HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 275, Issue 33, 25061-25064, August 18, 2000

This Article Abstract Full Text (PDF) All Versions of this Article: 275/33/25061    most recent C000319200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Strack, S. Articles by Colbran, R. J. Search for Related Content PubMed PubMed Citation Articles by Strack, S. Articles by Colbran, R. J. Social Bookmarking                      What's this?

ACCELERATED PUBLICATION
Association of Calcium/Calmodulin-dependent Kinase II with Developmentally Regulated Splice Variants of the Postsynaptic Density Protein Densin-180^*

Stefan Strack, A. J. Robison^§, Martha A. Bass, and Roger J. Colbran^¶

From the Department of Molecular Physiology and Biophysics and Center for Molecular Neuroscience, Vanderbilt University Medical Center, Nashville, Tennessee 37232-0615

Received for publication, May 11, 2000

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

In a continuing search for proteins that target calcium/calmodulin-dependent protein kinase II (CaMKII) to postsynaptic density (PSD) substrates important in synaptic plasticity, we showed that the PSD protein densin-180 binds CaMKII. Four putative splice variants (A-D) of the cytosolic tail of densin-180 are shown to be differentially expressed during brain development. Densin-180 splicing affects CaMKII phosphorylation of specific serine residues. Variants A, B, and D, but not C, bind CaMKII stoichiometrically and with high affinity, mediated by a differentially spliced domain. Densin-180 differs from the previously identified CaMKII-binding protein NR2B in that binding does not strictly require CaMKII autophosphorylation. Binding of densin-180 and NR2B to CaMKII is noncompetitive, indicating different interaction sites on CaMKII. Expression of the membrane-targeted CaMKII-binding domain of densin-180 confers membrane localization to coexpressed CaMKII without requiring calcium mobilization, suggesting that densin-180 plays a role in the constitutive association of CaMKII with PSDs.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

CaMKII¹ is a broad specificity, calcium/calmodulin-dependent kinase with central roles in synaptic plasticity, learning, and memory (1). A critical autophosphorylation at Thr²⁸⁶ confers calcium-independent activity to the kinase and underlies its ability to decode the frequency of calcium transients (2). Although CaMKII is an abundant soluble protein, it is also a major component of postsynaptic densities (PSDs), cytoskeletal scaffolds for neurotransmitter receptors and their regulators (3, 4). Localization of CaMKII to PSDs is believed to be important in regulating the phosphorylation of glutamate receptor GluR1 subunits (5, 6), and CaMKII translocates to PSDs following synaptic stimulation (7, 8). We have recently identified the NR2B subunit of the N-methyl-D-aspartate (NMDA)-receptor as a targeting protein for Thr²⁸⁶-autophosphorylated CaMKII (9, 10). Here, we characterize developmentally regulated, putative splice variants of the postsynaptic density protein densin-180 as additional PSD-anchoring proteins that bind CaMKII by a mechanism different from that of NR2B.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Cloning and Expression of Densin-180 Fusion Proteins-- Rat forebrain RNA was isolated with Trizol reagent (Life Technologies, Inc.) according to supplied instructions. Sense and antisense primers corresponding to the borders of the putative cytosolic domain of densin-180 including BamHI and EcoRI adapters (sense, CGGGATCCGACAAGACATCAGATAACAGTG; antisense, GGAATTCTTAGACAGTGAGCTCACGTTG) were used to clone densin-180 by reverse transcriptase-polymerase chain reaction (RT-PCR) according to instructions for the Access RT-PCR kit (Promega). RT-PCR products were gel-purified and ligated into the prokaryotic glutathione S-transferase (GST)-fusion protein expression vector pGEX-2T (Amersham Pharmacia Biotech) and sequenced on both strands. The D variant contains a novel 141-bp insert (GenBank^TM accession no. AF266164). Truncation constructs were generated utilizing PCR or endogenous restriction sites. Site-directed mutagenesis was carried out by separately PCR-amplifying densin-180 halves 5' and 3' of the point mutation, utilizing complementary mutagenic primers that also incorporate a unique silent restriction site to permit reassembly of the two PCR products. Fusion protein were expressed and purified on glutathione-agarose by standard methods.

