JBC Oz Biosciences

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M004251200 on May 31, 2000

J. Biol. Chem., Vol. 275, Issue 33, 25095-25101, August 18, 2000
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/33/25095    most recent
M004251200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Petropoulos, H.
Right arrow Articles by Skerjanc, I. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petropoulos, H.
Right arrow Articles by Skerjanc, I. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Analysis of the Inhibition of MyoD Activity by ITF-2B and Full-length E12/E47*

Helen PetropoulosDagger and Ilona S. Skerjanc§

From the Department of Biochemistry, University of Western Ontario, London, Ontario N6A 5C1, Canada

Received for publication, May 18, 2000

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

MyoD heterodimerizes with E type factors (E12/E47 and ITF-2A/ITF-2B) and binds E box sequences within promoters of muscle-specific genes. In transient transfection assays, MyoD activates transcription in the presence of ITF-2A but not ITF-2B, which contains a 182-amino acid N-terminal extension. The first 83 amino acids of the inhibitory N terminus of ITF-2B show high sequence homology to the N terminus of full-length E12/E47. Previous studies that showed activation of MyoD by E12 used an artificially N-terminally truncated form. Here we show that the full-length form of E12 inhibits MyoD function. A conserved alpha -helix motif, capable of interacting with the transcriptional machinery, was not essential for inhibition. Furthermore, the fusion of N-terminal ITF-2B sequences or non-inhibiting ITF-2A sequences to truncated E12 was sufficient in converting the activator into an inhibitor. Overexpression of ITF-2B did not inhibit C2C12 myogenesis or affect levels of endogenous muscle gene expression, consistent with the finding that inhibitory E type proteins are present in muscle. Furthermore, we found that MyoD co-transfected with either ITF-2B or ITF-2A converted fibroblasts into myoblasts with the same frequency. Our findings suggest that the ability of E type proteins to inhibit MyoD activity is dependent on the context of the E box.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Skeletal muscle development is known to be dependent on a family of basic helix-loop-helix (bHLH)1 transcription factors, termed the myogenic regulatory factors (MRFs). The family includes MyoD, myf5, myogenin, and myf6/MRF4/herculin (1-7). Ectopic expression of any family member in a wide range of non-muscle cells results in the conversion of these cells to the skeletal muscle lineage (8, 9). The myogenic regulatory factors regulate muscle-specific gene expression by heterodimerizing with the E type family of ubiquitous bHLH transcription factors via the HLH domains and binding the E box consensus sequence (CANNTG) within muscle-specific promoters via the basic domains (10, 11). Homodimers of MyoD are inactive, whereas heterodimers between MyoD and E type proteins can activate E box-containing promoters. Therefore, heterodimerization with the E type transcription factors is necessary for activity of the myogenic regulatory factors.

The E type family of bHLH transcription factors includes E12/E47 (12-14), ITF-2 (15-17), and HEB (18). The E type proteins contain two activation domains, the AD1 domain and the AD2 or LH domain (19, 20). Two alternatively spliced forms of mouse ITF-2, termed ITF-2A and ITF-2B, were shown to differentially regulate MyoD activation. In transient transfection assays, ITF-2B was found to inhibit MyoD activation of the cardiac alpha -actin muscle-specific promoter (21) and the muscle-specific creatine kinase (MCK) promoter (22). Inhibition was shown to occur in both P19 cells and C2C12 cells. The activator, ITF-2A, and the inhibitor, ITF-2B, are co-expressed in several cell types including skeletal muscle cells (21, 22).

The activity of the myogenic regulatory factors is also inhibited by the Id gene family (23). These factors contain an HLH domain but lack a basic domain. They are thought to inhibit the activity of the myogenic factors by forming inactive heterodimers with the E type proteins, thus sequestering them from myogenic factor binding (23, 24). Several studies suggest this is not the primary mechanism by which inhibition by ITF-2B occurs. Inhibition by Id can be reversed by the addition of excess E type activator, whereas inhibition by ITF-2B cannot (21). Furthermore, MyoD/ITF-2B heterodimers bind DNA (22). Together, these results suggest that ITF-2B can form a stable heterodimer with MyoD, which can then bind the E box consensus, but this complex is unable to activate transcription.

Basic helix-loop-helix transcription factors have also been shown to inhibit MyoD activity. Twist inhibits MyoD activity by mechanisms involving the titration and sequestration of the E type proteins, by inhibition of the MyoD co-factor MEF2, and direct inhibition via interaction with the basic domain of MyoD (25-27). MyoR has also been shown to inhibit MyoD activity by mechanisms including competition for DNA-binding sites, active repression through a repressor domain, and titration of the E type proteins (28). More recently, the bHLH protein OUT has been shown to inhibit MyoD activity by E type titration and by preventing E12-MyoD heterodimers from binding DNA (29).

