| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 32, 25039-25045, August 11, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, February 10, 2000, and in revised form, June 8, 2000
Ezrin-radixin-moesin (ERM)-binding phosphoprotein
50 (EBP50) is a versatile membrane-cytoskeleton linking protein that
binds to the COOH-tail of specific integral membrane proteins through its two PDZ domains. These EBP50 binding interactions have been implicated in sequestering interactive sets of proteins into common microdomains, regulating the activity of interacting proteins, and
modulating membrane protein trafficking. With only two PDZ domains, it
is unclear how EBP50 forms multiprotein complexes. Other PDZ proteins
increase their breadth and diversity of protein interactions through
oligomerization. Hypothesizing that EBP50 self-associates to amplify
its functional capacity, far-Western blotting of cholangiocyte
epithelial cell proteins with EBP50 fusion protein revealed that EBP50
binds to a 50-kDa protein. Far-Western blotting of EBP50 isolated by
two-dimensional gel electrophoresis or immunoprecipitation demonstrates
that the 50-kDa binding partner is itself EBP50. Further,
co-transfection/co-precipitation studies show the self-association can
occur in an intracellular environment. In vitro analysis of
the EBP50-EBP50 binding interaction indicates it is both saturable and
of relatively high affinity. Analysis of truncated EBP50 proteins
indicates EBP50 self-association is mediated through its PDZ domains.
The ability to self-associate provides a mechanism for EBP50 to expand
its capacity to form multiprotein complexes and regulate membrane
transport events.
PDZ (PSD95, Dlg, ZO-1)
proteins serve as central organizers of protein complexes. The
80-90-amino acid PDZ domains are most noted for their capacity to bind
the COOH-tail of specific integral membrane proteins (1). Through a
distinct interface, some PDZ domains also have the capacity to
participate in separate PDZ-PDZ interactions. Interestingly, these
properties allow a single PDZ domain to bind concurrently with both the
COOH-tail of an integral membrane protein and another protein through a
PDZ-PDZ interaction (2). PDZ proteins amplify their capacity and
diversity of protein-protein interactions through co-expression of
additional protein binding motifs (e.g. SH2 domains, SH3
domains, ankyrin repeats,
ERM1 binding domains),
expression of multiple PDZ domains within the same PDZ protein, and
oligomerization with other PDZ proteins (2-7). Oligomerization can
occur either through non-PDZ domain interactions or through PDZ-PDZ interactions.
ERM-binding phosphoprotein 50 (EBP50; also known as NHE regulatory
factor) is a PDZ domain protein found in several epithelial cell types.
EBP50 has been shown to bind a growing number of integral membrane
proteins including cAMP-regulated Na+/H+
exchanger 3 (NHE3), EBP50 Fusion Protein Constructs and Expression--
GST-EBP50
fusion proteins were created by polymerase chain reaction amplification
of the full-length or segmented rat EBP50 cDNA
(GenBankTM accession number AF154336), ligation into
PGEX-2T or PGEX-4T-3 vectors (Amersham Pharmacia Biotech), and
transformation into Escherichia coli strain DH5
Transformed colonies were selected by ampicillin resistance (100 µg/ml ampicillin), and protein expression was induced with isopropyl- Far-Western Assays--
In initial studies, 40 µg of total
protein from normal rat cholangiocytes was solubilized in 5× PAGE
buffer (5% SDS, 25% sucrose, 50 mM Tris, 5 mM
EDTA, pH 8.0), electrophoresed on a 3.5-17.5% SDS-PAGE gel, and
transferred to nitrocellulose membrane. Subsequent overlay studies
blotted 10 µg of recombinant EBP50 proteins. Immobilized proteins
were blocked with 5% nonfat dry milk in blot buffer (150 mM NaCl, 10 mM Na2HPO4,
1 mM EDTA, 0.2% Triton X-100) at 4 °C overnight. Unless
otherwise stated, the immobilized proteins were then incubated in blot
buffer with 500 nM recombinant EBP50 protein and protease
inhibitors for 2 h at room temperature. In some experiments, EBP50
was biotinylated (0.5 mg/ml N-hydroxysuccinimidobiotin
(Pierce), 45 min, 4 °C) prior to overlaying the blots. EBP50 protein
was detected by Western blotting with HRP-tagged secondary antibody and
enhanced chemiluminescence (Pierce). Biotinylated EBP50 was detected
with HRP-tabbed neutravidin and enhanced chemiluminescence (Pierce).
Two-dimensional Gel Electrophoresis--
NRC cells were
solubilized in half-strength 5× PAGE buffer as above without reducing
agent and diluted 1:1 with overlay buffer (650 mg/ml urea, 50 µl/ml
pI 5-7 ampholyte (Bio-Rad), 50 µl/ml pI 6-8 ampholyte (Bio-Rad).
This solution was loaded on top of a 14 × 0.15-cm tube gel (4%
polyacrylamide, 9 M urea, 3% (v/v) pI 5-7 ampholyte, 3%
(v/v) pI 6-8 ampholyte). Isoelectric focusing occurred under 600 V for
13 h and 900 V for 4 h. The proteins in the tube gels were
further solubilized and reduced by incubation in equilibration buffer
(250 mM Tris-HCl, 11% sucrose, 3% SDS, 10 mM
dithiothreitol, pH 6.8) for 10 min. The tube gels were run in the
second dimension on either a 4-14% gradient gel or 10% Tris-glycine
separating gel. Paired blots were used for Western and far-Western
blotting for EBP50 localization and binding interaction, respectively.
Following Western and far-Western blotting, the membranes were washed
in dH2O and developed for total protein using colloidal
gold (Bio-Rad). For clarity of presentation, the complexity of
neighboring proteins was reduced by using 0.5% Triton X-100 insoluble
proteins from NRC monolayers for the two-dimensional gel overlay
experiments in Fig. 3.