CaMKII Binding Assays-- Purification of the murine  isoform of CaMKII from Sf9 cells, site-specific autophosphorylation of CaMKII at Thr²⁸⁶ in the presence and at Thr^305/306 in the absence of calcium/calmodulin, and [³²P]CaMKII overlay binding assays were performed as described (11). Glutathione-microtiter plate binding and glutathione-agarose sedimentation assays were described previously (10).

Colocalization Experiments-- A membrane-targeted fusion protein cDNA was constructed as described for a similar protein targeted to mitochondria (10). Briefly, this construct encodes, from N to C termini, a 10-amino acid membrane-targeting sequence from the Lck tyrosine kinase with myristoylation and dual palmitoylation sites (12), a Myc epitope tag, and the GST and green fluorescent protein coding sequences. Domain 4 of the densin-180 cytoplasmic tail was ligated into BamHI and EcoRI sites between the GST and green fluorescent protein sequences. HEK293 cells were cotransfected with the membrane-targeted fusion protein and CaMKII expression plasmids, and colocalization was assayed by double-immunofluorescence confocal microscopy (9, 10).

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

In an effort to identify proteins that target CaMKII to PSDs, we have previously characterized a p190 band enriched in postsynaptic densities that binds Thr²⁸⁶-autophosphorylated CaMKII by overlay (11). The NR2B subunit of the NMDA receptor was shown to be a component of this 190-kDa binding activity (9, 10). To reveal other potential CaMKII-binding proteins that comigrate with NR2B, PSD proteins were treated with N-glycanase to remove N-linked carbohydrates. Deglycosylation lead to a quantitative increase in electrophoretic mobility of NR2A and NR2B subunit immunoreactivity, whereas only a fraction of the CaMKII-binding activity was shifted similarly (data not shown), implicating the existence of at least one other ~190 kDa CaMKII-binding protein in PSDs.

Developmental Splicing of the Densin-180 Cytosolic Tail-- Densin-180 is a PSD-enriched O-sialoglycoprotein of 180 kDa with a sequence predicting a large N-terminal extracellular domain, a single transmembrane domain, and a short cytosolic tail ending in a PDZ domain of unknown ligand specificity (13). As a first step toward investigating whether densin-180 is the missing CaMKII-binding protein, RT-PCR was used to isolate cDNA clones encoding the densin-180 cytosolic tail from rat brain RNA isolated at various developmental stages. The predicted 790-bp RT-PCR product (A variant) was amplified, along with additional products of 670, 570, and 940 bp, designated B through D (Fig. 1B). Sequencing revealed that the A variant encodes the known densin-180 cytosolic tail (13), whereas the B and C variants encode cytosolic tails lacking amino acids 1291-1330 and 1331-1404, respectively. The D variant encodes a C-terminal tail with a novel 47-amino acid sequence inserted after R1290 (clone numbering from Ref. 13), which is unlikely to be an incompletely spliced intron because its 5' and 3' ends do not conform to an intronic splice site consensus (17). These variants define five domains of the densin-180 cytosolic tail (Fig. 1A), presumably corresponding to differentially spliced exons; domain 1 and 5, the PDZ domain, are common to all variants (Fig. 1A). Presumed splice variations in the densin-180 extracellular domain also were described (13), implying even greater structural diversity of densin-180. The putative splicing of the cytosolic tail appears to be developmentally regulated. Expression of the D variant was predominant at E18 but decreased during early postnatal development, paralleling increased expression of A and B variants (Fig. 1B). The C variant was most consistently detected in embryonic and early postnatal RNA samples. Since most synapses (and PSDs develop postnatally, embryonic forms of densin-180 may be involved in early developmental processes such as process outgrowth and path finding.