Here we set out to examine the role of the N-terminal domain of ITF-2B in the inhibition of MyoD activity. We found that the full-length E12/E47 proteins contain a domain that is highly similar to the N-terminal inhibitory region of ITF-2B. Like ITF-2B, both full-length E12 and E47 proteins were shown to inhibit transactivation of the exogenous cardiac alpha -actin promoter by MyoD.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmid Constructs-- The cDNAs utilized in these experiments were all driven by the mouse pgk-1 promoter (30). Expression constructs of mouse ITF-2A and ITF-2B, human Delta E12 (partial E12 cDNA), MyoD, CAT, puromycin, and lacZ as well as the cardiac alpha -actin promoter driving the lacZ gene (CA-LacZ) have been previously described (21). The promoter construct contained 440 bp of the human cardiac alpha -actin promoter (31), with one E box that is essential for expression during skeletal myogenesis (32). The human full-length E12 and E47 cDNAs were kindly provided by C. Murre (see Ref. 33). The PGK-vector plasmid contains the pgk-1 (phosphoglycerate kinase) promoter alone.

The mutant ITF-2B plasmid, which corresponds to Mutant 2 (34), was constructed utilizing the Muta-geneTM Phagemid in vitro mutagenesis kit, according to manufacturer's instructions (Bio-Rad). The plasmid used was a 728-bp SalI-SstI fragment of ITF-2B subcloned into pBluescript KS+ (Stratagene Cloning Systems, La Jolla). The mutagenic oligonucleotide used was AAACATCGCACTGCGATCTAGACGATCACTCAGCTCT (altered nucleotides are shown in bold).

The chimeric proteins were constructed by PCR amplification. The N terminus of ITF-2B (initiator methionine underlined) was amplified with the 5' oligonucleotide sequence AAAGGTAACATGCATCACCAACAGCGA and the following 3' oligonucleotide sequences: AAAGGTACCACTGAAGACGGCAAACCC (aa 1-182), AAAGGTACCATTCTGGAATTGACAAAA (aa 1-99), AAAGGTACCACA TTTGAGCCAGTGAAA (aa 1-49), and AAAGGTACCATCGCACTGAAATCCAGT (aa 1-24). The fragment from aa 11-28 was amplified using the following oligonucleotides: AAAGGTACCATGGGGACGGACAAAGAGCTG and AAAGGTACCGGAGGCGAA AACATCGCA. The fragment encompassing aa 25-49 was amplified using the following oligonucleotides: AAAGGTACCATGTTTTCGCCTCCTGTA and AAAGGTACCACATTTGAGCCAGTGAAA. The first 182 aa of ITF-2A were amplified using the following oligonucleotides: AAAGGTACCATGTACTGCGCATACACC and AAAGGTACCGAGGAAAAGCTGTTGTTC. PCR was performed utilizing 10 ng of ITF-2A or ITF-2B cDNA, 0.25 µM of each oligonucleotide, and 2.5 units of Taq polymerase (Life Technologies, Inc.) in 100 µl. Standard PCR conditions were employed with annealing temperatures between 55 and 68 °C. Each fragment was then inserted into a KpnI site (boldface sequences in oligonucleotides) upstream of and in frame with Delta E12.

Cell Culture and Transfections-- P19 embryonal carcinoma cells were cultured as described previously (35). Transfections were carried out by the calcium phosphate method (36). Briefly, 7.5 × 105 cells in 5 ml of medium were exposed to DNA precipitate for 6-9 h in a 60-mm tissue culture dish. The DNA precipitates consisted of 4 µg of CA-LacZ and 1 µg of PGK-CAT in the absence or presence of 2 µg of PGK-MyoD and 5 µg of the various E type containing plasmids. Each transfection was brought up to 12 µg of total DNA with PGK-vector plasmid. Cultures were harvested 24 h after transfection.

beta -Galactosidase and chloramphenicol acetyltransferase (CAT) assays were performed as described previously (37, 38). beta -Galactosidase activities for each culture were normalized for transfection efficiency against CAT activity as well as to the activity of MyoD alone. The background activity of the promoter alone was subtracted from each sample within an experiment.

C2C12 myoblasts were cultured under growth conditions in 15% 1:1 cosmic calf/fetal bovine serum (Cansera, Rexdale, Ontario, Canada, and HyClone, Logan, UT, respectively) in alpha -minimum Eagle's medium. Cell lines that stably expressed ITF-2A, ITF-2B, Delta E12, or PGK vector were created by transfecting 10 µg of PGK-ITF-2A, PGK-ITF-2B, or PGK vector plasmid, 1 µg of PGK-puromycin, and 1 µg of PGK-LacZ by the calcium phosphate method. Myoblasts were plated into 60-mm dishes, selected for puromycin resistance for 1 week, and then transferred into differentiation media (2% horse serum) for 4 days.

Transient transfections of C2C12 myoblasts were carried out utilizing FuGENETM 6 transfection reagent as per the manufacturer's instructions (Roche Molecular Biochemicals). Briefly, 11 µg of PGK-ITF-2B or PGK-vector and 1 µg of pEGFP-N1 (CLONTECH Laboratories, Inc., Palo Alto, CA) and FuGENETM 6 reagent mixtures were added to C2C12 cells in 100-mm dishes. GFP fluorescence was utilized to assess transfection efficiency. Myoblasts were transferred from growth media to differentiation media 24 h later.

Whole Mount in Situ Hybridization of Micromass Cultures-- For in situ hybridization, C2C12 stable cell lines were differentiated as above and fixed with 4% paraformaldehyde overnight at 4 °C. The cells were rehydrated, and in situ hybridizations were carried out as described previously (39). A total of about 80 colonies was present on each plate, and the extent of myogenesis was calculated by counting colonies containing multinucleated myotubes that expressed the transfected gene product. This experiment was repeated twice with similar results.

