characterize precisely the outcome
of selection in line D198A-myc2. The mtDNA mutation load was again
lower at 4 months than at 3, and this was also accompanied by transgene
inactivation. However, in this cell line it appears to have involved at
least two different mechanisms: loss of expression (in a minority of
cells) and loss of polymerase activity in some others. Based on
previous analyses of cultured heteroplasmic cells (38, 51), random
mitotic segregation could not alone have brought about the decline in
mutation load observed in these cultures.
The mutation load observed at 3 months in both mutator clones implies
that each mtDNA molecule should carry typically about 10 mutations, at
least some of which are expected to be deleterious. This is strongly
implied by the pattern of substitutions (Fig. 8d), in which
first, second and third base pairs of codons within the ND1
coding sequence are equally targeted including 4 amino acid
substitutions and one frameshift. Four out of 5 mutated residues in
tRNA-leu(UUR) are phylogenetically conserved among all primates and
virtually all mammals. However, this mutation load does not entrain a
severe respiratory phenotype. It seems reasonable that intramolecular
complementation is able to sustain respiratory function, until a higher
threshold of mutation load is crossed. This could represent the
emergence of functionally dominant mutations that compromise protein
synthesis or respiratory enzyme assembly and function, or simply the
loss of all functional copies of at least one gene within each
mitochondrial genetic unit.
Loss of POLG Exonuclease Does Not Account for Mutational Patterns
in mtDNA--
The pattern of human mtDNA sequence polymorphisms
reported in the MITOMAP data base shows an enormous
preponderance of transitions (88%) over transversions, with a
nucleotide bias approximating that of the genome (i.e. the
genome is 56% A + T, and 58% of the transitions convert an A-T pair
to a G-C). Similar figures apply to the pathological mutations
currently reported in the data base (90% transitions, 56% of them
affecting an A-T pair). The mutations introduced by the POLG mutator
are also mainly transitions (29 out of 37), but the pattern of
substitutions is quite different, with C-G pairs replaced about 10 times more often by A-T pairs than vice versa (26 as against 3).
L-strand C residues were more frequently replaced than those on the
H-strand, although this may reflect the base bias of the region
analyzed (see legend to Table II). The gene for tRNA-leu(UUR) is
commonly claimed to be a hotspot for mutation, but this does not apply
to the changes introduced by the POLG mutator. The mutational patterns
of human mtDNA are therefore not obviously attributable to faulty POLG proofreading. The base- and possible strand-bias of the mutations we
observed may reflect fundamental properties of the POLG enzyme, or
aspects of the unusual, strand-asymetric mode of mtDNA replication in
mammalian cultured cells (2). It may be that the wild-type proofreading
exonuclease has a better ability to handle some types of mutations than
others and that the mutator superimposes a new set of mutations over a
background of errors that even the wild-type editing activity handles
poorly. Alternatively, the exonuclease activity of POLG may also play a
role in DNA repair, as suggested by in vitro studies (25).
Intriguingly, the mutational pattern that we found is similar to that
introduced into mtDNA by the chemical mutagen MNNG (52).
Two Polymerase-deficient POLG Variants Inhibit mtDNA Synthesis and
Cause Depletion--
The polymerase-deficient substitutions in
POLG-myc affect conserved aspartate residues of the polymerase domain
of the enzyme, located in the carboxyl-terminal half of the
polypeptide. The corresponding residues Asp705 and
Asp882 in E. coli Pol I are essential for
catalysis (41, 53). Transient expression of D890N-myc or D1135A-myc
inhibited endogenous POLG activity and caused a reproducible drop in
the level of mtDNA during the 96 h following transfection. During
a period when cell number increased through several cell doublings, the
amount of mtDNA relative to nuclear DNA decreased progressively by up
to 40%, whereas in parallel cultures transfected with vector or with wild-type POLG-myc there was no mtDNA depletion. Given typical transfection efficiencies of 50%, the kinetics of the effect are consistent with a total or almost total cessation of mtDNA replication, even without invoking a negative effect on cell growth. We postulate that the mutant proteins, expressed at much higher levels than the
endogenous POLG, were incorporated into "dead-end" replication complexes, thus blocking mtDNA synthesis.
The dominant-negative phenotype suggests that POLG is required for
mtDNA replication, although it need not be the only DNA polymerase
involved. Two distinct DNA polymerases appear to be found, for example,
in trypanosome (54) and bovine (55) mitochondria and, as already noted,
POLG could also serve a dual purpose as a DNA repair enzyme (25). The
repeated failure to isolate cell clones stably expressing the
polymerase-deficient variants, and the decline of their expression in
the weeks following transfection, even in cultures under selection,
furthermore, implies that their expression has a significant negative
effect on cell growth or survival, presumably via respiratory
selection. Given that high level expression of the polymerase-deficient
mutants appears to create a drastic phenotype, it may be profitable to
attempt lower level regulated expression, which might have a milder
dominant-negative effect on mtDNA metabolism.
,
**
TOP
ABSTRACT
INTRODUCTION
