| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 275, Issue 33, 25155-25162, August 18, 2000
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, January 18, 2000, and in revised form, May 15, 2000
Guanylyl cyclase activating peptide II (GCAP-II),
an endogenous ligand of guanylyl cyclase C, is produced via the
processing of the precursor protein (prepro-GCAP-II). We have
previously shown that the propeptide in pro-GCAP-II functions as an
intramolecular chaperone in the proper folding of the mature peptide,
GCAP-II (Hidaka, Y., Ohno, M., Hemmasi, B., Hill, O., Forssmann, W.-G., and Shimonishi, Y. (1998) Biochemistry 37, 8498-8507).
Here, we report an essential region in pro-GCAP-II for the correct
disulfide pairing of the mature peptide, GCAP-II. Five mutant proteins, in which amino acid residues were sequentially deleted from the N
terminus, and three mutant proteins of pro-GCAP-II, in which N-terminal
6, 11, or 17 amino acid residues were deleted, were overproduced using
Escherichia coli or human kidney 293T cells, respectively. Detailed analysis of in vivo or in
vitro folding of these mutant proteins revealed that one or two
amino acid residues at the N terminus of pro-GCAP-II are critical, not
only for the chaperone function in the folding but also for the net
stabilization of pro-GCAP-II. In addition, size exclusion
chromatography revealed that pro-GCAP-II exists as a dimer in solution.
These data indicate that the propeptide has two roles in proper
folding: the disulfide-coupled folding of the mature region and the
dimerization of pro-GCAP-II.
Endogenous peptide hormones are often synthesized in
vivo in the form of precursor proteins with pre- (or signal) and
prepro-leader sequences, which are subsequently processed into
biologically active mature peptides after their release from the
ribosome (1). Little is known, however, concerning the role of the
propeptide in the pro-leader sequence in the processing of precursor
proteins to the mature peptide hormones or their function in the
folding process, which results in the mature hormones. Guanylin and
uroguanylin (2-4), endogenous ligands of particulate guanylyl cyclase
C (GC-C)1 (5), are thought to
function in regulating the level of cGMP as a second messenger in
intestinal and kidney cells, i.e. the regulation of chloride
and water secretion from the inside of these cells to the outside (6,
7). Guanylin and uroguanylin are generated as precursor proteins
(preproguanylin (prepro-GCAP-I) or preprouroguanylin (prepro-GCAP-II),
respectively), which contain the prepro-leader sequences which precede
the mature portion. After cleavage of the pre-sequence, pro-GCAP-I
and/or pro-GCAP-II are further processed to give the mature peptides,
guanylin or uroguanylin (Fig. 1). GCAP-II, a plasma form of
uroguanylin, is one of the mature forms of pro-GCAP-II in
vivo (4, 8, 12, 14-16). Recent studies in this laboratory have
shown that spontaneous refolding to the native conformation is attained
in pro-GCAP-II but not in GCAP-II (17), i.e. GCAP-II
requires the propeptide, in order to efficiently fold into the
bioactive form.
There are a few examples, such as subtilisin, In a recent study, it was demonstrated that guanylin, which is
homologous to GCAP-II, requires the assistance of the propeptide of the
precursor protein, pro-GCAP-I, not only to achieve correct folding but
also for the formation of the native disulfide linkages (23). These
findings, and our previous studies, led us to conclude that the
propeptide in the pro-leader sequence of pro-GCAP-I and pro-GCAP-II
plays a functional role as an intramolecular chaperone in the correct
folding of the mature peptide and is also crucial for the
disulfide-coupled folding of the reduced precursor (17, 23).
Furthermore, these studies have led us to propose that the mature form
of pro-GCAP-II, GCAP-II, is not at the thermodynamic ground state but,
rather, is kinetically trapped in the precursor protein (17).
Consequently, these studies raised questions as to which region(s) of
the protein, or the manner in which the pro-leader sequence of
pro-GCAP-II, contributes to the correct folding of the mature peptide.
In this report, we provide evidence that the amino acid residues at the
N terminus of the pro-leader sequence are heavily involved in the
correct assembly of the three dimensional structure of pro-GCAP-II and,
in turn, of GCAP-II. These residues function to stabilize the bioactive
form of the mature portion during the folding of the entire protein.