EBP50 Immunoprecipitation--
EBP50 antibody was incubated with
Protein A/G beads (Pierce) for 1 h at room temperature and then
covalently cross-linked with 1 mM
dithiobis(sulfosuccinimidyl propionate) for 1 h at room temperature. Cross-linking was stopped, and unbound antibody was removed by washing and dilute storage in 1 M glycine buffer
(pH 7.5). Prior to immunoprecipitation, NRC cells were solubilized in
RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EGTA, 1% Nonidet P-40, 0.25% deoxycholate; protease
mixture, pH 7.4), and the pellet was isolated, solubilized in RIPA
buffer plus 1% SDS, diluted to 0.1% SDS with RIPA buffer, and
centrifuged at 14,000 × g for 2 min. The resultant
supernatant was precleared with washed Protein A/G beads (2 h at room
temperature) and then subjected to immunoprecipitation with EBP50
antibody-linked Protein A/G beads (2 h at room temperature). The beads
were then washed three times in RIPA buffer with 0.1% SDS, and the
bound protein was eluted with 5× PAGE buffer and centrifuged.
The pre-clear beads were treated identically and served as a
precipitation control.
Co-transfection and Co-precipitation of HA-EBP50 and
FLAG-EBP50--
HEK-293 cells were grown in Dulbecco's
modified Eagle's medium supplemented with 10% fetal calf serum,
penicillin (100 units/ml), and streptomycin (100 µg/ml) (Life
Technologies, Inc.) at 37 °C in a humidified atmosphere of 95% air
and 5% CO2. Full-length EBP50 was inserted into HA
(pCGN-2; David Gordon, University of Colorado Health Science Center)
and FLAG (p3XFLAG-CMV-7; Sigma) vectors, verified in-frame by
sequencing, and independently transfected into HEK-293 cells to verify
the synthesis of the tagged EBP50. To assess FLAG-EBP50
co-precipitation with immunoprecipitated HA-EBP50, four concurrent
co-transfections were performed. HEK-293 cells (100-mm dishes, ~80%
confluence) were transfected with 2-4 µg of 1) HA vector and FLAG
vector cDNA, 2) HA vector and FLAG-EBP50 cDNA, 3) HA-EBP50 and
FLAG vector cDNA, or 4) HA-EBP50 and FLAG-EBP50 cDNA (Effectene
transfection reagent kit according to the manufacturer's instructions;
Qiagen, Inc.). Forty-eight hours after transfection, the cells were
washed twice with ice-cold phosphate-buffered saline buffer and then
scraped into 1 ml of ice-cold lysis buffer (150 mM NaCl, 50 mM Tris, pH 8.0, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, 2 mM EDTA, protease inhibitors mixture (Roche
Molecular Biochemicals), and phosphatase inhibitors (5 mM
sodium pyrophosphate, 1 mM sodium fluoride, 20 mM sodium vanadate)). The lysate was rocked for 30 min at
4 °C, and the insoluble material was removed by centrifugation at
20,000 × g, 30 min at 4 °C. The lysate (400 µl)
was immunoprecipitated with 100 µl of anti-HA affinity matrix (Roche
Molecular Biochemicals) for 1 h at 4 °C, the matrix was washed
four times with 1 ml of cold lysis buffer, and the bound proteins
eluted with 5× PAGE buffer (200 µl, 95 °C, 5 min). Proteins were
separated on a 3.5-17.5% SDS-PAGE gel and transferred on nitrocellulose membrane. Self-association of EBP50 was revealed by
Western blotting with anti-FLAG M2 antibody (Sigma).
EBP50-EBP50 Binding Analysis--
The binding characteristics of
EBP50 self-association were performed in a similar fashion. Following
the transfer of paired sets of EBP50 (10 µg) or albumin (10 µg;
negative control), the blots were incubated in blot buffer containing
0-10 µM biotinylated EBP50. Following paired
colorimetric development of all blots using Opti-CN, the relative
levels of bound EBP50 were quantified by densitometry (IP
Laboratory, National Institutes of Health).
EBP50 Oligomerization and Cross-linking--
Thrombin-liberated
recombinant EBP50 (0.1 mg·ml EBP50 Domain-specific Binding--
To determine the domain
responsible for EBP50 self-association, domain-specific EBP50 fusion
proteins were generated, biotinylated, cleaved from the immobile phase
with thrombin, and overlaid onto blotted full-length EBP50. These
recombinant EBP50 domains included the PDZ1,2 domain (amino
acids 1-260), the post-PDZ domain COOH segment (amino acids 228-356),
and COOH-tail (amino acids 1-348). Next, domain-specific EBP50
proteins (COOH-tail, PDZ1,2, post-PDZ COOH segment) were
blotted and overlaid with biotinylated forms of the same
domain-specific form of EBP50. Subsequently, the PDZ1 domain (amino acids 1-133) and PDZ2 domain (amino acids
133-260) were generated, biotinylated, and overlaid onto wild-type,
PDZ1,2, PDZ1, and PDZ2 domains of
EBP50.
Characterization of GST-EBP50 Fusion Proteins--
GST-EBP50
fusion proteins were generated for use in far-Western detection of
binding partners (Fig. 1A).
Following isolation of GST proteins, total protein staining (left
panel) detected no protein from control bacteria (lane
1), a single protein consistent with 26-kDa GST protein
(lane 2), and two prominent proteins of ~80 kDa consistent
with GST-EBP50 (lane 3). Western blotting with anti-GST
antibody (middle panel) confirmed the single protein in
lane 2, and the doublet in lane 3 contained GST
protein. Western blotting with anti-EBP50 antibody (right
panel) confirmed that the protein doublet in lane 3 contained EBP50. The lower band of the doublet is a likely partial
proteolytic product of the intact protein.