View larger version (69K): [in this window] [in a new window]   Fig. 1.   Identification of developmentally regulated densin-180 cytosolic tail variants. Panel A, domain diagram of densin-180. The cytosolic tail is expanded, showing putative exon boundaries defined by the sequence of the indicated cDNA variants isolated by RT-PCR. The sequence of the novel insert (domain 2) in the D variant is listed (GenBankTM accession number AF266164). Panel B, developmental expression of dension-180 tail variants. Total RNA from rat brains of the indicated ages (in days; E, embryonic; P, postnatal; and Adult, >6 weeks old) was analyzed by RT-PCR. A gray-scale inverted image of an ethidium bromide-stained gel is shown. A-D, variants are indicated by solid arrowheads. The identity of additional bands below A and D variants (open arrowheads) is unknown, because they could not be recovered by ligation into plasmids. Similar results were obtained in six RT-PCR reactions with three sets of RNA samples.

Differential Phosphorylation of Densin-180 Variants-- Densin-180 can be phosphorylated by CaMKII in PSDs at unidentified sites (18). Phosphoamino acid analysis following exhaustive phosphorylation of cytosolic tail fusion proteins by CaMKII in vitro revealed 90% Ser phosphate and 10% Thr phosphate, indicating phosphorylation at multiple sites (data not shown). Intriguingly, a sequence matching a consensus CaMKII phosphorylation site, (I/L)XRXX(S/T) (14), bridges domain boundaries and is altered in some densin variants (Fig. 2A). Deletion of domain 3 in variant B removes Ser⁹⁴ as a potential phosphate acceptor (numbering starting with the first residue of the longest, D variant cytosolic tail), but reconstitutes the consensus motif with Ser¹³⁴ in domain 4. Insertion of domain 2 of the D variant replaces the terminal LDR residues of domain 1 with LQK, which differs only in a conservative substitution (Arg to Lys) from the phosphorylation consensus. Ser⁹⁴ (or the positionally equivalent Ser¹³⁴ in the B variant) was mutated to Asp, and CaMKII phosphorylation of the GST-cytosolic tail fusion proteins was compared with wild-type sequences (Fig. 2B). Replacing this serine in the A, B, and D variants reduced ³²P incorporation by about half and abolished phosphorylation of the C variant completely, demonstrating that differential splicing conserves phosphorylation of this residue. These data also imply the existence of an additional phosphorylation site in domain 4, missing in the C variant. Phosphoamino acid analysis of truncation constructs narrowed down the candidate residue to the single serine within residues 180-205, Ser¹⁹⁸ (data not shown), even though the context of this residue (TKGQRS) does not conform to the CaMKII phosphorylation consensus (14). Indeed, the S198D mutant A variant displayed a 40-50% reduced phosphorylation, and the S94D/S198D double mutant could be phosphorylated to less than 10% of wild-type (Fig. 2B), indicating that these two residues are the major CaMKII phosphorylation sites, at least in vitro.

View larger version (77K): [in this window] [in a new window]   Fig. 2.   Identification of CaMKII phosphorylation sites in densin-180. Panel A, partial domain diagram of densin-180 cytosolic tails centering on a consensus CaMKII phosphorylation motif that bridges domain boundaries. The phosphorylated serine (S94 in lanes A, C, and D; S134 in lane B; numbering of the D variant cytosolic tail) is highlighted. Panel B, in vitro phosphorylation of densin-180 cytosolic tail GST-proteins. CaMKII was Thr286-autophosphorylated (14) and incubated (30 min, 30 °C) at 2.5 nM in the absence of calcium/calmodulin with 200 µM [-32P]ATP and the indicated wild-type (w.t.) at ~2 µM or mutant densin-180 cytosolic tails expressed as GST-fusion proteins. Reactions were analyzed by SDS-PAGE followed by Coomassie Blue protein staining (top) and autoradiography (32P, bottom). Arrowheads indicate full-length fusion protein and asterisks, a major proteolytic fragment. Molecular weight markers are shown between panels. Full-length wild-type proteins were phosphorylated to 0.1-0.2 mol/mol stoichiometry in these experiments, representative of four.