Moreover, we provide evidence that supports the existence of a
homodimer, which is stabilized by intermolecular and non-covalent
interactions between the region in the pro-leader sequence and,
possibly, in the intermediate as well as the final steps of the folding
process. The data obtained provide basic information, which is critical
for our understanding of the role of the pro-leader sequence of the
precursor proteins during the maturation of peptide hormones, such as
GCAP-II and guanylin.
Materials--
Restriction enzymes were purchased from Toyobo
(Osaka, Japan) and New England Biolabs (Beverly, MA). Taq
polymerase, T4 DNA ligase, and endoproteinase Arg-C were obtained from
Takara Shuzo Co. (Kyoto, Japan). Dulbecco's modified Eagle's medium
(DMEM) and fetal bovine serum (FBS) were purchased from Nissui
Pharmaceutical, Co. (Tokyo, Japan) and Dainippon Pharmaceutical, Co.
(Osaka, Japan), respectively. Thr-Ile-Ala-uroguanylin and its disulfide
isomers were synthesized according to a previously described procedure (17). All other chemicals and solvents were reagent grade. PCR was
carried out using a Sanyo DNA amplifier MIR-D30 (Osaka, Japan).
Construction of Expression Vectors of the Deletion Mutants for
and Their Expression by E. coli Cells--
The cDNAs encoding the
deletion mutant proteins were subcloned into a pET17b expression vector
(Novagen), following the introduction, by means of PCR, of an
NdeI site at its 5' end and a XhoI site at its 3'
end using pEX2 as a template. The cDNA sequences of the vectors
were confirmed as described above. E. coli BL21(DE3) cells,
which were transformed with the expression vector, was cultured at
37 °C in Luria broth medium supplemented with ampicillin (50 mg/liter). The production of the mutant proteins was induced by the
addition of 1 mM isopropyl-1-thio- Construction of Expression Vectors of Deletion Mutants for Human
Embryonic Kidney 293T Cells--
The pEX2 vector derived from the
pcDNA3 vector (Invitrogen), which contains a strong cytomegalovirus
enhancer-promoter sequence for a high level of protein expression in
mammalian cells (17), was used in this experiment. The construction of
the expression vectors of the N-terminal deletion mutants of
pro-GCAP-II was carried out as follows. The pEX2 vector, which carries
a cDNA encoding pre-pro-GCAP-II between a BamHI site at
its 5' end and a XbaI site at its 3' end (8), was employed
as a template for the construction of the expression vectors in
carrying the cDNAs of the N-terminal deletion mutant proteins of
pro-GCAP-II. To efficiently use the signal sequence (the pre-region of
pre-pro-GCAP-II) for the expression of the mutant proteins, the
cDNA fragment from a BamHI site to the end of the signal
sequence was amplified by PCR using the pEX2 vector as a template and a
sense (ATATAGGATCCAGGGAGCGCGATG) as primer 1 and an antisense
(TCTCTCTAGAGAATTCCTCGAGTGACTGTGTGCTCTG) as primer 2. The cDNA
fragment encoding the signal sequence was inserted between the
BamHI and XbaI sites of pEX2, resulting in the
construction of pcDNA3H, which contains a unique XhoI
site after the signal sequence between the BamHI site and
the XbaI site. The cDNAs encoding the deletion mutant
proteins were prepared by PCR and subcloned into the site between the
XhoI site and the XbaI site in pcDNA3H. The
resulting expression vectors comprised the cDNA sequences, which
encode the signal peptide of pre-pro-GCAP-II and each of the deletion
mutant proteins, pro-GCAP-II-(7-86), pro-GCAP-II-(12-86), and
pro-GCAP-II-(18-86). The mutant proteins (pro-GCAP-II-(7-86) and
pro-GCAP-II-(18-86)) contained two additional amino acid residues,
which are derived from the XhoI site in the expression
vector, at their N termini. The cDNA sequences of the vectors thus
constructed were confirmed by analysis using an Applied Biosystems 373A
sequencing system.
Expression of Deletion Mutants in 293T Cells--
Human
embryonic kidney 293T cells (24) were maintained in 10% FBS/DMEM and
transferred in a 10-cm diameter plate at 60-80% confluence with 20 µg of each of the expression vectors and the SuperFect reagent
(Qiagen, Hilden, Germany) according to the manufacturer's specifications. After incubation for 16 h, the medium was replaced by DMEM (10 ml/plate) without FBS and the cells were incubated for an
additional 2 days at 37 °C in a CO2 incubator.