Thrombin treatment of the intact GST-EBP50 resulted in site-specific
cleavage (Fig. 1B). Total protein staining (left
panel) showed that thrombin treatment cleaved the parent protein
(lane 1) and liberated a 50-kDa protein (lane 2).
GST was not eluted from the immobile phase following thrombin digestion
and would not be predicted to be present in lane 2. Western
blotting with EBP50 antibody (right panel) confirmed that
the thrombin-liberated protein was indeed EBP50. Similar approaches
were utilized to generate truncated forms of EBP50 (see below).
Recombinant EBP50 Is Capable of Binding with a 50-kDa Protein in
Cholangiocytes--
Thrombin-cleaved recombinant EBP50 was used in two
different far-Western blotting protocols to demonstrate EBP50 is
capable of binding an endogenous 50-kDa protein from NRC cells. First, Western-blotted proteins from NRC cells, which express endogenous EBP50, were overlaid with recombinant EBP50. Paired blots without overlaid recombinant protein served as the control. Immunodetection of
EBP50, which detects both endogenous and recombinant EBP50, was then
performed (Fig. 2; A-1 and
A-2). In all paired samples tested (n = 5),
the 50-kDa band on the blot that was overlaid with recombinant EBP50
(A-1) was more intense than the 50-kDa band that was not
overlaid with recombinant EBP50 (A-2). This increased EBP50
signal intensity in the overlaid sample suggests that EBP50 binds
either to itself or another protein of similar mass.
To specifically detect only the overlaid EBP50, recombinant EBP50 was
biotinylated before being overlaid onto the blotted NRC proteins and
detected with horseradish peroxidase-labeled neutravidin. The overlaid
biotinylated EBP50 again detected a protein at 50 kDa. Its relative
intensity is lower when compared with other EBP50-bound proteins (Fig.
2; B-1). This lower relative intensity would be predicted
because endogenous EBP50 is not detected by this assay. Paired blots of
NRC proteins that were not overlaid with biotinylated EBP50 (negative
control; B-2) showed no signal when detected with
neutravidin-HRP. These two observations indicate that recombinant EBP50
specifically interacts with either native EBP50 or a protein(s) that
co-migrates at 50 kDa.
Recombinant EBP50 Is Capable of Self-associating with EBP50 from
NRC Cells--
To directly determine if the endogenous 50-kDa binding
partner is indeed EBP50, three distinct approaches were employed.
First, in a similar overlay approach, paired NRC protein samples
(Triton-insoluble fraction) were separated by two-dimensional gel
electrophoresis and transferred to nitrocellulose. The first
two-dimensional blot was developed by standard Western blotting to
identify the migration pattern of EBP50. EBP50 (Fig.
3A, panel 1,
arrow) was detected in a region consistent with its
demonstrated migration at 50 kDa and predicted pI value of 6.2. Protein
staining with colloidal gold shows the relative position of EBP50 to
neighboring proteins (panel 2). In the paired blot, these
proteins were used to confirm the location of EBP50 (panel
4). When paired blots were overlaid with biotinylated recombinant
EBP50, there was specific binding between recombinant EBP50 and
endogenous EBP50 (arrow; panel 3).
These observations were mirrored in overlays of
immunoprecipitated EBP50 (Fig. 3B). Western blotting
(left panel) shows that EBP50 was specifically
immunoprecipitated from NRC cell lysates. In contrast to either
precipitates obtained in the absence of EBP50 antibody or albumin
controls, paired blots show that biotinylated EBP50 readily binds to
immunoprecipitated EBP50 protein, again consistent with EBP50
self-association.
EBP50 Self-association Occurs in an in Vivo Environment--
To
determine if the observed in vitro EBP50-EBP50 binding
interaction can occur in an intracellular environment, a
co-transfection/co-precipitation approach was employed (Fig.
3C). HA- and FLAG-tagged EBP50 were co-transfected into
HEK-296 cells, and the co-precipitation of FLAG-EBP50 with
immunoprecipitated HA-EBP50 was assayed. In contrast to cells
co-transfected/co-precipitated with FLAG-EBP50 and HA-vector only,
cells co-transfected with FLAG-EBP50 and HA-EBP50 showed FLAG-EBP50
present in the washed HA-immunoprecipitate fraction (Fig.
3C). Other control co-transfections/co-precipitations
(FLAG-vector only/HA-vector only; FLAG-vector only/HA-EBP50) were also negative.
EBP50 Self-association Is Saturable and of Relative High
Affinity--
Using isolated recombinant EBP50 protein, the binding
characteristics of the EBP50-EBP50 interaction were evaluated. First, EBP50 self-association was confirmed by binding of biotinylated recombinant EBP50 to immobilized GST-EBP50 (Fig.
4A). Albumin and GST-only
served as negative controls. Coomassie Blue staining of albumin,
GST-only, and GST-EBP50 in paired gels demonstrate that equivalent
amounts of protein were added (left panel). Biotinylated EBP50, after being overlaid on a paired blot, bound only to the GST-EBP50 protein (right panel).
Using albumin as a negative control, the EBP50-EBP50 interaction was
evaluated further by overlaying immobilized EBP50 with varying
concentrations of biotinylated EBP50 (Fig. 4B). Quantitation of the resultant binding showed that the EBP50-EBP50 interaction was
both saturable and of relatively high affinity.
EBP50 Self-association Can Result in the Formation of
Multimers--
EBP50 self-association could generate simple
dimerization or lead to the formation of more complex oligomers. To
determine if oligomerization can occur, recombinant EBP50 was incubated in suspension, covalently cross-linked, and assayed for the presence of
multimers by Western blotting (Fig. 5).
