|
Originally published In Press as doi:10.1074/jbc.M004251200 on May 31, 2000
J. Biol. Chem., Vol. 275, Issue 33, 25095-25101, August 18, 2000
Analysis of the Inhibition of MyoD Activity by ITF-2B and
Full-length E12/E47*
Helen
Petropoulos and
Ilona S.
Skerjanc§
From the Department of Biochemistry, University of Western Ontario,
London, Ontario N6A 5C1, Canada
Received for publication, May 18, 2000
 |
ABSTRACT |
MyoD heterodimerizes with E type factors (E12/E47
and ITF-2A/ITF-2B) and binds E box sequences within promoters of
muscle-specific genes. In transient transfection assays, MyoD activates
transcription in the presence of ITF-2A but not ITF-2B, which contains
a 182-amino acid N-terminal extension. The first 83 amino acids of the
inhibitory N terminus of ITF-2B show high sequence homology to the N
terminus of full-length E12/E47. Previous studies that showed
activation of MyoD by E12 used an artificially N-terminally truncated
form. Here we show that the full-length form of E12 inhibits MyoD
function. A conserved -helix motif, capable of interacting with the
transcriptional machinery, was not essential for inhibition.
Furthermore, the fusion of N-terminal ITF-2B sequences or
non-inhibiting ITF-2A sequences to truncated E12 was sufficient in
converting the activator into an inhibitor. Overexpression of ITF-2B
did not inhibit C2C12 myogenesis or affect levels of endogenous muscle
gene expression, consistent with the finding that inhibitory E type
proteins are present in muscle. Furthermore, we found that MyoD
co-transfected with either ITF-2B or ITF-2A converted fibroblasts into
myoblasts with the same frequency. Our findings suggest that the
ability of E type proteins to inhibit MyoD activity is dependent on the context of the E box.
 |
INTRODUCTION |
Skeletal muscle development is known to be dependent on a family
of basic helix-loop-helix
(bHLH)1 transcription
factors, termed the myogenic regulatory factors (MRFs). The family
includes MyoD, myf5, myogenin, and myf6/MRF4/herculin (1-7). Ectopic
expression of any family member in a wide range of non-muscle cells
results in the conversion of these cells to the skeletal muscle lineage
(8, 9). The myogenic regulatory factors regulate muscle-specific gene
expression by heterodimerizing with the E type family of ubiquitous
bHLH transcription factors via the HLH domains and binding the E box
consensus sequence (CANNTG) within muscle-specific promoters via the
basic domains (10, 11). Homodimers of MyoD are inactive, whereas
heterodimers between MyoD and E type proteins can activate E
box-containing promoters. Therefore, heterodimerization with the E type
transcription factors is necessary for activity of the myogenic
regulatory factors.
The E type family of bHLH transcription factors includes E12/E47
(12-14), ITF-2 (15-17), and HEB (18). The E type proteins contain two
activation domains, the AD1 domain and the AD2 or LH domain (19, 20).
Two alternatively spliced forms of mouse ITF-2, termed ITF-2A and
ITF-2B, were shown to differentially regulate MyoD activation. In
transient transfection assays, ITF-2B was found to inhibit MyoD
activation of the cardiac -actin
muscle-specific promoter (21) and the muscle-specific creatine
kinase (MCK) promoter (22). Inhibition was shown to occur in both
P19 cells and C2C12 cells. The activator, ITF-2A, and the inhibitor,
ITF-2B, are co-expressed in several cell types including skeletal
muscle cells (21, 22).
The activity of the myogenic regulatory factors is also inhibited by
the Id gene family (23). These factors contain an HLH domain but lack a
basic domain. They are thought to inhibit the activity of the myogenic
factors by forming inactive heterodimers with the E type proteins, thus
sequestering them from myogenic factor binding (23, 24). Several
studies suggest this is not the primary mechanism by which inhibition
by ITF-2B occurs. Inhibition by Id can be reversed by the addition of
excess E type activator, whereas inhibition by ITF-2B cannot (21).
Furthermore, MyoD/ITF-2B heterodimers bind DNA (22). Together, these
results suggest that ITF-2B can form a stable heterodimer with MyoD,
which can then bind the E box consensus, but this complex is unable to
activate transcription.
Basic helix-loop-helix transcription factors have also been shown to
inhibit MyoD activity. Twist inhibits MyoD activity by mechanisms
involving the titration and sequestration of the E type proteins, by
inhibition of the MyoD co-factor MEF2, and direct inhibition via
interaction with the basic domain of MyoD (25-27). MyoR has also been
shown to inhibit MyoD activity by mechanisms including competition for
DNA-binding sites, active repression through a repressor domain, and
titration of the E type proteins (28). More recently, the bHLH protein
OUT has been shown to inhibit MyoD activity by E type titration and by
preventing E12-MyoD heterodimers from binding DNA (29).
Here we set out to examine the role of the N-terminal domain of ITF-2B
in the inhibition of MyoD activity. We found that the full-length
E12/E47 proteins contain a domain that is highly similar to the
N-terminal inhibitory region of ITF-2B. Like ITF-2B, both full-length
E12 and E47 proteins were shown to inhibit transactivation of the
exogenous cardiac -actin promoter by MyoD.
 |
EXPERIMENTAL PROCEDURES |
Plasmid Constructs--
The cDNAs utilized in these
experiments were all driven by the mouse pgk-1 promoter
(30). Expression constructs of mouse ITF-2A and ITF-2B, human E12
(partial E12 cDNA), MyoD, CAT, puromycin, and lacZ as
well as the cardiac -actin promoter driving
the lacZ gene (CA-LacZ) have been previously described (21).