CaMKII Binding to Densin-180 Variants-- To determine whether CaMKII can stably interact with the cytosolic tails of densin-180, fusion proteins were probed with CaMKII, ³²P-labeled by autophosphorylation at Thr²⁸⁶ ([³²P-Thr²⁸⁶]CaMKII). Specific binding was detected to the full-length cytosolic tails of the A, B, and D but not the C variant (Fig. 3A); signal intensities were similar to CaMKII binding to NR2B fusion proteins on the same blots (not shown). The failure of CaMKII to bind to the C variant suggested that domain 4 contains important binding determinants. Furthermore, overlay analysis of truncation constructs demonstrated that domain 4 is sufficient for CaMKII binding (Fig. 3B). Residues 155-182 within domain 4 were found necessary for binding but supported only reduced interaction with CaMKII when expressed in isolation, suggesting that flanking regions may stabilize the interaction of CaMKII with densin-180 residues 155-182. Interestingly, the sequence of this domain bears no resemblance to that of the CaMKII-binding domain in NR2B (residues 1290-1309 (14)). Whereas NR2B-(1290-1309) contains a high affinity CaMKII phosphorylation site that modulates CaMKII binding (14), residues 155-182 in densin-180 are not phosphorylated and the presumed phosphomimetic S94D/S134D and S198D mutations do not affect CaMKII binding by overlay (not shown).

View larger version (36K): [in this window] [in a new window]   Fig. 3.   Differential binding of CaMKII to densin-180 variants and binding domain mapping. A, GST-fusion proteins of the indicated densin-180 cytosolic tail variants (~2 µg/lane) were separated by SDS-PAGE, blotted, and stained for protein with Ponceau-S (top) followed by [32P-Thr286]CaMKII overlay (200 nM) and autoradiography (bottom). Molecular weight markers are indicated on the right. B, GST-fusion proteins of the full-length A variant cytosolic tail and the diagrammed truncations (D variant numbering starting after transmembrane domain) (~0.5 µg/lane) were analyzed for CaMKII binding as in panel A. The region necessary for binding is cross-hatched with its sequence listed on top. Data are representative of six similar experiments.

To determine the affinity of the CaMKII:densin-180 interaction, [³²P-Thr²⁸⁶]CaMKII was incubated with densin-180 cytosolic tail (A variant) GST-fusion proteins immobilized on glutathione-coated microtiter plates (Fig. 4A). CaMKII bound saturably with an affinity of 150-250 nM (n = 2), and Scatchard analysis indicated a simple bimolecular event (not shown). This K_d is similar to the K_d for the CaMKII:NR2B interaction (9) and two orders of magnitude lower than the average concentration of CaMKII in neurons (11, 15), suggesting that both complexes can exist in neurons.

View larger version (27K): [in this window] [in a new window]   Fig. 4.   Characterization of CaMKII binding to densin-180. A, graph; [32P-Thr286]CaMKII at the indicated concentrations was allowed to bind to the GST-densin-180 A variant (10 µg/well) immobilized in glutathione-coated microtiter wells, and bound CaMKII was quantified by liquid scintillation counting. Inset, binding of 50 nM [32P]CaMKII phosphorylated at Thr286 or Thr305/306 to GST-densin-180 A (densin) or GST-NR2B-(1260-1316) (NR2B) by the glutathione-plate assay. Means of duplicates ± S.D. are plotted. B, glutathione-agarose cosedimentation assay showing stoichiometric association of densin-180 with [P-Thr286]CaMKII (densitometric ratio 1.0 ± 0.1, n = 2). CaMKII was incubated under calcium/calmodulin-dependent autophosphorylation conditions without () or with (+) ATP. After stopping phosphorylation, incubation was continued with equimolar (1 µM) GST-densin-180 A, residues 1-205 (densin), or GST alone, followed by purification on glutathione-agarose (10). Aliquots of the incubation mixture (input) and the glutathione-agarose pellet were analyzed by SDS-PAGE, blotted, and stained for total protein with Ponceau-S (top) followed by immunoblotting with a phospho-Thr286-specific CaMKII antibody (-pT286 (Promega), bottom). The full-length densin-180 GST-fusion protein and GST are indicated by solid arrowheads, CaMKII by open arrowheads. Densin-180 fragments are labeled with asterisks. Molecular weight markers are shown on the right. C, failure of NR2B to compete for densin-180 binding to CaMKII. [32P-Thr286]CaMKII (100 nM) in the presence of the indicated concentrations of a soluble bacterial protein extract expressing His6-NR2B-(1185-1482) (supplemented to 400 µg/ml with control bacterial extract) was allowed to bind to GST-densin-180 A (densin) or GST-NR2B-(1260-1316) (NR2B) on glutathione-coated plates. The means of duplicates ± S.D. are plotted. Data are representative of 2-3 experiments.