Digoxigenin-labeled riboprobes were transcribed from single-stranded DNA templates according to the manufacturer's instructions (Roche Molecular Biochemicals) and quantitated as described previously using an anti-Digoxigenin antibody conjugated to alkaline phosphatase (39). A 165-bp SstI-AccI fragment, which contained 5'-untranslated and coding regions of ITF-2A, was utilized to create the ITF-2A-specific probe. The ITF-2B-specific probe consisted of a PCR fragment containing the N-terminal 99 amino acids of ITF-2B. The Delta E12-specific probe consisted of a 429-bp SstI-XhoI fragment within the coding region of Delta E12. Images were captured using Sony DXC-9503 3CCD color video camera and analyzed using Northern Eclipse image analysis software (Empix Imaging, Inc.).

Western Blot Analysis-- Myoblast cells expressing PGK-ITF-2A, PGK-ITF-2B, and PGK vector were differentiated as above, and myosin was harvested by the Burridge and Bray method (40), omitting the second dialysis step. Protein concentration of the myosin extracts was measured by the Bio-Rad Protein Assay (Bio-Rad). Two micrograms of protein were electrophoresed by 7% SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose overnight at 30 V at 4 °C. Blots were probed with anti-MyHC mouse monoclonal antibody, MF20 (1:1000 dilution) as a control for total myosin (41), and with anti-MyHC IIB antibody BF:F3 (undiluted) against type IIB myosin (42). Anti-mouse Ig, horseradish peroxidase-linked whole antibody (Amersham Pharmacia Biotech) was used at a 1:5000 dilution. The reaction was visualized using the ECL SuperSignal® Substrate (Pierce) for Western blotting and autoradiography. Quantitation was carried out utilizing NIH Image 1.58.

Northern Blot Analysis-- The lithium chloride/urea extraction method was used to isolate total RNA, and 6 µg were examined by Northern blot analysis as described previously (43). The ITF-2B probe used was an SspI-NotI fragment of ITF-2B, which encodes the full-length cDNA. This probe detected transfected ITF-2B and endogenous forms of ITF-2. Other probes utilized were a 600-base pair EcoRI fragment of rat myosin light chain (MLC) 1/3 and a 600-base pair PstI fragment from the last exon of human cardiac alpha -actin. Northern blots were visualized by autoradiography and quantitated by NIH Image 1.58.

Myogenic Conversion of 10T1/2 Fibroblasts-- 10T1/2 fibroblasts were cultured under growth conditions in 10% 1:1 cosmic calf-fetal bovine serum in alpha -minimum Eagle's medium. Cells on gelatin-coated coverslips were transfected in the absence or presence of 1 µg of PGK-MyoD, 2.5 µg of the various E type containing plasmids, and 0.5 µg of pEGFP-N1 (CLONTECH Laboratories, Inc. Palo Alto, CA) utilizing the FuGENETM 6 transfection reagent. Total DNA in each transfection was brought up to 4 µg with PGK vector plasmid. Following 24 h, cells were transferred to differentiation media, containing 2% horse serum, for 6 days. Transfection efficiency for each culture was scored utilizing GFP fluorescence and total number of cells was estimated by counting Hoechst-stained nuclei. To identify myogenic conversion, cells were fixed with methanol at -20 °C and stained for myosin heavy chain (41) as described (43). Immunofluorescence was visualized with a Zeiss Axioskop microscope.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Full-length E12 and E47 Inhibit MyoD Activity-- Previous results have shown that the N-terminal 83 amino acids of ITF-2B were required for ITF-2B to inhibit MyoD activity (21). Consequently, we set out to determine if other E type proteins contained similar N-terminal sequences and possibly similar inhibitory activity. An alignment of the N-terminal 83 amino acids with the N termini of full-length E12 and full-length E47 (33) revealed that this domain is 51% identical among the three E type proteins (Fig. 1). This region has been shown to contain a conserved alpha -helix that functions as a transactivation domain when fused to the Gal4 DNA binding domain (34). The E12 and E47 proteins, termed Delta E12 and Delta E47, utilized in activation studies with MyoD, are fragments of the full-length proteins and contain a synthetic initiator methionine (12). These fragments are missing the first 216 aa compared with full-length E12 and E47 (33). Subsequently, the partial proteins are missing the region that is similar to the N-terminal region of the inhibitor ITF-2B (summarized in Fig. 2A). To our knowledge, the full-length E12 and E47 proteins have not been tested with respect to their effect on MyoD activity.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1.   The N-terminal 83 amino acids of ITF-2B, full-length E12, and full-length E47 are conserved. The N-terminal 83 amino acid domain of the inhibitor, ITF-2B, is 51% identical to the N termini of the full-length E12 and full-length E47 proteins. The conserved amino acids are boxed.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   Full-length E12 and E47 proteins inhibit MyoD activity compared with endogenous E type proteins present in P19 cells. A, comparison of the length and domain structure of E type bHLH proteins and their ability to activate MyoD activity. The conserved N-terminal 83 amino acids are shown as hatched boxes, the bHLH domains are shown as black boxes, and the lengths of the various domains are indicated. B, the ability of MyoD to transactivate the cardiac alpha -actin promoter in the presence of each E type protein was examined. P19 cells were transfected with 4 µg of the reporter construct CA-LacZ and 1 µg of the standardization reporter PGK-CAT, as well as 5 µg of the various E type expression constructs and 2 µg of MyoD. Error bars represent S.E. with n = 4 or 5.