The promoter construct contained 440 bp of the human cardiac
-actin promoter (31), with one E box that is
essential for expression during skeletal myogenesis (32). The human
full-length E12 and E47 cDNAs were kindly provided by C. Murre (see
Ref. 33). The PGK-vector plasmid contains the pgk-1
(phosphoglycerate kinase) promoter alone.
The mutant ITF-2B plasmid, which corresponds to Mutant 2 (34), was
constructed utilizing the Muta-geneTM Phagemid in
vitro mutagenesis kit, according to manufacturer's instructions
(Bio-Rad). The plasmid used was a 728-bp
SalI-SstI fragment of ITF-2B subcloned into
pBluescript KS+ (Stratagene Cloning Systems, La Jolla). The
mutagenic oligonucleotide used was
AAACATCGCACTGCGATCTAGACGATCACTCAGCTCT (altered nucleotides are shown in bold).
The chimeric proteins were constructed by PCR amplification. The N
terminus of ITF-2B (initiator methionine underlined) was amplified with the 5' oligonucleotide sequence
AAAGGTAACATGCATCACCAACAGCGA and the following 3'
oligonucleotide sequences: AAAGGTACCACTGAAGACGGCAAACCC (aa
1-182), AAAGGTACCATTCTGGAATTGACAAAA (aa 1-99),
AAAGGTACCACA TTTGAGCCAGTGAAA (aa 1-49), and
AAAGGTACCATCGCACTGAAATCCAGT (aa 1-24). The fragment from aa
11-28 was amplified using the following oligonucleotides:
AAAGGTACCATGGGGACGGACAAAGAGCTG and
AAAGGTACCGGAGGCGAA AACATCGCA. The fragment encompassing aa
25-49 was amplified using the following oligonucleotides:
AAAGGTACCATGTTTTCGCCTCCTGTA and
AAAGGTACCACATTTGAGCCAGTGAAA. The first 182 aa of ITF-2A were
amplified using the following oligonucleotides:
AAAGGTACCATGTACTGCGCATACACC and
AAAGGTACCGAGGAAAAGCTGTTGTTC. PCR was performed
utilizing 10 ng of ITF-2A or ITF-2B cDNA, 0.25 µM of
each oligonucleotide, and 2.5 units of Taq polymerase (Life
Technologies, Inc.) in 100 µl. Standard PCR conditions
were employed with annealing temperatures between 55 and 68 °C. Each
fragment was then inserted into a KpnI site (boldface
sequences in oligonucleotides) upstream of and in frame with
E12.
Cell Culture and Transfections--
P19 embryonal carcinoma
cells were cultured as described previously (35). Transfections were
carried out by the calcium phosphate method (36). Briefly, 7.5 × 105 cells in 5 ml of medium were exposed to DNA precipitate
for 6-9 h in a 60-mm tissue culture dish. The DNA precipitates
consisted of 4 µg of CA-LacZ and 1 µg of PGK-CAT in the absence or
presence of 2 µg of PGK-MyoD and 5 µg of the various E type
containing plasmids. Each transfection was brought up to 12 µg of
total DNA with PGK-vector plasmid. Cultures were harvested 24 h
after transfection.
-Galactosidase and chloramphenicol acetyltransferase (CAT) assays
were performed as described previously (37, 38). -Galactosidase activities for each culture were normalized for transfection efficiency against CAT activity as well as to the activity of MyoD alone. The
background activity of the promoter alone was subtracted from each
sample within an experiment.
C2C12 myoblasts were cultured under growth conditions in 15% 1:1
cosmic calf/fetal bovine serum (Cansera, Rexdale, Ontario, Canada, and
HyClone, Logan, UT, respectively) in -minimum Eagle's medium. Cell
lines that stably expressed ITF-2A, ITF-2B, E12, or PGK vector were
created by transfecting 10 µg of PGK-ITF-2A, PGK-ITF-2B, or PGK
vector plasmid, 1 µg of PGK-puromycin, and 1 µg of PGK-LacZ by the
calcium phosphate method. Myoblasts were plated into 60-mm dishes,
selected for puromycin resistance for 1 week, and then transferred into
differentiation media (2% horse serum) for 4 days.
Transient transfections of C2C12 myoblasts were carried out utilizing
FuGENETM 6 transfection reagent as per the manufacturer's
instructions (Roche Molecular Biochemicals). Briefly, 11 µg of
PGK-ITF-2B or PGK-vector and 1 µg of pEGFP-N1
(CLONTECH Laboratories, Inc., Palo Alto, CA) and
FuGENETM 6 reagent mixtures were added to C2C12 cells in
100-mm dishes. GFP fluorescence was utilized to assess transfection
efficiency. Myoblasts were transferred from growth media to
differentiation media 24 h later.
Whole Mount in Situ Hybridization of Micromass Cultures--
For
in situ hybridization, C2C12 stable cell lines were
differentiated as above and fixed with 4% paraformaldehyde overnight at 4 °C. The cells were rehydrated, and in situ
hybridizations were carried out as described previously (39). A total
of about 80 colonies was present on each plate, and the extent of
myogenesis was calculated by counting colonies containing
multinucleated myotubes that expressed the transfected gene product.
This experiment was repeated twice with similar results.
Digoxigenin-labeled riboprobes were transcribed from
single-stranded DNA templates according to the manufacturer's
instructions (Roche Molecular Biochemicals) and quantitated as
described previously using an anti-Digoxigenin antibody
conjugated to alkaline phosphatase (39). A 165-bp
SstI-AccI fragment, which contained
5'-untranslated and coding regions of ITF-2A, was utilized to create
the ITF-2A-specific probe. The ITF-2B-specific probe consisted of a PCR
fragment containing the N-terminal 99 amino acids of ITF-2B. The
E12-specific probe consisted of a 429-bp
SstI-XhoI fragment within the coding region of
E12. Images were captured using Sony DXC-9503 3CCD color video camera and analyzed using Northern Eclipse image analysis software (Empix Imaging, Inc.).