Whereas denatured EBP50 in non-cross-linked samples ran almost
exclusively at 50 kDa, a significant fraction of EBP50 in paired
cross-linked samples appeared at higher molecular masses. The
apparent mass of these proteins (~100 kDa and ~150 kDa) is
consistent with oligomer formation. Although the predominant oligomer
was the dimer, a trimer was also readily observed, and a tetramer was
seen at longer exposures (data not shown).
EBP50 Self-associates through PDZ-PDZ Interactions--
To
evaluate which regions of EBP50 participate in the self-association
interaction, specific domains of EBP50 were synthesized (Fig.
6), biotinylated, and overlaid onto
immobilized full-length EBP50 (Fig.
7A). These EBP50 domains
include 1) full-length EBP50, 2) COOH-tailless EBP50, 3)
PDZ1,2 domains, 4) post-PDZ1,2 COOH segment, 5)
PDZ1 domain, and 6) PDZ2 domain. The
COOH-tailless EBP50 proteins bound with an avidity that was
indistinguishable from the full-length EBP50 protein. This observation
was reiterated by comparing the self-association of COOH-tailless to
immobilized COOH-tailless and full-length EBP50 (Fig. 7B).
Again, the degree of association was not notably different between the
two groups, indicating that the COOH-tail was not involved in EBP50
self-association.
The COOH segment EBP50 protein showed little or no detectable binding
(Fig. 7A). This indicates the post-PDZ COOH segment is not
capable itself of binding EBP50. Likewise, no detectable binding was
observed when the COOH segment was overlaid onto itself (data not
shown). In contrast, the PDZ1,2 domain showed a greater degree of binding to EBP50 than the full-length EBP50 (Fig.
7A). This occurred consistently across three separate
preparations of recombinant EBP50 proteins. The avid binding indicates
that the PDZ1,2 domain is involved in the EBP50-EBP50
self-association reaction. To verify that the PDZ1,2 domain
binding interaction occurred with the PDZ1,2 domain of the
immobilized EBP50, the binding of biotinylated PDZ1,2 to
blotted PDZ1,2 was examined (Fig. 7B).
PDZ1,2 showed avid binding to PDZ1,2,
demonstrating that the EBP50-EBP50 binding interactions occurred
through a PDZ1,2 domain.
Finally, to determine if one or both of the two PDZ domains of EBP50
are involved in the self-association reaction, the binding of
biotinylated PDZ1 and PDZ2 domains to
immobilized full-length EBP50 as well as the individual
PDZ1 and PDZ2 domains was assessed (Fig.
7C). Interestingly, both PDZ1 and
PDZ2 bound EBP50. When the specific PDZ domain interactions
were evaluated, both PDZ1 and PDZ2 could bind
to either PDZ domain. Their apparent interactions, however, were not
equivalent. For both PDZ domains, the homologous binding interactions
predominated such that PDZ1 binding was greater with
PDZ1 than with PDZ2 and PDZ2
binding was greater with PDZ2 than with
PDZ1.
EBP50 Oligomerizes through PDZ-PDZ Interactions--
EBP50
contains two PDZ domains followed by an ERM protein binding domain.
Further, sequence analysis of the carboxyl terminus (FSNL) suggests
that the COOH-tail of EBP50 itself could be bound by a PDZ protein and
provides a potential mechanism for EBP50 self-association. If EBP50
self-associated by binding the tail of another EBP50 protein the
resultant complex would be a head-to-tail configuration more likely to
extend rather than cluster EBP50 and its associated proteins. This
possibility was largely ruled out by removing the terminal eight amino
acids from the carboxyl tail and assaying its ability to bind EBP50. No
difference was observed in the abundance of protein binding in this
assay (Fig. 7A). Further, because the tailless EBP50
could bind the tail of the immobilized full-length EBP50, the binding
interaction between tailless EBP50 to immobilized tailless EBP50 was
also analyzed. It also failed to show any difference in either its
apparent affinity or binding capacity (Fig. 7B).
Consequently, the EBP50-EBP50 interaction is unlikely to occur in a
head-to-tail fashion.
PSD95, one of the originally described PDZ proteins, oligomerizes
through a non-PDZ segment of its protein (4). The
post-PDZ1,2 COOH segment has not been fully characterized
but, as a minimum, has the capacity to bind members of the
ezrin-radixin-moesin family (7). Given its known protein binding
capacity, its potential involvement in EBP50 self-association was
examined. Run in parallel with full-length EBP50, no oligomerization of
EBP50-COOH segment was observed (Fig. 7A). Taken together,
these findings indicate that the COOH segment is unlikely to account
for the EBP50-EBP50 binding.
The capacity of proteins to oligomerize through PDZ-PDZ interactions is
demonstrated by the association of nNOS with syntrophin and PSD95 and
the dimerization of InaD (2, 5). To determine if EBP50 self-association
occurs through its PDZ domains, the binding of the PDZ1,2
construct to immobilized EBP50 was compared with that of wild type
EBP50. In three separate preparations, there was greater binding of
PDZ1,2 than full-length EBP50 (Fig. 7). This strongly
supports the hypothesis that EBP50 self-association occurs through
PDZ-PDZ interactions and suggests that the COOH segment could modify
the binding characteristics. Unlike the dimerization of InaD, which
occurs between two distinct PDZ domains within InaD, the most prominent
PDZ:PDZ domain interactions of EBP50 occurred between homologous PDZ
domains (i.e. PDZ1 to PDZ1 and PDZ2 to PDZ2; Fig. 7C). Thus, EBP50
self-association is apparently mediated through a novel interaction
involving homologous PDZ domains.