NR2B only binds to the Thr²⁸⁶-autophosphorylated, calcium/calmodulin-independent form of CaMKII (9, 10). In contrast, densin-180 bound significant amounts of inactive CaMKII, ³²P-labeled by Thr^305/306 autophosphorylation in the absence of calcium/calmodulin (11), in glutathione-plate assays (Fig. 4A, inset), a finding that was confirmed in overlay experiments (not shown). Furthermore, in glutathione-agarose cosedimentation experiments, Thr²⁸⁶ autophosphorylation increased the amount of CaMKII copurifying with densin-180 to stoichiometric levels, even though some CaMKII copurified without prior autophosphorylation (Fig. 4B).

The finding that the densin-180 and NR2B interactions differ in their degree of dependence on CaMKII Thr²⁸⁶ autophosphorylation, combined with the lack of conservation between the CaMKII-binding domains in NR2B and densin-180, suggests different mechanisms of binding. Competition experiments support this conclusion. Whereas soluble NR2B cytosolic tail protein inhibits CaMKII binding to immobilized GST-NR2B fusion protein in a concentration-dependent manner, it has no effect on CaMKII binding to GST-densin-180 (Fig. 4C), indicating that densin-180 and NR2B interact with different and independent sites on CaMKII and suggesting that ternary complexes may exist in neurons.

Densin-180 Sequences Target CaMKII in Cells-- Densin-180 is highly enriched in PSDs and colocalizes with CaMKII at synapses of hippocampal neurons (13), consistent with our proposed function of densin-180 as a CaMKII-targeting protein. To demonstrate directly that densin-180 can alter the subcellular localization of CaMKII, we cotransfected HEK293 cells with CaMKII and a synthetic fusion protein targeted to the membrane via multiple acylations (see "Experimental Procedures"). This fusion protein was expressed in large patches and in small punctate or ring-shaped profiles (Fig. 5). The small profiles, shown to be on the cell surface by optical sectioning, likely correspond to caveolae, where the tyrosine kinase Lck from which the membrane-targeting sequence was derived is localized (16). Coexpression of the membrane-targeted fusion protein without insert had no effect on the localization of CaMKII, which remained diffusely localized in the cytoplasm (Fig. 5). When the CaMKII-binding domain 4 of densin-180 (residues 132-205, Fig. 3B) was inserted into the membrane-targeting vector, CaMKII localization changed dramatically, resulting in strong colocalization (Fig. 5).

View larger version (47K): [in this window] [in a new window]   Fig. 5.   Densin-180 sequences target CaMKII to the membrane. A membrane-targeted fusion protein with Myc epitope tag was coexpressed with CaMKII in HEK293 cells and localized by double-immunofluorescence microscopy with antibodies to CaMKII (red) and Myc epitope (green). CaMKII was diffusely cytoplasmic when cotransfected with the fusion protein without a densin-180 insert (control, top) but perfectly colocalized with a fusion protein containing densin-180 domain 4 (residues 132-205, bottom) apparent as yellow in the merged image. Arrows point to circular profiles, presumably caveolae. Identical results were obtained in three transfections. Scale bars = 10 µM.

Colocalization of CaMKII with artificially targeted NR2B sequences and NMDA receptors containing the full-length NR2B subunit requires calcium mobilization and is not absolute, presumably because CaMKII:NR2B complex formation requires Thr²⁸⁶ autophosphorylation of CaMKII but is antagonized by NR2B phosphorylation (9, 10). In contrast, CaMKII and densin-180 colocalization was near perfect under basal conditions and was not detectably altered by calcium ionophore treatment (2 µM A23187 for 5 and 15 min, data not shown).