Western Blot Analysis--
Myoblast cells expressing PGK-ITF-2A,
PGK-ITF-2B, and PGK vector were differentiated as above, and myosin was
harvested by the Burridge and Bray method (40), omitting the second
dialysis step. Protein concentration of the myosin extracts was
measured by the Bio-Rad Protein Assay (Bio-Rad). Two micrograms of
protein were electrophoresed by 7% SDS-polyacrylamide gel
electrophoresis and transferred to nitrocellulose overnight at 30 V at
4 °C. Blots were probed with anti-MyHC mouse monoclonal antibody,
MF20 (1:1000 dilution) as a control for total myosin (41), and with
anti-MyHC IIB antibody BF:F3 (undiluted) against type IIB myosin (42). Anti-mouse Ig, horseradish peroxidase-linked whole antibody
(Amersham Pharmacia Biotech) was used at a 1:5000 dilution. The
reaction was visualized using the ECL SuperSignal® Substrate (Pierce)
for Western blotting and autoradiography. Quantitation was carried out
utilizing NIH Image 1.58.
Northern Blot Analysis--
The lithium chloride/urea extraction
method was used to isolate total RNA, and 6 µg were examined by
Northern blot analysis as described previously (43). The ITF-2B probe
used was an SspI-NotI fragment of ITF-2B, which
encodes the full-length cDNA. This probe detected transfected
ITF-2B and endogenous forms of ITF-2. Other probes utilized were a
600-base pair EcoRI fragment of rat myosin light chain (MLC)
1/3 and a 600-base pair PstI fragment from the last exon of
human cardiac -actin. Northern blots were
visualized by autoradiography and quantitated by NIH Image 1.58.
Myogenic Conversion of 10T1/2 Fibroblasts--
10T1/2
fibroblasts were cultured under growth conditions in 10% 1:1 cosmic
calf-fetal bovine serum in -minimum Eagle's medium. Cells on
gelatin-coated coverslips were transfected in the absence or presence
of 1 µg of PGK-MyoD, 2.5 µg of the various E type containing
plasmids, and 0.5 µg of pEGFP-N1 (CLONTECH
Laboratories, Inc. Palo Alto, CA) utilizing the FuGENETM 6 transfection reagent. Total DNA in each transfection was brought up to
4 µg with PGK vector plasmid. Following 24 h, cells were transferred to differentiation media, containing 2% horse serum, for 6 days. Transfection efficiency for each culture was scored utilizing GFP
fluorescence and total number of cells was estimated by counting
Hoechst-stained nuclei. To identify myogenic conversion, cells were
fixed with methanol at 20 °C and stained for myosin heavy chain
(41) as described (43). Immunofluorescence was visualized with a Zeiss
Axioskop microscope.
 |
RESULTS |
Full-length E12 and E47 Inhibit MyoD Activity--
Previous
results have shown that the N-terminal 83 amino acids of ITF-2B were
required for ITF-2B to inhibit MyoD activity (21). Consequently, we set
out to determine if other E type proteins contained similar N-terminal
sequences and possibly similar inhibitory activity. An alignment of the
N-terminal 83 amino acids with the N termini of full-length E12 and
full-length E47 (33) revealed that this domain is 51% identical among
the three E type proteins (Fig. 1). This
region has been shown to contain a conserved -helix that functions
as a transactivation domain when fused to the Gal4 DNA binding domain
(34). The E12 and E47 proteins, termed E12 and E47, utilized in
activation studies with MyoD, are fragments of the full-length proteins
and contain a synthetic initiator methionine (12). These fragments are
missing the first 216 aa compared with full-length E12 and E47 (33).
Subsequently, the partial proteins are missing the region that is
similar to the N-terminal region of the inhibitor ITF-2B (summarized in
Fig. 2A). To our knowledge,
the full-length E12 and E47 proteins have not been tested with respect
to their effect on MyoD activity.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 1.
The N-terminal 83 amino acids of
ITF-2B, full-length E12, and full-length E47 are conserved. The
N-terminal 83 amino acid domain of the inhibitor, ITF-2B, is 51%
identical to the N termini of the full-length E12 and full-length E47
proteins. The conserved amino acids are boxed.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 2.
Full-length E12 and E47 proteins inhibit MyoD
activity compared with endogenous E type proteins present in P19
cells. A, comparison of the length and domain structure
of E type bHLH proteins and their ability to activate MyoD activity.
The conserved N-terminal 83 amino acids are shown as hatched
boxes, the bHLH domains are shown as black boxes, and
the lengths of the various domains are indicated. B, the
ability of MyoD to transactivate the cardiac
-actin promoter in the presence of each E type
protein was examined. P19 cells were transfected with 4 µg of the
reporter construct CA-LacZ and 1 µg of the standardization reporter
PGK-CAT, as well as 5 µg of the various E type expression
constructs and 2 µg of MyoD. Error bars represent S.E.
with n = 4 or 5.
|
|
In order to determine if the presence of the conserved N-terminal
region (represented in Fig. 1) modified the activity of E12 and E47, we
examined the effect of full-length E12 and E47 proteins on MyoD. This
involved determining the ability of MyoD to transactivate the
cardiac -actin promoter in the presence of
each E type protein after transient transfection into P19 cells. In
agreement with previously published results, MyoD alone transactivated the cardiac -actin promoter indicating the
presence of endogenous activating E type proteins in P19 cells (21)
(Fig. 2B). Furthermore, MyoD was active in the presence of
E12 and ITF-2A but not in the presence of ITF-2B. In the presence of
full-length E12 and full-length E47, MyoD activity was decreased 3- and
5-fold, respectively, in multiple repetitive assays. Therefore,
full-length E12 and E47 proteins inhibited MyoD activity as effectively
as ITF-2B.