Functional Significance of EBP50-EBP50 Self-association--
The
functional significance of EBP50 self-association remains speculative
at this point. In other systems, PDZ domain-dependent protein-protein interactions have been described (2, 5). PDZ-PDZ
interactions can occur between disparate proteins (5) or between PDZ
domains of the same protein (2). In the case of nNOS-syntrophin
binding, both proteins contain only a single PDZ domain, and the
PDZ-PDZ binding interaction is considered a mechanism to allow nNOS to
affiliate with the dystrophin complex (5). In contrast, InaD has five
distinct PDZ domains which enable InaD to sequester and regulate
receptor, signaling, and effector proteins of the rhodopsin
phototransduction system of Drosophila. InaD is central to
the spatiotemporal orchestration of events that culminate in
photoreceptor activity and subsequent desensitization. Oligomerization
of InaD through the third and fourth PDZ domains of separate InaD
proteins is considered to amplify the capacity and complexity of InaD
sequestered proteins.
EBP50 by itself, with only two PDZ domains, has a limited capacity to
sequester arrays of proteins into membrane microdomains. In the renal
proximal tubule, where EBP50 has been studied in greatest detail, EBP50
can bind at least three discrete proteins to its PDZ domains (8, 10,
13). This includes the concurrent binding and activity modulation of
HEK-293 cells were provided by Jerome Schaak,
University of Colorado Health Sciences Center.
*
This work was supported by a postdoctoral fellowship from
INSERM, France (to L. F.), National Institutes of Health Grant DK 44484 and American Digestive Health Foundation/Hoechst Marion Rousel
Research Award (to C. C.-Y.), National Institutes of Health Grants R01
DK 46082 and DK 43278 (to J. G. F.), and Liver Scholar Award ALF PN
9801-014 from the American Liver Foundation (to R. B. D.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: University of
Colorado Health Sciences Center 4200 East Ninth Ave., Box B158, Denver,
CO 80262. Tel.: 303-315-3535; Fax: 303-315-3507; E-mail: brian.
doctor{at}uchsc.edu.
Published, JBC Papers in Press, June 19, 2000, DOI 10.1074/jbc.C000092200
The abbreviations used are:
ERM, ezrin-radixin-moesin;
EBP50, ERM-binding phosphoprotein 50;
NHE-RF, Na+/H+ exchanger-regulatory factor;
NRC, normal
rat cholangiocyte;
GST, glutathione S-transferase;
PAGE, polyacrylamide gel electrophoresis;
HA, hemagglutinin;
HRP, horseradish
peroxidase;
nNOS, neuronal nitric-oxide synthase.
Evidence for Ezrin-Radixin-Moesin-binding Phosphoprotein
50 (EBP50) Self-association through PDZ-PDZ Interactions*
,, and¶
Division of Gastroenterology and Hepatology,
University of Colorado Health Sciences Center, Denver, Colorado
80262 and the § Division of Gastroenterology, The Johns
Hopkins University School of Medicine, Baltimore, Maryland 21205
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
2-adrenergic receptor, G
protein-coupled receptor kinase-6A (GRK6A), Yes-associated protein 65 (YAP65), and the cAMP-dependent cystic fibrosis
transmembrane conductance regulator Cl
channel
(cftr) (8-12). With only two PDZ domains, individual EBP50
proteins have a limited capacity to form multiprotein arrays. Theoretically, EBP50 oligomerization could amplify the capacity of the
existing PDZ domains to sequester interactive proteins within membrane
microdomains. The present study demonstrates the capacity of EBP50,
both in vivo and in vitro, to
self-associate with high affinity through PDZ-PDZ interactions.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
.
The primer sets include (a)
ggtgaattccgcagagcaagatgagcgcg/ggagaattctgctcagaggttgctgaagag (EBP50);
(b)
ggtgaattccgcagagcaagatgagcgcg/ggagaattctgctcacttgctccagtccatctg (COOH-tail); (c)
ggtgaattccgcagagcaagatgagcgcg/ggagaattcctctccattgctgaagggttc(PDZ1,2); (d)
ggtgaattccgcagagcaagatgagcgcg/ggagaattcgtccccagccttcttagtgtc (PDZ1); (e)
ggtggatccgacactaagaaggctggggac/ggagaattcctctccattgctgaagggtt (PDZ2); (f)
ggtggatccgtagacaaggaaacagatgag/ggagaattctgctcagaggttgctgaagag (COOH
Seg). HA- and FLAG-tagged full-length EBP50 was generated similarly in
pCGN-2 (David Gordon, University of Colorado Health Science Center) and
p3XFLAG-CMV-7 (Sigma) vectors, respectively. These primer sets include
(a)
ggtaagcttagatgagcgcggacgcagcg/ggtggatcctgctcagaggttgctgaagag (HA-EBP50)
and (b)
ggtaagcttaagatgagcgcggacgcagcg/ggtggatcctgctcagaggttgctgaagag (FLAG-EBP50).
-D-thiogalactopyranoside (0.5 mM
for 3 h). GST fusion proteins were enriched from the bacteria by
diluting cultures 1:40 in lysis buffer (20 mM Tris-HCl, pH
8.0, 150 mM NaCl, 1 mM EDTA, 1 mM
dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM leupeptin, 1% Nonidet P-40), sonicating, incubating (2 mM ATP, 10 mM MgSO4, 50 mM Tris, pH 7.4, 10 min, 37 °C), clarifying by
centrifugation (14,000 × g; 10 min), and incubating
the lysate with glutathione-Sepharose beads. In some cases, GST-EBP50
was subsequently eluted from the beads with glutathione elution buffer (10 mM reduced glutathione in 50 mM Tris-HCl,
pH 8.0, 30 min, 4 °C). In other experiments, EBP50 was cleaved from
GST with 12.5 units of thrombin for 1 h at 22 °C. EBP50 itself
does not contain thrombin-sensitive sites. Thrombin was then
inactivated by the addition of 1 mM phenylmethylsulfonyl
fluoride and 1 µM leupeptin.