In order to determine if the presence of the conserved N-terminal region (represented in Fig. 1) modified the activity of E12 and E47, we examined the effect of full-length E12 and E47 proteins on MyoD. This involved determining the ability of MyoD to transactivate the cardiac alpha -actin promoter in the presence of each E type protein after transient transfection into P19 cells. In agreement with previously published results, MyoD alone transactivated the cardiac alpha -actin promoter indicating the presence of endogenous activating E type proteins in P19 cells (21) (Fig. 2B). Furthermore, MyoD was active in the presence of Delta E12 and ITF-2A but not in the presence of ITF-2B. In the presence of full-length E12 and full-length E47, MyoD activity was decreased 3- and 5-fold, respectively, in multiple repetitive assays. Therefore, full-length E12 and E47 proteins inhibited MyoD activity as effectively as ITF-2B.

Mutation of the Conserved alpha -Helix Does Not Affect Inhibition-- A conserved alpha -helix has been identified from aa 11-28 of E12, E47, and ITF-2B that function as transcriptional activators when fused to the Gal4 DNA binding domain (34). Since this region lies within the inhibitory domain of ITF-2B and can interact with components of the transcriptional machinery, we set out to determine if these sequences were required for inhibition. A mutant was generated in which two conserved, non-polar residues were replaced with arginine (Fig. 3A). These changes were shown previously to disrupt the transactivation domain (34). Here we show that this mutant still functions as an inhibitor, decreasing MyoD activity 4-fold compared with MyoD alone (Fig. 3B).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3.   Mutation of amino acids within the conserved alpha -helix, which are crucial for activation by the ADI domain, does not affect inhibition. A, two amino acids within the conserved alpha -helix, which have been shown to be important for transactivation by the ADI domain, were substituted by site-directed mutagenesis. B, to test the effect of the mutation on the ability of ITF-2B to inhibit MyoD activity, 1.5 µg of the mutated ITF-2B, wild-type ITF-2B, or Delta E12 were co-transfected with 4 µg of CA-LacZ, 1.5 µg of PGK-MyoD, and 1 µg of PGK-CAT. Error bars represent S.E. from seven different experiments.

Lengthening the N Terminus of Delta E12 Converts the Activator into an Inhibitor-- In order to identify the amino acids of ITF-2B that are sufficient for inhibition, various portions of the N-terminal domain of ITF-2B were fused onto the N terminus of the activating Delta E12 protein (Fig. 4A). To ensure the inhibition was specific to the inhibitory region of ITF-2B, the N-terminal 182-amino acids of the activator, ITF-2A, were also fused to the N terminus of Delta E12. In transient co-transfection experiments, we observed that the addition of various fragments of the ITF-2B N-terminal sequences as well as the N terminus of ITF-2A were all sufficient in converting Delta E12 into an inhibitor of MyoD activity (Fig. 4B). The fusion proteins inhibited MyoD activity between 2- and 5-fold. This range of inhibition may be due to small variations in conformation or expression levels between the different fusion proteins. This conversion did not appear to be sequence-dependent since both non-inhibitory sequences from ITF-2A and inhibitory sequences from ITF-2B were capable of converting Delta E12 into an inhibitor. Consequently, as few as 18 amino acids are sufficient to convert Delta E12 from an activator into an inhibitor, in a sequence-independent manner.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   The N-terminal 182 amino acids of ITF-2A and various sizes of the ITF-2B N terminus are sufficient to transform Delta E12 from an activator to an inhibitor of MyoD. A, the N-terminal 182 amino acids of ITF-2A and ITF-2B, as well as varying lengths of the ITF-2B N terminus, were fused in frame to the N terminus of Delta E12. The fused domains and the bHLH domain of each chimeric protein are represented by the hatched and black boxes, respectively, and MyoD activity with each is summarized. B, to test the effect of each chimeric protein on the activity of MyoD, 5 µg of each was co-transfected with 4 µg of CA-LacZ, 2 µg of PGK-MyoD, and 1 µg of PGK-CAT. The activity of MyoD in the presence of each chimeric protein was compared with that in the presence of Delta E12 as shown (* indicates values are significantly different from Delta E12 by Student's t test). Error bars represent S.E. between 4 and 14 different experiments.

Overexpression of ITF-2B Has No Effect on Myogenesis or Fiber Type Generation-- To study the physiological relevance of ITF-2B inhibition of MyoD activity, ITF-2B was stably and transiently overexpressed in C2C12 myoblasts. Cells stably expressing ITF-2B, ITF-2A, or Delta E12 were differentiated to determine if overexpression of ITF-2B was sufficient to inhibit the process of myogenesis (Fig. 5). The differentiation of C2C12 myoblasts was monitored by counting colonies that contained multinucleated myotubes, and overexpression of the E type proteins was determined by in situ hybridization. Myotubes were found to express high levels of ITF-2B (Fig. 5A), compared with endogenous staining (Fig. 5B). The total number of colonies containing myotubes and expressing ITF-2A, Delta E12, or beta -galactosidase (average of 24 colonies) was not substantially different from the number of colonies containing myotubes and expressing the inhibitor ITF-2B (22 colonies). C2C12 cell lines stably expressing ITF-2A and ITF-2B to levels equivalent to endogenous levels of ITF-2 transcripts were found to express similar amounts of cardiac alpha -actin and differentiate as efficiently as control cell lines (data not shown). Therefore, C2C12 cells stably overexpressing ITF-2B were found to differentiate with equal efficiency as cells stably overexpressing ITF-2A, Delta E12, or control transfected cells.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 5.   The stable expression of ITF-2B does not inhibit the differentiation of C2C12 myoblasts. Myoblasts were transfected with ITF-2B, selected for stable expression, and differentiated in media containing 2% horse serum. In situ hybridization was used to identify differentiated colonies overexpressing ITF-2B (A) compared with colonies expressing endogenous ITF-2B levels (B). The bar represents 0.2 mm.