Mutation of the Conserved -Helix Does Not Affect
Inhibition--
A conserved -helix has been identified from aa
11-28 of E12, E47, and ITF-2B that function as transcriptional
activators when fused to the Gal4 DNA binding domain (34). Since this
region lies within the inhibitory domain of ITF-2B and can interact
with components of the transcriptional machinery, we set out to
determine if these sequences were required for inhibition. A mutant was generated in which two conserved, non-polar residues were replaced with
arginine (Fig. 3A). These
changes were shown previously to disrupt the transactivation domain
(34). Here we show that this mutant still functions as an inhibitor,
decreasing MyoD activity 4-fold compared with MyoD alone (Fig.
3B).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 3.
Mutation of amino acids within the
conserved -helix, which are crucial for
activation by the ADI domain, does not affect inhibition.
A, two amino acids within the conserved -helix, which
have been shown to be important for transactivation by the ADI domain,
were substituted by site-directed mutagenesis. B, to test
the effect of the mutation on the ability of ITF-2B to inhibit MyoD
activity, 1.5 µg of the mutated ITF-2B, wild-type ITF-2B, or E12
were co-transfected with 4 µg of CA-LacZ, 1.5 µg of PGK-MyoD, and 1 µg of PGK-CAT. Error bars represent S.E. from seven
different experiments.
|
|
Lengthening the N Terminus of E12 Converts the Activator into an
Inhibitor--
In order to identify the amino acids of ITF-2B that are
sufficient for inhibition, various portions of the N-terminal domain of
ITF-2B were fused onto the N terminus of the activating E12 protein
(Fig. 4A). To ensure the
inhibition was specific to the inhibitory region of ITF-2B, the
N-terminal 182-amino acids of the activator, ITF-2A, were also fused to
the N terminus of E12. In transient co-transfection experiments, we
observed that the addition of various fragments of the ITF-2B
N-terminal sequences as well as the N terminus of ITF-2A were all
sufficient in converting E12 into an inhibitor of MyoD activity
(Fig. 4B). The fusion proteins inhibited MyoD activity
between 2- and 5-fold. This range of inhibition may be due to small
variations in conformation or expression levels between the different
fusion proteins. This conversion did not appear to be
sequence-dependent since both non-inhibitory sequences from
ITF-2A and inhibitory sequences from ITF-2B were capable of converting
E12 into an inhibitor. Consequently, as few as 18 amino acids are
sufficient to convert E12 from an activator into an inhibitor, in a
sequence-independent manner.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
The N-terminal 182 amino acids of ITF-2A and
various sizes of the ITF-2B N terminus are sufficient to transform
E12 from an activator to an inhibitor of MyoD.
A, the N-terminal 182 amino acids of ITF-2A and ITF-2B, as
well as varying lengths of the ITF-2B N terminus, were fused in frame
to the N terminus of E12. The fused domains and the bHLH domain of
each chimeric protein are represented by the hatched and
black boxes, respectively, and MyoD activity with each is
summarized. B, to test the effect of each chimeric protein
on the activity of MyoD, 5 µg of each was co-transfected with 4 µg
of CA-LacZ, 2 µg of PGK-MyoD, and 1 µg of PGK-CAT. The activity of
MyoD in the presence of each chimeric protein was compared with that in
the presence of E12 as shown (* indicates values are significantly
different from E12 by Student's t test). Error
bars represent S.E. between 4 and 14 different experiments.
|
|
Overexpression of ITF-2B Has No Effect on Myogenesis or Fiber Type
Generation--
To study the physiological relevance of ITF-2B
inhibition of MyoD activity, ITF-2B was stably and transiently
overexpressed in C2C12 myoblasts. Cells stably expressing ITF-2B,
ITF-2A, or E12 were differentiated to determine if overexpression of
ITF-2B was sufficient to inhibit the process of myogenesis (Fig.
5). The differentiation of C2C12
myoblasts was monitored by counting colonies that contained
multinucleated myotubes, and overexpression of the E type proteins was
determined by in situ hybridization. Myotubes were found to
express high levels of ITF-2B (Fig. 5A), compared with
endogenous staining (Fig. 5B). The total number of colonies
containing myotubes and expressing ITF-2A, E12, or -galactosidase
(average of 24 colonies) was not substantially different from the
number of colonies containing myotubes and expressing the inhibitor
ITF-2B (22 colonies). C2C12 cell lines stably expressing ITF-2A and
ITF-2B to levels equivalent to endogenous levels of ITF-2 transcripts
were found to express similar amounts of cardiac -actin and
differentiate as efficiently as control cell lines (data not shown).
Therefore, C2C12 cells stably overexpressing ITF-2B were found to
differentiate with equal efficiency as cells stably overexpressing
ITF-2A, E12, or control transfected cells.

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 5.
The stable expression of ITF-2B does not
inhibit the differentiation of C2C12 myoblasts. Myoblasts were
transfected with ITF-2B, selected for stable expression, and
differentiated in media containing 2% horse serum. In situ
hybridization was used to identify differentiated colonies
overexpressing ITF-2B (A) compared with colonies expressing
endogenous ITF-2B levels (B). The bar represents
0.2 mm.
|
|
The differences we observed in the ability of ITF-2B to inhibit MyoD
activity may be due to the examination of exogenous versus endogenous promoters or to the transient versus stable
expression levels of factors. To distinguish these two possibilities,
C2C12 myoblasts were transiently transfected with ITF-2B,
differentiated into muscle, and examined by Northern blot analysis
(Fig. 6). We found that levels of
exogenous ITF-2B are high early during differentiation of transiently
transfected cells (data not shown). ITF-2B expression remained at an
average of 3-fold over the level of endogenous forms of ITF-2 (Fig.