Purification of the Recombinant Proteins Expressed by E. coli
Cells or Human Kidney 293T Cells--
The recombinant proteins, which
were expressed as inclusion bodies in E. coli cells, were
treated with 20 eq of DTT in 50 mM Tris/HCl (pH 8.0) (200 µl) containing 6 M guanidine HCl under an N2
atmosphere at 50 °C for 1 h. The supernatant of the reaction mixture or the culture medium (20 ml) of the 293T cells were applied to
a column of Cosmosil 140C18-OPN (1 ml) (Nacarai Tesque
Inc., Kyoto, Japan) pre-equilibrated with and washed with 20 ml of
solvent A (20% CH3CN in 0.05% trifluoroacetic acid). The
adsorbed proteins, which were eluted with solvent B (80%
CH3CN in 0.05% trifluoroacetic acid), were collected and
lyophilized. The protein was purified by HPLC and analyzed by mass
spectrometry, as described previously (17). The yield of the purified
protein was 0.5-1 nmol/10 ml of the culture medium of 293T cells, as
estimated by amino acid analyses.
Endoproteinase Arg-C Digestion of the Recombinant
Proteins--
The recombinant protein (1 nmol) was incubated with
endoproteinase Arg-C (50 pmol) in 0.1 M Tris/HCl (pH 8.0)
(200 µl) at 37 °C for 18 h. The digest was treated with
anhydrotrypsin agarose as described previously (17), and the
supernatant was subjected to HPLC. The eluates were analyzed by mass
spectrometry and amino acid analysis.
Gel Filtration Chromatography--
The HPLC apparatus consisted
of a Waters 600 multisolvent delivery system (Bedford, MA) equipped
with a Hitachi L-3000 photodiode array detector and a D-2000
chromato-integrator (Tokyo, Japan). The protein (1 nmol) was dissolved
in 50 mM Tris/HCl (pH 7.4) (50 µl) containing 0.2 M NaCl and chromatographed on a TSK-Gel G3000SWXL column (7.8 × 300 mm; Tosoh, Tokyo, Japan).
The protein was eluted with 50 mM Tris/HCl (pH 7.4)
containing 0.2 M NaCl at a flow rate of 0.8 ml/min, and the
eluate was monitored at 220 nm. The molecular mass of the protein was
calibrated using a gel filtration calibration kit (Amersham Pharmacia
Biotech) containing bovine serum albumin (67 kDa), ovalbumin (43 kDa), RNase A (13.7 kDa), and thioredoxin (20 kDa). Thioredoxin was prepared
from E. coli cells transformed with pET32b (Novagen), which
possesses the cDNA encoding thioredoxin, purified on a
nickel-nitrilotriacetic acid resin (Qiagen), and identified by mass
spectrometric analysis.
In Vitro Complementary Refolding of Pro-GCAP-II-(7-86) and
Pro-GCAP-II-(12-86)--
The fully reduced pro-GCAP-II-(12-86) was
prepared as follows. The protein (2 nmol) was incubated with 20 eq of
DTT in 50 mM Tris/HCl (pH 8.0) (200 µl) containing 6 M guanidine HCl under an N2 atmosphere at
50 °C for 1 h. The reduced pro-GCAP-II-(12-86) was purified by
HPLC, as described above, and lyophilized. The reduced
pro-GCAP-II-(12-86) (1 nmol) was dissolved in 0.05% trifluoroacetic acid (20 µl) and mixed with 9 volumes of 50 mM Tris/HCl
(pH 8.0) in the presence of 2 mM GSH and 1 mM
GSSG as described previously, and incubated at room temperature for 2 days. The oxidative refolding experiment was also carried out in the
redox buffer in the presence of the synthetic complementary N-terminal
peptides (VYIQYQ or VYIQYQGFRVQ). The reaction mixture was analyzed by
HPLC. All solutions used for the refolding experiment were flushed with
N2, and the reaction was carried out in a sealed vial under
an atmosphere of N2.