The differences we observed in the ability of ITF-2B to inhibit MyoD activity may be due to the examination of exogenous versus endogenous promoters or to the transient versus stable expression levels of factors. To distinguish these two possibilities, C2C12 myoblasts were transiently transfected with ITF-2B, differentiated into muscle, and examined by Northern blot analysis (Fig. 6). We found that levels of exogenous ITF-2B are high early during differentiation of transiently transfected cells (data not shown). ITF-2B expression remained at an average of 3-fold over the level of endogenous forms of ITF-2 (Fig. 6A, compare lanes 1 and 2 to 3 and 4) on day 4 of differentiation. Expression levels were normalized against 18 S. The level of expression of cardiac alpha -actin and MLC 1/3 was not altered in cultures expressing ITF-2B compared with control cells. Therefore, the transient overexpression of ITF-2B was not sufficient to inhibit myogenesis or to affect MRF activity on the endogenous cardiac alpha -actin promoter.


View larger version (53K):
[in this window]
[in a new window]
 
Fig. 6.   Transient overexpression of ITF-2B does not affect the expression of endogenous cardiac alpha -actin in differentiated C2C12 myoblasts. C2C12 cells were transfected with ITF-2B and transferred to differentiation media the next day. Total RNA from differentiated cultures was harvested 4 days later. Northern blots containing 6 µg of RNA were probed with ITF-2B, MLC1/3, cardiac alpha -actin and 18 S as indicated.

To examine further the activity of transiently transfected ITF-2B on endogenous muscle-gene promoters, we tested the ability of MyoD to convert fibroblasts to myoblasts in the presence of various E type proteins (Fig. 7). We found that MyoD could convert 10T1/2 fibroblasts to the myogenic lineage with similar efficiency when co-transfected with ITF-2A or ITF-2B. Similarly, full-length E12 could convert cells as efficiently as Delta E12 in the presence of MyoD. Therefore, expression of the inhibitory forms of the E type proteins was not sufficient to inhibit myogenic conversion by MyoD.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 7.   ITF-2A and ITF-2B convert fibroblasts to myoblasts with the same efficiency when co-transfected with MyoD. 10T1/2 fibroblasts were transfected with 1 µg of PGK-MyoD, 2.5 µg of the various E type genes, and 0.5 µg of GFP. Number of cells expressing MyHC following 6 days in differentiation media was determined by immunofluorescence. The percentage of MyHC-positive cells was normalized against transfection efficiency, and MyoD conversion was set to 100. Error bars represent S.E. between three different experiments.

In addition, we tested the possibility that E type factors may play a role in the ability of the MRFs to generate different fiber types by activating the endogenous expression of different MyHC isoforms. Myoblasts expressing ITF-2A or ITF-2B were differentiated to determine if overexpression of either form affects MyHC IIB protein expression when compared with control transfected cells. We observed no difference in the amount of MyHC IIB protein present in ITF-2A- or ITF-2B-expressing cells compared with control myoblast cells by Western blot analysis (data not shown).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have shown that full-length E12/E47 contains an N-terminal domain homologous to the N-terminal inhibitory domain of ITF-2B. In transient transfection assays, full-length E12/E47 inhibits MyoD function. Therefore, similar to ITF-2, E12/E47 can either activate or inhibit MyoD activity depending on which domains of E12/E47 are present in the MyoD/E12/E47 heterodimer. The inhibitory activity of ITF-2B did not require a conserved alpha -helix, shown to be necessary for transactivation by Gal4-E2-2 fusion proteins (34). This indicates that the inhibitory activity within the N-terminal region is separable from the activating function seen by others (34). Consequently, the ability of ITF-2B to inhibit MyoD does not require interactions specifically between the alpha -helical domain and the transcriptional apparatus. Finally, the overexpression of ITF-2B in C2C12 myoblasts or MyoD-transfected fibroblasts did not result in the inhibition of myogenesis. Therefore, whereas the presence of the inhibitory domain inhibits MyoD transactivation of exogenous promoters, it does not inhibit MyoD transactivation of endogenous muscle promoters.

The fusion of activating sequences from ITF-2A or inhibitory sequences from ITF-2B onto the N terminus of Delta E12 converted Delta E12 from an activator into an inhibitor. Since the inhibition was sequence-independent, it is possible that the fusion of ectopic sequences may change the conformation of the N terminus of E12, transforming it from an activator into an inhibitor. This conformational change may simulate the mechanism by which ITF-2B inhibits MyoD activity via its N-terminal domain. Alternatively, the creation of a fusion protein with Delta E12 may prevent the MyoD/Delta E12 fusion heterodimers from binding DNA.