6A, compare lanes 1 and 2 to 3 and 4) on day 4 of differentiation. Expression
levels were normalized against 18 S. The level of expression of
cardiac -actin and MLC 1/3 was not altered in cultures expressing
ITF-2B compared with control cells. Therefore, the transient
overexpression of ITF-2B was not sufficient to inhibit myogenesis or to
affect MRF activity on the endogenous cardiac
-actin promoter.

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 6.
Transient overexpression of ITF-2B does not
affect the expression of endogenous cardiac
-actin in differentiated C2C12 myoblasts.
C2C12 cells were transfected with ITF-2B and transferred to
differentiation media the next day. Total RNA from differentiated
cultures was harvested 4 days later. Northern blots containing 6 µg
of RNA were probed with ITF-2B, MLC1/3, cardiac
-actin and 18 S as indicated.
|
|
To examine further the activity of transiently transfected ITF-2B on
endogenous muscle-gene promoters, we tested the ability of MyoD to
convert fibroblasts to myoblasts in the presence of various E type
proteins (Fig. 7). We found that MyoD
could convert 10T1/2 fibroblasts to the myogenic lineage with similar
efficiency when co-transfected with ITF-2A or ITF-2B. Similarly,
full-length E12 could convert cells as efficiently as E12 in the
presence of MyoD. Therefore, expression of the inhibitory forms of the E type proteins was not sufficient to inhibit myogenic conversion by
MyoD.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7.
ITF-2A and ITF-2B convert fibroblasts to
myoblasts with the same efficiency when co-transfected with MyoD.
10T1/2 fibroblasts were transfected with 1 µg of PGK-MyoD, 2.5 µg
of the various E type genes, and 0.5 µg of GFP. Number of cells
expressing MyHC following 6 days in differentiation media was
determined by immunofluorescence. The percentage of MyHC-positive cells
was normalized against transfection efficiency, and MyoD conversion was
set to 100. Error bars represent S.E. between three
different experiments.
|
|
In addition, we tested the possibility that E type factors may play a
role in the ability of the MRFs to generate different fiber types by
activating the endogenous expression of different MyHC isoforms.
Myoblasts expressing ITF-2A or ITF-2B were differentiated to determine
if overexpression of either form affects MyHC IIB protein expression
when compared with control transfected cells. We observed no difference
in the amount of MyHC IIB protein present in ITF-2A- or
ITF-2B-expressing cells compared with control myoblast cells by Western
blot analysis (data not shown).
 |
DISCUSSION |
We have shown that full-length E12/E47 contains an N-terminal
domain homologous to the N-terminal inhibitory domain of ITF-2B. In
transient transfection assays, full-length E12/E47 inhibits MyoD
function. Therefore, similar to ITF-2, E12/E47 can either activate or
inhibit MyoD activity depending on which domains of E12/E47 are present
in the MyoD/E12/E47 heterodimer. The inhibitory activity of ITF-2B did
not require a conserved -helix, shown to be necessary for
transactivation by Gal4-E2-2 fusion proteins (34). This indicates that
the inhibitory activity within the N-terminal region is separable from
the activating function seen by others (34). Consequently, the ability
of ITF-2B to inhibit MyoD does not require interactions specifically
between the -helical domain and the transcriptional apparatus.
Finally, the overexpression of ITF-2B in C2C12 myoblasts or
MyoD-transfected fibroblasts did not result in the inhibition of
myogenesis. Therefore, whereas the presence of the inhibitory domain
inhibits MyoD transactivation of exogenous promoters, it does not
inhibit MyoD transactivation of endogenous muscle promoters.
The fusion of activating sequences from ITF-2A or inhibitory sequences
from ITF-2B onto the N terminus of E12 converted E12 from an
activator into an inhibitor. Since the inhibition was sequence-independent, it is possible that the fusion of ectopic sequences may change the conformation of the N terminus of E12, transforming it from an activator into an inhibitor. This
conformational change may simulate the mechanism by which ITF-2B
inhibits MyoD activity via its N-terminal domain. Alternatively, the
creation of a fusion protein with E12 may prevent the MyoD/ E12
fusion heterodimers from binding DNA.
Since ITF-2B forms stable heterodimers with MyoD that are capable of
binding DNA (21, 22), one hypothesis is that the conformation adopted
by the N-terminal extension of ITF-2B may sterically hinder a domain of
MyoD which is necessary for transactivation. Alternatively, ITF-2B may
hinder the binding of the E type/MRF heterodimer to transcription
factors bound to other elements within muscle-specific promoters (22).
It is possible that other sites are required for inhibition since
ITF-2B has been shown to inhibit the activity of muscle promoters
including cardiac -actin (21) and MCK but not
the activation of an artificial promoter containing E boxes (22).
Overexpression of ITF-2B did not result in the inhibition of myogenesis
in C2C12 cells and did not modulate the expression of myosin heavy
chain (type IIB), myosin light chain 1/3, or cardiac -actin.
Furthermore, when compared with the activators, ITF-2A and E12,
ITF-2B and full-length E12 did not inhibit the ability of MyoD to
convert fibroblasts to the myogenic lineage. These findings suggest
that ITF-2B expression is not sufficient to inhibit MyoD activation of
endogenous muscle-specific promoters. Therefore, ITF-2B is unlikely to
play a role in inhibiting myogenesis in vivo, consistent
with the presence of the inhibitor ITF-2B in skeletal myocytes and
adult skeletal muscle (21, 22). In contrast, Twist and MyoR, which are
not expressed in skeletal muscle cells and do inhibit differentiation
when overexpressed in myoblasts, are more likely physiological bHLH
inhibitors of myogenesis (28, 44, 45).