Mutational Analysis of the N-terminal Amino Acids for a Role in the
in Vitro Folding of Pro-GCAP-II--
In a previous report, we
demonstrated that the mature form of GCAP-II does not possess
sufficient information to permit for its correct folding and that the
propeptide in pro-GCAP-II aids in the folding process, yielding only
the bioactive form of GCAP-II (17). This result provided confirmation
that the function of the propeptide in the pro-leader sequence of
pro-GCAP-II was to serve as an intramolecular chaperone in the folding
of GCAP-II, and consequently raised a number of questions, such as (i)
which region(s) in the pro-leader sequence of pro-GCAP-II contribute to
the correct folding of the mature peptide, and (ii) how does the
propeptide play a role in the folding of GCAP-II in vivo and in vitro?
To address these problems, we first searched the sequence motif(s) in
the pro-leader sequence of pro-GCAP-II in the primary structures of
pro-GCAP-IIs, which have been determined thus far, and then deduced the
secondary structure of pro-GCAP-II using the Chou-Fasman method (25),
as shown in Fig. 1. The amino acid sequences of the N-terminal region (amino acid residues 1-23) and the
C-terminal region (amino acid residues 38-65) in the pro-leader sequence of pro-GCAP-II are highly homologous in all species, whereas
that in the central region (amino acids 24-37) is diverse. This raises
the possibility that the N-terminal region (amino acid residues 1-23),
along with the C-terminal region (amino acid residues 38-65), acts as
an intramolecular chaperone for the correct folding of pro-GCAP-II to
yield the bioactive conformation of the mature peptide, GCAP-II.
Further, the secondary structure prediction implied that the N-terminal
region (amino acids 1-6) and the C-terminal region (LCVNV, amino acid
residues 76-80) in the mature region exist as
To examine the nature of the participation of the N-terminal region in
the pro-leader sequence of pro-GCAP-II in terms of its correct folding,
we prepared a series of mutant proteins of pro-GCAP-II, in which the
N-terminal amino acid residues were sequentially deleted from the N
terminus of pro-GCAP-II (Fig. 2). The
recombinant proteins were generated using E. coli BL21(DE3) cells. All mutant proteins were expressed with an additional Met residue at their N termini, which originated from the starting codon.
For example, the deletion of a Val residue at the N terminus of
pro-GCAP-II resulted in the production of the mutant protein, Met1-pro-GCAP-II-(2-86) (Fig. 2). Since the mutant
proteins were produced as inclusion bodies in the bacterial cells, as
is the case for the expression of many eukaryotic proteins by E. coli cells, we were not able to define the conformational states
of the mutant proteins immediately after expression in the cells. As a
result, the recombinant proteins were purified by HPLC in the reduced form and then oxidatively refolded to the oxidized forms in the presence of 2 mM GSH and 1 mM GSSG following
previously reported procedures (17). The refolded proteins were
subjected to HPLC, which indicated the presence of a few isomers, which
comprised different disulfide linkages (data not shown). It was not
possible to completely separate these isomers from each other under the conditions used in this experiment. The refolded proteins were then
directly digested by endoproteinase Arg-C and the resulting digests
were separated by HPLC, as previously reported (17). The ratios of the
disulfide isomers in the digests, which have different disulfide
linkages and were clearly separated on HPLC as is the case in our paper
(17), were estimated by measurement of their peak areas on HPLC and
shown in Fig. 2. The mutant protein, Met1-pro-GCAP-II-(2-86), consisted predominantly of the
native-type Thr-Ile-Ala-uroguanylin (the native-type
Thr-Ile-Ala-uroguanylin contains two disulfide linkages between
Cys74 and Cys82 and Cys77 and
Cys85 (Ref. 17)), along with small amounts of biologically
inactive isomers 1 and 2 (the positions of the disulfide bonds of
isomer 1 are between Cys74 and Cys85 and
Cys77 and Cys82, and isomer 2 between
Cys74 and Cys77 and Cys82 and
Cys85 (Ref. 17)), as found in the folding of the wild-type
pro-GCAP-II (17). This indicates that the mutation of the Val residue
to Met at the N terminus had no significant effect on the folding of
pro-GCAP-II. The mutant proteins, Met2-pro-GCAP-II-(3-86)
and Met3-pro-GCAP-II-(4-86), were composed of the
native-type Thr-Ile-Ala-uroguanylin, isomer 1 and isomer 2 in ratios of
1: 1.14: 0.82 and 1: 4.4: 2.10, respectively. These data suggest that
the deletion of the amino acid residue at the N terminus greatly
affects the construction of the native tertiary structure in the mature
region of pro-GCAP-II, because the native-type disulfide pairing
comprises only one-third of the mutant protein
(Met2-pro-GCAP-II-(3-86)). Further, the mutant protein,
Met3-pro-GCAP-II-(4-86), in which two amino acid residues
were deleted from the N terminus, nearly completely lacked the ability
to form the correct disulfide pairing in the mature region and, thus, was devoid of the chaperone function in the pro-leader sequence of
pro-GCAP-II, because the ratio of the native type to isomers was
comparable with that in the folding of the mature hormone, GCAP-II
(17).