Since ITF-2B forms stable heterodimers with MyoD that are capable of binding DNA (21, 22), one hypothesis is that the conformation adopted by the N-terminal extension of ITF-2B may sterically hinder a domain of MyoD which is necessary for transactivation. Alternatively, ITF-2B may hinder the binding of the E type/MRF heterodimer to transcription factors bound to other elements within muscle-specific promoters (22). It is possible that other sites are required for inhibition since ITF-2B has been shown to inhibit the activity of muscle promoters including cardiac alpha -actin (21) and MCK but not the activation of an artificial promoter containing E boxes (22).

Overexpression of ITF-2B did not result in the inhibition of myogenesis in C2C12 cells and did not modulate the expression of myosin heavy chain (type IIB), myosin light chain 1/3, or cardiac alpha -actin. Furthermore, when compared with the activators, ITF-2A and Delta E12, ITF-2B and full-length E12 did not inhibit the ability of MyoD to convert fibroblasts to the myogenic lineage. These findings suggest that ITF-2B expression is not sufficient to inhibit MyoD activation of endogenous muscle-specific promoters. Therefore, ITF-2B is unlikely to play a role in inhibiting myogenesis in vivo, consistent with the presence of the inhibitor ITF-2B in skeletal myocytes and adult skeletal muscle (21, 22). In contrast, Twist and MyoR, which are not expressed in skeletal muscle cells and do inhibit differentiation when overexpressed in myoblasts, are more likely physiological bHLH inhibitors of myogenesis (28, 44, 45).

The differential inhibition of MyoD by ITF-2B is similar to the finding that Id will inhibit MRF transactivation of exogenous promoters but will not block myogenesis in C2C12 cells 2 days after the onset of differentiation (24). Furthermore, mice null for Id1, Id2, Id3, or Id1/Id3 (46-48) and E2A, HEB, or E2-2 gene products do not show a muscle phenotype (49, 50). The analysis of these knock-out mice is complicated by functional redundancy, demonstrated by the ability of HEB to replace E2A in supporting B-lymphocyte development (51).

Many studies have shown that the function and requirement for specific DNA elements differ in transient transfection studies compared with transgenic mouse models (52, 53). Furthermore, transient transfection studies have shown that the activity of cardiac alpha -actin and MCK varies with the size of the promoter fragment used (54, 55). These studies suggest that the regulation of an endogenous promoter is dependent on a complex set of factors and promoter elements. Active MyoD-ITF-2B heterodimers may require association with factors bound to sites within endogenous promoters, which are not present in the exogenous promoters tested. Alternatively, other factors bound to the endogenous promoter may abrogate the inhibition of MyoD activity by ITF-2B. Finally, the inhibition seen on an exogenous promoter may be negligible compared with the full activity of an endogenous promoter.

Other differences in the regulation of exogenous versus endogenous promoters may be due to differences in their chromatin structure (56). Co-activators such as p300/CBP and p300/CBP associated factor (57-59) and the corepressor N-CoR (60) are known to play a critical role in regulating MyoD activity. The activity of such factors may abrogate the inhibitory function of ITF-2B on an endogenous promoter, whereas chromatin remodeling may not be involved in the activation of an exogenous promoter.

It is possible that the residual activity of MyoD presence of ITF-2B and E12 is sufficient to induce myogenesis. Alternatively, the presence of endogenous activating E type proteins could have a compensating effect on the activity of myogenic regulatory factors in C2C12 and 10T1/2 cells, resulting in the lack of inhibition of myogenesis observed. Furthermore, the activity of the E type proteins may be limited by post-translational regulation or by degradation. It is possible that the inhibitory activity is acting in a subtle manner to regulate MRF function. For example, overexpression of ITF-2B may decrease levels of muscle genes we have not tested. Several studies indicate that the myogenic regulatory factors have specific target gene specificities (61-65). The ability of the E type dimerization partners to differentially regulate the activity of the myogenic regulatory factors may be one mechanism regulating the fine-tuning of muscle-specific gene expression. A more detailed examination of mice null for the various E type factors may reveal a more complex role.

In summary, we have shown that E type proteins containing a conserved N-terminal domain, such as E12/E47 and ITF-2B, have the ability to inhibit MyoD activity in transient transfection assays. In contrast, these inhibitors had no effect on myogenesis or myogenic conversion of fibroblasts. Therefore, the N-terminal region of E type proteins seems critical for regulating MyoD activity on exogenous but not endogenous promoters. The presence of E type inhibitory proteins does not appear to play a physiological role in the on/off regulation of myogenesis.

    ACKNOWLEDGEMENTS

We thank Judy Ball and Daniel MacPhee for critically reading the manuscript; Al Ridgeway, Sharon Wilton, David Litchfield, and Chris Brandl for helpful discussions; and C. Murre for providing full-length E12 and full-length E47 cDNA. We also gratefully acknowledge the technical assistance of Joe Martens and Andrea Weston.

    FOOTNOTES

* This work was supported in part by a grant from the Medical Research Council of Canada.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported by a studentship from the Natural Sciences and Engineering Research Council of Canada.

§ Supported by a Medical Research Council of Canada Scholarship (Development Grant). To whom correspondence and request for materials should be addressed: Dept. of Biochemistry, Medical Sciences Bldg., University of Western Ontario, London, Ontario N6A 5C1, Canada. Tel.: 519-679-2111 (ext. 86867); Fax: 519-661-3175; E-mail: skerjanc@julian.uwo.ca.