The differential inhibition of MyoD by ITF-2B is similar to the finding
that Id will inhibit MRF transactivation of exogenous promoters but
will not block myogenesis in C2C12 cells 2 days after the onset of
differentiation (24). Furthermore, mice null for Id1, Id2, Id3, or
Id1/Id3 (46-48) and E2A, HEB, or E2-2 gene products do not show a
muscle phenotype (49, 50). The analysis of these knock-out mice is
complicated by functional redundancy, demonstrated by the ability of
HEB to replace E2A in supporting B-lymphocyte development (51).
Many studies have shown that the function and requirement for specific
DNA elements differ in transient transfection studies compared with
transgenic mouse models (52, 53). Furthermore, transient transfection
studies have shown that the activity of cardiac
-actin and MCK varies with the size of the promoter
fragment used (54, 55). These studies suggest that the regulation of an
endogenous promoter is dependent on a complex set of factors and
promoter elements. Active MyoD-ITF-2B heterodimers may require association with factors bound to sites within endogenous promoters, which are not present in the exogenous promoters tested. Alternatively, other factors bound to the endogenous promoter may abrogate the inhibition of MyoD activity by ITF-2B. Finally, the inhibition seen on
an exogenous promoter may be negligible compared with the full activity
of an endogenous promoter.
Other differences in the regulation of exogenous versus
endogenous promoters may be due to differences in their chromatin structure (56). Co-activators such as p300/CBP and p300/CBP associated factor (57-59) and the corepressor N-CoR (60) are known to
play a critical role in regulating MyoD activity. The activity of such
factors may abrogate the inhibitory function of ITF-2B on an endogenous
promoter, whereas chromatin remodeling may not be involved in the
activation of an exogenous promoter.
It is possible that the residual activity of MyoD presence of
ITF-2B and E12 is sufficient to induce myogenesis. Alternatively, the
presence of endogenous activating E type proteins could have a
compensating effect on the activity of myogenic regulatory factors in
C2C12 and 10T1/2 cells, resulting in the lack of inhibition of
myogenesis observed. Furthermore, the activity of the E type proteins
may be limited by post-translational regulation or by degradation. It
is possible that the inhibitory activity is acting in a subtle manner
to regulate MRF function. For example, overexpression of ITF-2B may
decrease levels of muscle genes we have not tested. Several studies
indicate that the myogenic regulatory factors have specific target gene
specificities (61-65). The ability of the E type dimerization partners
to differentially regulate the activity of the myogenic regulatory
factors may be one mechanism regulating the fine-tuning of
muscle-specific gene expression. A more detailed examination of mice
null for the various E type factors may reveal a more complex role.
In summary, we have shown that E type proteins containing a conserved
N-terminal domain, such as E12/E47 and ITF-2B, have the ability to
inhibit MyoD activity in transient transfection assays. In contrast,
these inhibitors had no effect on myogenesis or myogenic conversion of
fibroblasts. Therefore, the N-terminal region of E type proteins seems
critical for regulating MyoD activity on exogenous but not endogenous
promoters. The presence of E type inhibitory proteins does not appear
to play a physiological role in the on/off regulation of myogenesis.
 |
ACKNOWLEDGEMENTS |
We thank Judy Ball and Daniel MacPhee for
critically reading the manuscript; Al Ridgeway, Sharon Wilton, David
Litchfield, and Chris Brandl for helpful discussions; and C. Murre for
providing full-length E12 and full-length E47 cDNA. We also
gratefully acknowledge the technical assistance of Joe Martens and
Andrea Weston.
 |
FOOTNOTES |
*
This work was supported in part by a grant from the Medical
Research Council of Canada.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by a studentship from the Natural Sciences and
Engineering Research Council of Canada.
§
Supported by a Medical Research Council of Canada Scholarship
(Development Grant). To whom correspondence and request for materials
should be addressed: Dept. of Biochemistry, Medical Sciences
Bldg., University of Western Ontario, London, Ontario N6A 5C1,
Canada. Tel.: 519-679-2111 (ext. 86867); Fax: 519-661-3175; E-mail: skerjanc@julian.uwo.ca.
Published, JBC Papers in Press, May 31, 2000, DOI 10.1074/jbc.M004251200
 |
ABBREVIATIONS |
The abbreviations used are:
bHLH, basic
helix-loop-helix;
MRFs, myogenic regulatory factors;
MCK, muscle-specific creatine kinase;
bp, base pair;
PCR, polymerase chain
reaction;
CAT, chloramphenicol acetyltransferase;
aa, amino acids;
MLC, myosin light chain;
MyHC, myosin heavy chain;
PGK, phosphoglycerate
kinase.
 |
REFERENCES |
| 1.
|
Davis, R. L.,
Weintraub, H.,
and Lassar, A. B.
(1987)
Cell
51,
987-1000
|
| 2.
|
Braun, T.,
Buschhausen-Denker, G.,
Bober, E.,
Tannich, E.,
and Arnold, H. H.
(1989)
EMBO J.
8,
701-709
|
| 3.
|
Edmondson, D. G.,
and Olson, E. N.
(1989)
Genes Dev.
3,
628-640
|
| 4.
|
Rhodes, S. J.,
and Konieczny, S. F.
(1989)
Genes Dev.
3,
2050-2061
|
| 5.
|
Wright, W. E.,
Sassoon, D. A.,
and Lin, V. K.
(1989)
Cell
56,
607-617
|
| 6.
|
Braun, T.,
Bober, E.,
Winter, B.,
Rosenthal, N.,
and Arnold, H. H.
(1990)
EMBO J.
9,
821-831
|
| 7.
|
Miner, J. H.,
and Wold, B.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
1089-1093
|
| 8.
|
Filvaroff, E. H.,
and Derynck, R.
(1996)
Dev. Biol.