1) was brought to room
temperature, incubated for 1 h, and divided into two aliquots. The
first aliquot was cross-linked in 3.3 mM
bis(sulfosuccinimidyl) suberate (Pierce) for 1 h at room
temperature; the second aliquot received an equivalent volume of
phosphate-buffered saline. These two solutions received 0.1 volume of
10% SDS, 50% sucrose and were assayed for EBP50 cross-linking by
Western blotting.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (19K):
[in a new window]
Fig. 1.
Characterization of GST-EBP50 fusion
protein. A, GST-EBP50 expression. Full-length GST-EBP50
fusion proteins were expressed, isolated, and characterized for use in
subsequent studies. Bacteria alone (lane 1), bacteria with
GST-only vector (lane 2), or bacteria with GST-EBP50 vector
(lane 3) were evaluated by Coomassie Blue staining
(left panel), anti-GST Western blotting (center
panel), and anti-EBP50 Western blotting (right panel).
Coomassie Blue staining did not detect any protein in the bacterial
lysate and detected a single 26-kDa protein in the GST-only lysates and
a doublet protein around 80 kDa in the GST-EBP50 lysates. Western
blotting against GST detected both the single band in the GST-only lane
and the doublet in the GST-EBP50 lane. This doublet was detected when
probed with antibody directed against EBP50. B, thrombin
cleavage of GST-EBP50. EBP50 was isolated from immobilized GST-EBP50 by
thrombin treatment. GST-EBP50 is shown without (lane 1) and
with (lane 2) thrombin treatment. Coomassie Blue staining
(left panel) showed that without thrombin treatment
GST-EBP50 exists as a doublet around 80 kDa. Following cleavage from
the immobilized GST linkage, the doublet migrates at 50 and 40 kDa.
Western blotting for EBP50 (right panel) confirmed that this
lower molecular mass doublet was EBP50.
View larger version (43K):
[in a new window]
Fig. 2.
Far-Western blotting indicates that EBP50
binds a 50-kDa protein from NRC cells. Overlays of NRC cell
proteins with EBP50 fusion protein (panel A-1) showed
binding with several distinct proteins of varied molecular masses,
consistent with the presence of multiple EBP50 binding partners.
Negative albumin (Alb) controls indicate that these
interactions are comparatively specific. Although EBP50 from NRC cells
is also detected in the Western blot assay of overlaid EBP50, paired
NRC samples that were not overlaid with recombinant EBP50 had 50-kDa
bands that were consistently less intense than the 50-kDa band that was
overlaid with recombinant EBP50 (panel A-2;
arrowheads). To assess if the increased 50-kDa staining
intensity was due to overlaid EBP50, paired blots were overlaid with
biotinylated EBP50 and assayed with HRP-neutravidin (panel
B), thus eliminating the detection of EBP50 from NRC cells. Again
a 50-kDa protein was overlaid with recombinant EBP50 (panel
B-1; arrowhead). The assay was specific for the
overlaid EBP50 because paired blots not overlaid with biotinylated
EBP50 did not detect any proteins (panel B-2). This
indicates that EBP50 associates with either EBP50 or a protein that
co-migrates with EBP50 in one-dimensional gel electrophoresis.
View larger version (20K):
[in a new window]
Fig. 3.
EBP50 self-association is observed by three
distinct methods. Three separate methodologies were used to
demonstrate that EBP50 is capable of self-association. A,
first, EBP50 from the Triton-insoluble fraction of NRC cells was
separated in paired two-dimensional gel electrophoresis blots (pI 5-8;
10% gel) and subjected to either Western or far-Western blotting.
Western blotting for EBP50 detected a single protein with an apparent
mass and isoelectric point consistent with EBP50 (migration molecular
mass = 50 kDa; calculated pI = 6.2; panel 1).
Protein staining of non-EBP50 proteins serve as a reference for EBP50
(arrow; panel 2). Protein staining of a paired
sample shows the same protein separation pattern (panel 4).
Far-Western blotting with biotinylated EBP50 bound specifically to the
EBP50 protein (arrow, panel 3), demonstrating the capacity
for self-association. This observation was made in four separate
experiments. B, in a second method, EBP50 was
immunoprecipitated from NRC cells and subjected to far-Western blotting
with biotinylated EBP50. Western blotting of the immunoprecipitate
(IP) shows that EBP50 was specifically isolated (left
panel; PreClear versus EBP50). Far-Western blotting of
the immunoprecipitate shows that biotinylated EBP50 specifically binds
immunoprecipitated EBP50 (right panel; EBP50
versus albumin). C, finally, HA- and FLAG-tagged
EBP50 was co-transfected into HEK-293 cells, HA-EBP50 was
immunoprecipitated from cell lysates, and co-precipitation of
FLAG-EBP50 was assessed by Western blotting against the FLAG epitope.
Compared with control co-transfections, including HA-vector
only/FLAG-EBP50, FLAG-EBP50 was readily detected when both HA-EBP50 and
FLAG-EBP50 were co-transfected. Together, these three experimental approaches demonstrate that EBP50 is capable
of self-association.
View larger version (15K):
[in a new window]
Fig. 4.
In vitro binding analysis
demonstrates avid EBP50 binding and multimer formation.
Biotinylated recombinant EBP50 bound specifically to GST-EBP50.
A, equivalent amounts of albumin (Alb) (negative
control), GST-only (negative control), and GST-EBP50 were blotted onto
nitrocellulose (left panel). When overlaid with biotinylated
EBP50 only the GST-EBP50 protein had detectable EBP50 (right
panel), further indicating that EBP50 is capable of
self-association. B, paired blots of recombinant EBP50 (10 µg) were overlaid with biotinylated EBP50 at varied concentrations
(1-5000 nM). Blotted albumin (10 µg) served as a
negative control. The binding was relatively high in affinity and
saturable. A representative experiment from five separate experiments
is shown.