In summary, densin-180 may be responsible for constitutively anchoring CaMKII to the PSD, where it is poised to respond to localized calcium influx by phosphorylating postsynaptic substrates important in synaptic plasticity. The highly regulated CaMKII:NR2B interaction (9, 10), on the other hand, may underlie the dynamic association of CaMKII with PSDs following synaptic activation (7, 8). Although phosphorylation of densin-180 itself does not appear to affect CaMKII binding, the careful reconstitution of one of the phosphorylation sites during alternative splicing suggests phosphorylation could have other important roles, perhaps in regulating the association of densin-180 with other proteins. Finally, the existence of the C variant of densin-180 that lacks the CaMKII-binding domain suggests alternative splicing as a potential mechanism for regulating the association of CaMKII with PSDs.

	FOOTNOTES

^* This work was supported by National Institutes (NIH) of Health Grant NS37508 and American Heart Association Grants-in-aid 96010040 (National) and 9950865V (Southeast affiliate). Confocal microscopy was performed using the Vanderbilt Cell Imaging Resource (supported by NIH Grants CA68485 and DK20593).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AF266164 (D variant).

Present address: Dept. of Pharmacology, 2-432 BSB, University of Iowa College of Medicine, Iowa City, IA 52242.

^§ Recipient of a Molecular Endocrinology Training Program stipend (5T32DK07563).

^¶ To whom correspondence should be addressed: Dept. of Molecular Physiology & Biophysics, Rm. 762, MRB-I, Vanderbilt University, Nashville, TN 37232-0615. Tel.: 615-936-1630; Fax: 615-322-7236; E-mail: Roger.Colbran@mcmail.vanderbilt.edu.

Published, JBC Papers in Press, May 25, 2000, DOI 10.1074/jbc.C000319200

	ABBREVIATIONS

The abbreviations used are: CaMKII, calcium/calmodulin-dependent protein kinase II; [P-Thr²⁸⁶]CaMKII, CaMKII autophosphorylated at threonine 286; PSD, postsynaptic density; NMDA, N-methyl- D-aspartate; PCR, polymerase chain reaction; RT-PCR, reverse transcriptase-PCR; GST, glutathione S-transferase; PAGE, polyacrylamide gel electrophoresis; bp, base pair(s).

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				R. S. Vest, K. D. Davies, H. O'Leary, J. D. Port, and K. U. Bayer Dual Mechanism of a Natural CaMKII Inhibitor Mol. Biol. Cell, December 1, 2007; 18(12): 5024 - 5033. [Abstract] [Full Text] [PDF]

				K. U. Bayer, E. LeBel, G. L. McDonald, H. O'Leary, H. Schulman, and P. De Koninck Transition from Reversible to Persistent Binding of CaMKII to Postsynaptic Sites and NR2B J. Neurosci., January 25, 2006; 26(4): 1164 - 1174. [Abstract] [Full Text] [PDF]

				R. O. Solomonia, A. Kotorashvili, T. Kiguradze, B. J. McCabe, and G. Horn Ca2+/calmodulin protein kinase II and memory: learning-related changes in a localized region of the domestic chick brain J. Physiol., December 1, 2005; 569(2): 643 - 653. [Abstract] [Full Text] [PDF]

				A. J. Robison, R. K. Bartlett, M. A. Bass, and R. J. Colbran Differential Modulation of Ca2+/Calmodulin-dependent Protein Kinase II Activity by Regulated Interactions with N-Methyl-D-aspartate Receptor NR2B Subunits and {alpha}-Actinin J. Biol. Chem., November 25, 2005; 280(47): 39316 - 39323. [Abstract] [Full Text] [PDF]

				A. J. Robison, M. A. Bass, Y. Jiao, L. B. MacMillan, L. C. Carmody, R. K. Bartlett, and R. J. Colbran Multivalent Interactions of Calcium/Calmodulin-dependent Protein Kinase II with the Postsynaptic Density Proteins NR2B, Densin-180, and {alpha}-Actinin-2 J. Biol. Chem., October 21, 2005; 280(42): 35329 - 35336. [Abstract] [Full Text] [PDF]

				N. R. Forsthoefel, K. Cutler, M. D. Port, T. Yamamoto, and D. M. Vernon PIRLs: A Novel Class of Plant Intracellular Leucine-rich Repeat Proteins Plant Cell Physiol., June 1, 2005; 46(6): 913 - 922. [Abstract] [Full Text] [PDF]