178,
459-471
|
| 9.
|
Weintraub, H.,
Tapscott, S. J.,
Davis, R. L.,
Thayer, M. J.,
Adam, M. A.,
Lassar, A. B.,
and Miller, A. D.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
5434-5438
|
| 10.
|
Lassar, A. B.,
Buskin, J. N.,
Lockshon, D.,
Davis, R. L.,
Apone, S.,
Hauschka, S. D.,
and Weintraub, H.
(1989)
Cell
58,
823-831
|
| 11.
|
Lassar, A. B.,
Davis, R. L.,
Wright, W. E.,
Kadesch, T.,
Murre, C.,
Voronova, A.,
Baltimore, D.,
and Weintraub, H.
(1991)
Cell
66,
305-315
|
| 12.
|
Murre, C.,
McCaw, P. S.,
and Baltimore, D.
(1989)
Cell
56,
777-783
|
| 13.
|
Henthorn, P.,
McCarrick-Walmsley, R.,
and Kadesch, T.
(1990)
Nucleic Acids Res.
18,
677
|
| 14.
|
Nourse, J.,
Mellentin, J. D.,
Galili, N.,
Wilkinson, J.,
Stanbridge, E.,
Smith, S. D.,
and Cleary, M. L.
(1990)
Cell
60,
535-545
|
| 15.
|
Henthorn, P.,
Kiledjian, M.,
and Kadesch, T.
(1990)
Science
247,
467-470
|
| 16.
|
Corneliussen, B.,
Thornell, A.,
Hallberg, B.,
and Grundstrom, T.
(1991)
J. Virol.
65,
6084-6093
|
| 17.
|
Javaux, F.,
Donda, A.,
Vassart, G.,
and Christophe, D.
(1991)
Nucleic Acids Res.
19,
1121-1127
|
| 18.
|
Hu, J. S.,
Olson, E. N.,
and Kingston, R. E.
(1992)
Mol. Cell. Biol.
12,
1031-1042
|
| 19.
|
Quong, M. W.,
Massari, M. E.,
Zwart, R.,
and Murre, C.
(1993)
Mol. Cell. Biol.
13,
792-800
|
| 20.
|
Aronheim, A.,
Shiran, R.,
Rosen, A.,
and Walker, M. D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8063-8067
|
| 21.
|
Skerjanc, I. S.,
Truong, J.,
Filion, P.,
and McBurney, M. W.
(1996)
J. Biol. Chem.
271,
3555-3561
|
| 22.
|
Chen, B.,
and Lim, R. W.
(1997)
J. Biol. Chem.
272,
2459-2463
|
| 23.
|
Benezra, R.,
Davis, R. L.,
Lockshon, D.,
Turner, D. L.,
and Weintraub, H.
(1990)
Cell
61,
49-59
|
| 24.
|
Jen, Y.,
Weintraub, H.,
and Benezra, R.
(1992)
Genes Dev.
6,
1466-1479
|
| 25.
|
Spicer, D. B.,
Rhee, J.,
Cheung, W. L.,
and Lassar, A. B.
(1996)
Science
272,
1476-1480
|
| 26.
|
Hamamori, Y.,
Wu, H. Y.,
Sartorelli, V.,
and Kedes, L.
(1997)
Mol. Cell. Biol.
17,
6563-6573
|
| 27.
|
Hebrok, M.,
Fuchtbauer, A.,
and Fuchtbauer, E. M.
(1997)
Exp. Cell Res.
232,
295-303
|
| 28.
|
Lu, J.,
Webb, R.,
Richardson, J. A.,
and Olson, E. N.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
552-527
|
| 29.
|
Narumi, O.,
Mori, S.,
Boku, S.,
Tsuji, Y.,
Hashimoto, N.,
Nishikawa, S.,
and Yokota, Y.
(2000)
J. Biol. Chem.
275,
3510-3521
|
| 30.
|
Adra, C. N.,
Boer, P. H.,
and McBurney, M. W.
(1987)
Gene (Amst.)
60,
65-74
|
| 31.
|
Pari, G.,
Jardine, K.,
and McBurney, M. W.
(1991)
Mol. Cell. Biol.
11,
4796-4803
|
| 32.
|
Skerjanc, I. S.,
and McBurney, M. W.
(1994)
Dev. Biol.
163,
125-132
|
| 33.
|
Kamps, M. P.,
Murre, C.,
Sun, X. H.,
and Baltimore, D.
(1990)
Cell
60,
547-555
|
| 34.
|
Massari, M. E.,
Jennings, P. A.,
and Murre, C.
(1996)
Mol. Cell. Biol.
16,
121-129
|
| 35.
|
Rudnicki, M. A.,
and McBurney, M. W.
(1987)
in
Teratocarcinomas and Embryonic Stem Cells: A Practical Approach
(Robertson, E. J., ed)
, pp. 19-49, IRL Press at Oxford University Press, Oxford
|
| 36.
|
Chen, C.,
and Okayama, H.
(1987)
Mol. Cell. Biol.
7,
2745-2752
|
| 37.
|
Norton, P. A.,
and Coffin, J. M.
(1985)
Mol. Cell. Biol.
5,
281-290
|
| 38.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
in
Molecular Cloning: A Laboratory Manual
(Nolan, C., ed), 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 39.
|
Cash, D. E.,
Bock, C. B.,
Schughart, K.,
Linney, E.,
and Underhill, T. M.
(1997)
J. Cell Biol.
136,
445-457
|
| 40.
|
Burridge, K.,
and Bray, D.
(1975)
J. Mol. Biol.
99,
1-14
|
| 41.
|
Bader, D.,
Masaki, T.,
and Fischman, D. A.
(1982)
J. Cell Biol.
95,
763-770
|
| 42.
|
DeNardi, C.,
Ausoni, S.,
Moretti, P.,
Gorza, L.,
Velleca, M.,
Buckingham, M.,
and Schiaffino, S.