View larger version (37K):
[in a new window]
Fig. 5.
EBP50 is capable of forming trimers and
tetramers. To assess if EBP50 binding is limited to dimer
formation or is capable of forming larger multimers, recombinant EBP50
was allowed to self-associate in solution and subsequently covalently
cross-linked and assayed by Western blotting. While EBP50 dimers were
the most prevalent oligomer observed, both trimers and tetramers (at
longer exposures) were observed.
View larger version (36K):
[in a new window]
Fig. 6.
Recombinant proteins of EBP50 domains.
A, to determine the domain responsible for EBP50-EBP50
binding, specific domains of EBP50 were generated. These include the
PDZ1,2, COOH segment, COOH-tailless, PDZ1, and
PDZ2 proteins. B, Coomassie staining shows an
enrichment of the recombinant EBP50-domain proteins. w.t.,
wild type.
View larger version (26K):
[in a new window]
Fig. 7.
PDZ domains show specific binding of
EBP50. A, compared with full-length EBP50, removal of
the COOH-tail had no significant effect on binding and the COOH segment
only showed greatly diminished binding. The PDZ1,2 domain
protein, however, showed a heightened avidity for binding EBP50.
B, binding of COOH-tailless EBP50 with COOH-tailless EBP50
is not substantially different from the binding of full-length EBP50.
Using full-length EBP50 as a control, overlaid PDZ1,2
readily bound immobilized PDZ1,2 domain, demonstrating the
capacity for the PDZ domains to dictate the self-association
interaction. Each binding study was repeated three to four times with
separate preparations. C, interestingly, both of the
individual PDZ domains (PDZ1 and PDZ2) alone were
capable of binding EBP50. When the specific interactions of the two PDZ
domains were assessed, both homodimerization and heterodimerization of
the individual domains were observed but homodimer formation was
consistently greater than heterodimer formation (i.e.
PDZ1:PDZ1 > PDZ1:PDZ2;
PDZ2:PDZ2 > PDZ2:PDZ1). Alb, albumin; w.t., wild
type
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
2-adrenergic receptor or GRK6A with NHE3 (10, 13). As
evidence for multiple protein interactions between EBP50, regulatory
proteins, and effector proteins continues to emerge, a better
understanding of the molecular mechanisms that could coordinate these
interactions is required. Accordingly, the capacity of EBP50 to
oligomerize into trimers and tetramers, rather than simple dimers (Fig.
5), further extends the potential of EBP50 to sequester interactive
proteins within membrane microdomains. In this regard, EBP50
self-association seems more likely to resemble the InaD paradigm,
serving as a mechanism to congregate and integrate interactive
signaling, regulatory, and effector proteins.
ACKNOWLEDGEMENT
FOOTNOTES
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Songyang, Z.,
Fanning, A. S.,
Fu, C.,
Xu, J.,
Marfatia, S. M.,
Chishti, A. H.,
Crompton, A.,
Chan, A. C.,
Anderson, J. M.,
and Cantley, L. C.
(1997)
Nature
275,
73-77
2.
Xu, X-Z. S.,
Choudhury, A.,
Li, X.,
and Montell, C.
(1998)
J. Cell Biol.
142,
545-555
3.
Fanning, A.,
and Anderson, J.
(1999)
J. Clin. Invest.
103,
767-772
4.
Hsueh, Y-P.,
Kim, E.,
and Sheng, M.
(1997)
Neuron
18,
803-814
5.
Brenman, J. E.,
Chao, D. S.,
Gee, S. H.,
McGee, A. W.,
Craven, S. E.,
Santillano, D. R.,
Wu, Z.,
Huang, F.,
Xia, H.,
Peters, M. F.,
Froehner, S. C.,
and Bredt, D. S.
(1996)
Cell
84,
757-767
6.
Lim, S.,
Naisbitt, S.,
Yoon, J.,
Hwang, J.,
Suh, P.,
Sheng, M.,
and Kim, E.
(1999)
J. Biol. Chem.
274,
29510-29518
7.
Reczek, D.,
Berryman, M.,
and Bretscher, A.
(1997)
J. Cell Biol.
139,
169-176
8.
Weinman, E. J.,
Steplock, D.,
Wang, Y.,
and Shenolikar, S.
(1995)
J. Clin. Invest.
95,
2143-2149
9.
Hall, R.,
Ostegaard, L.,
Premont, R.,
Blitzer, J.,
Rahman, N.,
Welsh, M.,
and Lefkowitz, R.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
8496-8501
10.
Hall, R. A.,
Spurney, R. F.,
Premont, R. T.,
Rahman, N.,
Blitzer, J. T.,
Pitcher, J. A.,
and Lefkowitz, R. J.
(1999)
J. Biol. Chem.
274,
24328-24334
11.
Short, D. B.,
Trotter, K. W.,
Reczek, D.,
Kreda, S. M.,
Bretscher, A.,
Boucher, R. C.,
Stutts, M. J.,
and Milgram, S. L.
(1998)
J. Biol. Chem.
273,
19797-19801
12.
Mohler, P.,
Kreda, S.,
Boucher, R.,
Sudol, M.,
Stutts, M.,
and Milgram, S.
(1999)
J. Cell Biol.
147,
879-890
13.
Hall, R. A.,
Premont, R.T.,
Chow, C. W.,
Blitzer, J. T.,
Pitcher, J.A.,
Claing, A.,
Stoffel, R. H.,
Barak, L. S.,
Shenolikar, S.,
Weinman, E. S.,
Grinstein, S.,
and Lefkowitz, R. J.