				A. Quitsch, K. Berhorster, C. W. Liew, D. Richter, and H.-J. Kreienkamp Postsynaptic Shank Antagonizes Dendrite Branching Induced by the Leucine-Rich Repeat Protein Densin-180 J. Neurosci., January 12, 2005; 25(2): 479 - 487. [Abstract] [Full Text] [PDF]

				N. Otmakhov, J.-H. Tao-Cheng, S. Carpenter, B. Asrican, A. Dosemeci, T. S. Reese, and J. Lisman Persistent Accumulation of Calcium/Calmodulin-Dependent Protein Kinase II in Dendritic Spines after Induction of NMDA Receptor-Dependent Chemical Long-Term Potentiation J. Neurosci., October 20, 2004; 24(42): 9324 - 9331. [Abstract] [Full Text] [PDF]

				L. C. Griffith, C. S. Lu, and X. X. Sun CaMKII, an Enzyme on the Move: Regulation of Temporospatial Localization Mol. Interv., October 1, 2003; 3(7): 386 - 403. [Abstract] [Full Text] [PDF]

				D. K. Fong, A. Rao, F. T. Crump, and A. M. Craig Rapid Synaptic Remodeling by Protein Kinase C: Reciprocal Translocation of NMDA Receptors and Calcium/Calmodulin-Dependent Kinase II J. Neurosci., March 15, 2002; 22(6): 2153 - 2164. [Abstract] [Full Text] [PDF]

				I. Izawa, M. Nishizawa, K. Ohtakara, and M. Inagaki Densin-180 Interacts with delta -Catenin/Neural Plakophilin-related Armadillo Repeat Protein at Synapses J. Biol. Chem., February 8, 2002; 277(7): 5345 - 5350. [Abstract] [Full Text] [PDF]

				M. G. Giovannini, R. D. Blitzer, T. Wong, K. Asoma, P. Tsokas, J. H. Morrison, R. Iyengar, and E. M. Landau Mitogen-Activated Protein Kinase Regulates Early Phosphorylation and Delayed Expression of Ca2+/Calmodulin-Dependent Protein Kinase II in Long-Term Potentiation J. Neurosci., September 15, 2001; 21(18): 7053 - 7062. [Abstract] [Full Text] [PDF]

				R. S. Walikonis, A. Oguni, E. M. Khorosheva, C.-J. Jeng, F. J. Asuncion, and M. B. Kennedy Densin-180 Forms a Ternary Complex with the {alpha}-Subunit of Ca2+/Calmodulin-Dependent Protein Kinase II and {alpha}-Actinin J. Neurosci., January 15, 2001; 21(2): 423 - 433. [Abstract] [Full Text] [PDF]

				F. Gardoni, C. Bellone, F. Cattabeni, and M. Di Luca Protein Kinase C Activation Modulates alpha -Calmodulin Kinase II Binding to NR2A Subunit of N-Methyl-D-Aspartate Receptor Complex J. Biol. Chem., March 2, 2001; 276(10): 7609 - 7613. [Abstract] [Full Text] [PDF]

				B. Favre, L. Fontao, J. Koster, R. Shafaatian, F. Jaunin, J.-H. Saurat, A. Sonnenberg, and L. Borradori The Hemidesmosomal Protein Bullous Pemphigoid Antigen 1 and the Integrin beta 4 Subunit Bind to ERBIN. MOLECULAR CLONING OF MULTIPLE ALTERNATIVE SPLICE VARIANTS OF ERBIN AND ANALYSIS OF THEIR TISSUE EXPRESSION J. Biol. Chem., August 24, 2001; 276(35): 32427 - 32436. [Abstract] [Full Text] [PDF]

				T. R. Soderling, B. Chang, and D. Brickey Cellular Signaling through Multifunctional Ca2+/Calmodulin-dependent Protein Kinase II J. Biol. Chem., February 2, 2001; 276(6): 3719 - 3722. [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 275/33/25061    most recent C000319200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Strack, S. Articles by Colbran, R. J. Search for Related Content PubMed PubMed Citation Articles by Strack, S. Articles by Colbran, R. J. Social Bookmarking                      What's this?