(1993)
J. Cell Biol.
123,
823-835
|
| 43.
|
Skerjanc, I. S.,
Slack, R. S.,
and McBurney, M. W.
(1994)
Mol. Cell. Biol.
1464,
8451-8459
|
| 44.
|
Lemercier, C.,
To, R. Q.,
Carrasco, R. A.,
and Konieczny, S. F.
(1998)
EMBO J.
17,
1412-1422
|
| 45.
|
Hebrok, M.,
Wertz, K.,
and Fuchtbauer, E. M.
(1994)
Dev. Biol.
165,
537-544
|
| 46.
|
Lyden, D.,
Young, A. Z.,
Zagzag, D.,
Yan, W.,
Gerald, W.,
O'Reilly, R.,
Bader, B. L.,
Hynes, R. O.,
Zhuang, Y.,
Manova, K.,
and Benezra, R.
(1999)
Nature
401,
670-677
|
| 47.
|
Rivera, R. R.,
Johns, C. P.,
Quan, J.,
Johnson, R. S.,
and Murre, C.
(2000)
Immunity
12,
17-26
|
| 48.
|
Yokota, Y.,
Mansouri, A.,
Mori, S.,
Sugawara, S.,
Adachi, S.,
Nishikawa, S.,
and Gruss, P.
(1999)
Nature
397,
702-706
|
| 49.
|
Bain, G.,
Maandag, E. C.,
Izon, D. J.,
Amsen, D.,
Kruisbeek, A. M.,
Weintraub, B. C.,
Krop, I.,
Schlissel, M. S.,
Feeney, A. J.,
and van Roon, M.
(1994)
Cell
79,
885-892
|
| 50.
|
Zhuang, Y.,
Cheng, P.,
and Weintraub, H.
(1996)
Mol. Cell. Biol.
16,
2898-2905
|
| 51.
|
Zhuang, Y.,
Barndt, R. J.,
Pan, L.,
Kelley, R.,
and Dai, M.
(1998)
Mol. Cell. Biol.
18,
3340-3349
|
| 52.
|
Donoviel, D. B.,
Shield, M. A.,
Buskin, J. N.,
Haugen, H. S.,
Clegg, C. H.,
and Hauschka, S. D.
(1996)
Mol. Cell. Biol.
16,
1649-1658
|
| 53.
|
Shield, M. A.,
Haugen, H. S.,
Clegg, C. H.,
and Hauschka, S. D.
(1996)
Mol. Cell. Biol.
16,
5058-5068
|
| 54.
|
French, B. A.,
Chow, K. L.,
Olson, E. N.,
and Schwartz, R. J.
(1991)
Mol. Cell. Biol.
11,
2439-2450
|
| 55.
|
Amacher, S. L.,
Buskin, J. N.,
and Hauschka, S. D.
(1993)
Mol. Cell. Biol.
13,
2753-2764
|
| 56.
|
Archer, T. K.,
Lefebvre, P.,
Wolford, R. G.,
and Hager, G. L.
(1992)
Science
255,
1573-1576
|
| 57.
|
Sartorelli, V.,
Huang, J.,
Hamamori, Y.,
and Kedes, L.
(1997)
Mol. Cell. Biol.
17,
1010-1026
|
| 58.
|
Puri, P. L.,
Sartorelli, V.,
Yang, X. J.,
Hamamori, Y.,
Ogryzko, V. V.,
Howard, B. H.,
Kedes, L.,
Wang, J. Y.,
Graessmann, A.,
Nakatani, Y.,
and Levrero, M.
(1997)
Mol. Cell
1,
35-45
|
| 59.
|
Eckner, R.,
Yao, T. P.,
Oldread, E.,
and Livingston, D. M.
(1996)
Genes Dev.
10,
2478-2490
|
| 60.
|
Bailey, P.,
Downes, M.,
Lau, P.,
Harris, J.,
Chen, S. L.,
Hamamori, Y.,
Sartorelli, V.,
and Muscat, G. E.
(1999)
Mol. Endocrinol.
13,
1155-1168
|
| 61.
|
Yutzey, K. E.,
Rhodes, S. J.,
and Konieczny, S. F.
(1990)
Mol. Cell. Biol.
10,
3934-3944
|
| 62.
|
Chakraborty, T.,
Brennan, T.,
and Olson, E.
(1991)
J. Biol. Chem.
266,
2878-2882
|
| 63.
|
Fujisawa-Sehara, A.,
Nabeshima, Y.,
Komiya, T.,
Uetsuki, T.,
Asakura, A.,
and Nabeshima, Y.
(1992)
J. Biol. Chem.
267,
10031-10038
|
| 64.
|
Berberich, C.,
Durr, I.,
Koenen, M.,
and Witzemann, V.
(1993)
Eur. J. Biochem.
216,
395-404
|
| 65.
|
Ridgeway, A. G.,
Wilton, S.,
and Skerjanc, I. S.
(2000)
J. Biol. Chem.
275,
41-46
|
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
V. R. Sobrado, G. Moreno-Bueno, E. Cubillo, L. J. Holt, M. A. Nieto, F. Portillo, and A. Cano
The class I bHLH factors E2-2A and E2-2B regulate EMT
J. Cell Sci.,
April 1, 2009;
122(7):
1014 - 1024.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. B. Laursen, E. Mielke, P. Iannaccone, and E.-M. Fuchtbauer
Mechanism of Transcriptional Activation by the Proto-oncogene Twist1
J. Biol. Chem.,
November 30, 2007;
282(48):
34623 - 34633.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. G. Ridgeway, H. Petropoulos, S. Wilton, and I. S. Skerjanc
Wnt Signaling Regulates the Function of MyoD and Myogenin
J. Biol. Chem.,
October 13, 2000;
275(42):
32398 - 32405.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|