(1998)
Nature
392,
626-630
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  G. G. Garcia, A. A. S. Akha, and R. A. Miller Age-Related Defects in Moesin/Ezrin Cytoskeletal Signals in Mouse CD4 T Cells J. Immunol., November 15, 2007; 179(10): 6403 - 6409. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Auerbach and C. M. Liedtke Role of the scaffold protein RACK1 in apical expression of CFTR Am J Physiol Cell Physiol, July 1, 2007; 293(1): C294 - C304. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Bossard, A. Robay, G. Toumaniantz, S. Dahimene, F. Becq, J. Merot, and C. Gauthier NHE-RF1 protein rescues {Delta}F508-CFTR function Am J Physiol Lung Cell Mol Physiol, May 1, 2007; 292(5): L1085 - L1094. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. C. Morales, Y. Takahashi, S. Momin, H. Adams, X. Chen, and M.-M. Georgescu NHERF1/EBP50 Head-to-Tail Intramolecular Interaction Masks Association with PDZ Domain Ligands Mol. Cell. Biol., April 1, 2007; 27(7): 2527 - 2537. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Lamprecht and U. Seidler The emerging role of PDZ adapter proteins for regulation of intestinal ion transport Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G766 - G777. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Paquet, M. J. Asay, S. R. Fam, H. Inuzuka, A. M. Castleberry, H. Oller, Y. Smith, C. C. Yun, S. F. Traynelis, and R. A. Hall The PDZ Scaffold NHERF-2 Interacts with mGluR5 and Regulates Receptor Activity J. Biol. Chem., October 6, 2006; 281(40): 29949 - 29961. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Alewine, O. Olsen, J. B. Wade, and P. A. Welling TIP-1 Has PDZ Scaffold Antagonist Activity Mol. Biol. Cell, October 1, 2006; 17(10): 4200 - 4211. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Deval, V. Friend, C. Thirant, M. Salinas, M. Jodar, M. Lazdunski, and E. Lingueglia Regulation of Sensory Neuron-specific Acid-sensing Ion Channel 3 by the Adaptor Protein Na+/H+ Exchanger Regulatory Factor-1 J. Biol. Chem., January 20, 2006; 281(3): 1796 - 1807. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. J Weinman, R. Cunningham, J. B Wade, and S. Shenolikar The role of NHERF-1 in the regulation of renal proximal tubule sodium-hydrogen exchanger 3 and sodium-dependent phosphate cotransporter 2a J. Physiol., August 15, 2005; 567(1): 27 - 32. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. F. Collins, S. A. Frye, S. Balasingham, R. C. Ford, T. Tonjum, and J. P. Derrick Interaction with Type IV Pili Induces Structural Changes in the Bacterial Outer Membrane Secretin PilQ J. Biol. Chem., May 13, 2005; 280(19): 18923 - 18930. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Montell The TRP Superfamily of Cation Channels Sci. Signal., February 22, 2005; 2005(272): re3 - re3. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Gage, E. A. Matveeva, S. W. Whiteheart, and M. von Zastrow Type I PDZ Ligands Are Sufficient to Promote Rapid Recycling of G Protein-coupled Receptors Independent of Binding to N-Ethylmaleimide-sensitive Factor J. Biol. Chem., February 4, 2005; 280(5): 3305 - 3313. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Shenolikar, J. W. Voltz, R. Cunningham, and E. J. Weinman Regulation of Ion Transport by the NHERF Family of PDZ Proteins Physiology, December 1, 2004; 19(6): 362 - 369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Cunningham, D. Steplock, F. Wang, H. Huang, X. E, S. Shenolikar, and E. J. Weinman Defective Parathyroid Hormone Regulation of NHE3 Activity and Phosphate Adaptation in Cultured NHERF-1-/- Renal Proximal Tubule Cells J. Biol. Chem., September 3, 2004; 279(36): 37815 - 37821. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Huang, D. Steplock, E. J. Weinman, R. A. Hall, Z. Ding, J. Li, Y. Wang, and L.-Y. Liu-Chen {kappa} Opioid Receptor Interacts with Na+/H+-exchanger Regulatory Factor-1/Ezrin-Radixin-Moesin-binding Phosphoprotein-50 (NHERF-1/EBP50) to Stimulate Na+/H+ Exchange Independent of Gi/Go Proteins J. Biol. Chem., June 11, 2004; 279(24): 25002 - 25009. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Mahon and G. V. Segre Stimulation by Parathyroid Hormone of a NHERF-1-assembled Complex Consisting of the Parathyroid Hormone I Receptor, Phospholipase C{beta}, and Actin Increases Intracellular Calcium in Opossum Kidney Cells J. Biol. Chem., May 28, 2004; 279(22): 23550 - 23558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Yoo, T. P. Flagg, O. Olsen, V. Raghuram, J. K. Foskett, and P. A. Welling Assembly and Trafficking of a Multiprotein ROMK (Kir 1.1) Channel Complex by PDZ Interactions J. Biol. Chem., February 20, 2004; 279(8): 6863 - 6873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. B. Sneddon, C. A. Syme, A. Bisello, C. E. Magyar, M. D. Rochdi, J.-L. Parent, E. J. Weinman, A. B. Abou-Samra, and P. A. Friedman Activation-independent Parathyroid Hormone Receptor Internalization Is Regulated by NHERF1 (EBP50) J. Biol. Chem., October 31, 2003; 278(44): 43787 - 43796. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Fang, Y.-X. Tao, F. He, M. Zhang, C. F. Levine, P. Mao, F. Tao, C.-L. Chou, S. Sadegh-Nasseri, and R. A. Johns Synaptic PDZ Domain-mediated Protein Interactions Are Disrupted by Inhalational Anesthetics J. Biol. Chem., September 19, 2003; 278(38): 36669 - 36675. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