Published, JBC Papers in Press, May 31, 2000, DOI 10.1074/jbc.M004251200

    ABBREVIATIONS

The abbreviations used are: bHLH, basic helix-loop-helix; MRFs, myogenic regulatory factors; MCK, muscle-specific creatine kinase; bp, base pair; PCR, polymerase chain reaction; CAT, chloramphenicol acetyltransferase; aa, amino acids; MLC, myosin light chain; MyHC, myosin heavy chain; PGK, phosphoglycerate kinase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Davis, R. L., Weintraub, H., and Lassar, A. B. (1987) Cell 51, 987-1000
2. Braun, T., Buschhausen-Denker, G., Bober, E., Tannich, E., and Arnold, H. H. (1989) EMBO J. 8, 701-709
3. Edmondson, D. G., and Olson, E. N. (1989) Genes Dev. 3, 628-640
4. Rhodes, S. J., and Konieczny, S. F. (1989) Genes Dev. 3, 2050-2061
5. Wright, W. E., Sassoon, D. A., and Lin, V. K. (1989) Cell 56, 607-617
6. Braun, T., Bober, E., Winter, B., Rosenthal, N., and Arnold, H. H. (1990) EMBO J. 9, 821-831
7. Miner, J. H., and Wold, B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 1089-1093
8. Filvaroff, E. H., and Derynck, R. (1996) Dev. Biol. 178, 459-471
9. Weintraub, H., Tapscott, S. J., Davis, R. L., Thayer, M. J., Adam, M. A., Lassar, A. B., and Miller, A. D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5434-5438
10. Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D., and Weintraub, H. (1989) Cell 58, 823-831
11. Lassar, A. B., Davis, R. L., Wright, W. E., Kadesch, T., Murre, C., Voronova, A., Baltimore, D., and Weintraub, H. (1991) Cell 66, 305-315
12. Murre, C., McCaw, P. S., and Baltimore, D. (1989) Cell 56, 777-783
13. Henthorn, P., McCarrick-Walmsley, R., and Kadesch, T. (1990) Nucleic Acids Res. 18, 677
14. Nourse, J., Mellentin, J. D., Galili, N., Wilkinson, J., Stanbridge, E., Smith, S. D., and Cleary, M. L. (1990) Cell 60, 535-545
15. Henthorn, P., Kiledjian, M., and Kadesch, T. (1990) Science 247, 467-470
16. Corneliussen, B., Thornell, A., Hallberg, B., and Grundstrom, T. (1991) J. Virol. 65, 6084-6093
17. Javaux, F., Donda, A., Vassart, G., and Christophe, D. (1991) Nucleic Acids Res. 19, 1121-1127
18. Hu, J. S., Olson, E. N., and Kingston, R. E. (1992) Mol. Cell. Biol. 12, 1031-1042
19. Quong, M. W., Massari, M. E., Zwart, R., and Murre, C. (1993) Mol. Cell. Biol. 13, 792-800
20. Aronheim, A., Shiran, R., Rosen, A., and Walker, M. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8063-8067
21. Skerjanc, I. S., Truong, J., Filion, P., and McBurney, M. W. (1996) J. Biol. Chem. 271, 3555-3561
22. Chen, B., and Lim, R. W. (1997) J. Biol. Chem. 272, 2459-2463
23. Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L., and Weintraub, H. (1990) Cell 61, 49-59
24. Jen, Y., Weintraub, H., and Benezra, R. (1992) Genes Dev. 6, 1466-1479
25. Spicer, D. B., Rhee, J., Cheung, W. L., and Lassar, A. B. (1996) Science 272, 1476-1480
26. Hamamori, Y., Wu, H. Y., Sartorelli, V., and Kedes, L. (1997) Mol. Cell. Biol. 17, 6563-6573
27. Hebrok, M., Fuchtbauer, A., and Fuchtbauer, E. M. (1997) Exp. Cell Res. 232, 295-303
28. Lu, J., Webb, R., Richardson, J. A., and Olson, E. N. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 552-527
29. Narumi, O., Mori, S., Boku, S., Tsuji, Y., Hashimoto, N., Nishikawa, S., and Yokota, Y. (2000) J. Biol. Chem. 275, 3510-3521
30. Adra, C. N., Boer, P. H., and McBurney, M. W. (1987) Gene (Amst.) 60, 65-74
31. Pari, G., Jardine, K., and McBurney, M. W. (1991) Mol. Cell. Biol. 11, 4796-4803
32. Skerjanc, I. S., and McBurney, M. W. (1994) Dev. Biol. 163, 125-132
33. Kamps, M. P., Murre, C., Sun, X. H., and Baltimore, D. (1990) Cell 60, 547-555
34. Massari, M. E., Jennings, P. A., and Murre, C. (1996) Mol. Cell. Biol. 16, 121-129
35. Rudnicki, M. A., and McBurney, M. W. (1987) in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach (Robertson, E. J., ed) , pp. 19-49, IRL Press at Oxford University Press, Oxford
36. Chen, C., and Okayama, H. (1987) Mol. Cell. Biol. 7, 2745-2752
37. Norton, P. A., and Coffin, J. M. (1985) Mol. Cell. Biol. 5, 281-290
38. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) in Molecular Cloning: A Laboratory Manual (Nolan, C., ed), 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
39. Cash, D. E., Bock, C. B., Schughart, K., Linney, E., and Underhill, T. M. (1997) J. Cell Biol. 136, 445-457
40. Burridge, K., and Bray, D. (1975) J. Mol. Biol. 99, 1-14
41. Bader, D., Masaki, T., and Fischman, D. A. (1982) J. Cell Biol. 95, 763-770
42. DeNardi, C., Ausoni, S., Moretti, P., Gorza, L., Velleca, M., Buckingham, M., and Schiaffino, S. (1993) J. Cell Biol. 123, 823-835
43. Skerjanc, I. S., Slack, R. S., and McBurney, M. W. (1994) Mol. Cell. Biol. 1464, 8451-8459
44. Lemercier, C., To, R. Q., Carrasco, R. A., and Konieczny, S. F. (1998) EMBO J. 17, 1412-1422
45. Hebrok, M., Wertz, K., and Fuchtbauer, E. M. (1994) Dev. Biol. 165, 537-544
46. Lyden, D., Young, A. Z., Zagzag, D., Yan, W., Gerald, W., O'Reilly, R., Bader, B. L., Hynes, R. O., Zhuang, Y., Manova, K., and Benezra, R. (1999) Nature 401, 670-677
47. Rivera, R. R., Johns, C. P., Quan, J., Johnson, R. S., and Murre, C. (2000) Immunity 12, 17-26
48. Yokota, Y., Mansouri, A., Mori, S., Sugawara, S., Adachi, S., Nishikawa, S., and Gruss, P. (1999) Nature 397, 702-706
49. Bain, G., Maandag, E. C., Izon, D. J., Amsen, D., Kruisbeek, A. M., Weintraub, B. C., Krop, I., Schlissel, M. S., Feeney, A. J., and van Roon, M. (1994) Cell 79, 885-892
50. Zhuang, Y., Cheng, P., and Weintraub, H. (1996) Mol. Cell. Biol. 16, 2898-2905
51. Zhuang, Y., Barndt, R. J., Pan, L., Kelley, R., and Dai, M. (1998) Mol. Cell. Biol. 18, 3340-3349
52. Donoviel, D. B., Shield, M. A., Buskin, J. N., Haugen, H. S., Clegg, C. H., and Hauschka, S. D. (1996) Mol. Cell. Biol. 16, 1649-1658
53. Shield, M. A., Haugen, H. S., Clegg, C. H., and Hauschka, S. D. (1996) Mol. Cell. Biol. 16, 5058-5068
54. French, B. A., Chow, K. L., Olson, E. N., and Schwartz, R. J. (1991) Mol. Cell. Biol. 11, 2439-2450
55. Amacher, S. L., Buskin, J. N., and Hauschka, S. D. (1993) Mol. Cell. Biol. 13, 2753-2764
56. Archer, T. K., Lefebvre, P., Wolford, R. G., and Hager, G. L. (1992) Science 255, 1573-1576
57. Sartorelli, V., Huang, J., Hamamori, Y., and Kedes, L. (1997) Mol. Cell. Biol. 17, 1010-1026
58. Puri, P. L., Sartorelli, V., Yang, X. J., Hamamori, Y., Ogryzko, V. V., Howard, B. H., Kedes, L., Wang, J. Y., Graessmann, A., Nakatani, Y., and Levrero, M. (1997) Mol. Cell 1, 35-45
59. Eckner, R., Yao, T. P., Oldread, E., and Livingston, D. M. (1996) Genes Dev. 10, 2478-2490
60. Bailey, P., Downes, M., Lau, P., Harris, J., Chen, S. L., Hamamori, Y., Sartorelli, V., and Muscat, G. E. (1999) Mol. Endocrinol. 13, 1155-1168
61. Yutzey, K. E., Rhodes, S. J., and Konieczny, S. F. (1990) Mol. Cell. Biol. 10, 3934-3944
62. Chakraborty, T., Brennan, T., and Olson, E. (1991) J. Biol. Chem. 266, 2878-2882
63. Fujisawa-Sehara, A., Nabeshima, Y., Komiya, T., Uetsuki, T., Asakura, A., and Nabeshima, Y. (1992) J. Biol. Chem. 267, 10031-10038
64. Berberich, C., Durr, I., Koenen, M., and Witzemann, V. (1993) Eur. J. Biochem. 216, 395-404
65. Ridgeway, A. G., Wilton, S., and Skerjanc, I. S. (2000) J. Biol. Chem. 275, 41-46


Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. B. Laursen, E. Mielke, P. Iannaccone, and E.-M. Fuchtbauer
Mechanism of Transcriptional Activation by the Proto-oncogene Twist1
J. Biol. Chem., November 30, 2007; 282(48): 34623 - 34633.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. G. Ridgeway, H. Petropoulos, S. Wilton, and I. S. Skerjanc
Wnt Signaling Regulates the Function of MyoD and Myogenin
J. Biol. Chem., October 13, 2000; 275(42): 32398 - 32405.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
275/33/25095    most recent
M004251200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Petropoulos, H.
Right arrow Articles by Skerjanc, I. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petropoulos, H.
Right arrow Articles by Skerjanc, I. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2000 by the American Society for Biochemistry and Molecular Biology.