To further investigate whether the Tyr residue at position 2 from the N
terminus is involved in the folding of pro-GCAP-II, the mutant protein,
Met1,2-pro-GCAP-II-(3-86), was prepared in which the Tyr
residue was replaced by Met. The result indicates that the distribution
of the native-type isomers 1 and 2 in
Met1,2-pro-GCAP-II-(3-86) were nearly the same as in the
case of Met1-pro-GCAP-II-(2-86) and, therefore, that the
replacement of the Tyr residue with Met had no effect on the function
of the propeptide in the pro-leader sequence. Collectively, these
results indicate that the two N-terminal amino acid residues in length,
in particular the N-terminal residue, play an important role in the
formation of the correct disulfide linkages of the mature portion of
pro-GCAP-II in vitro and, thus, in the function of the
intramolecular chaperone of the propeptide in the pro-leader sequence
of pro-GCAP-II.
Expression of the N-terminal Deletion Mutants of Pro-GCAP-II in
293T Cells--
Since the mutant proteins were expressed as inclusion
bodies in the E. coli cells, we were not able to estimate
the effect of the deletion of the N-terminal residue on the in
vivo folding of pro-GCAP-II. Therefore, we prepared the wild-type
pro-GCAP-II in human embryonic kidney 293T cells, as well as the
N-terminal deletion mutants, in which the N-terminal amino acid
residues were sequentially deleted from the N terminus, and three types of mutant proteins of pro-GCAP-II, which are devoid of the N-terminal region, as shown in Fig. 2: 1) pro-GCAP-II-(7-86), which is deprived of the 6 N-terminal amino acid residues; 2) pro-GCAP-II-(12-86), which
lacks the 11 N-terminal residues; and 3) pro-GCAP-II-(18-86), which
lacks the 17 N-terminal residues that comprise an invariant region
(amino acid residue sequence 12-17) in both pro-GCAP-II and
pro-GCAP-I. The N-terminal deletion mutant proteins, which lack the
N-terminal Val or Val-Tyr residues, could not be isolated from 293T
cells, although the reason for this is not clear at present. The mutant
proteins, which were deleted in a portion of the peptide in the
pro-leader sequence of pro-GCAP-II, might be due to its failure to fold
in the endoplasmic reticulum, resulting in a protein that is
susceptible to degradation by proteases and is not secreted from the
endoplasmic reticulum (26). The other deletion mutants and the
wild-type pro-GCAP-II were expressed in human kidney 293T cells via the
expression vector, secreted into the culture media, and then purified
by HPLC (Fig. 3) and analyzed by
matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry (Fig. 4). The wild-type
pro-GCAP-II showed a signal at m/z = 9487.0, which is
consistent with the mass value (9487.9) calculated from the amino acid
sequence. In contrast, pro-GCAP-II-(7-86), pro-GCAP-II-(12-86), and
pro-GCAP-II-(18-86) exhibited mass spectral signals at
m/z = 17859.5, 16203.0, and 15248.0, respectively,
which are twice the theoretical values, calculated from their amino
acid sequences. No monomeric forms of the N-terminal deletion mutant
proteins were detected on Fig. 3. These results indicate that the
wild-type pro-GCAP-II was prepared as a monomer and, conversely, that
the mutant proteins, which lack the N-terminal amino acid residues,
were expressed as dimers. This dimer appears to be composed of two
monomer units, which are connected via a covalent linkage(s), perhaps
intermolecular disulfide linkage(s), because the dimer could be
converted into a monomer by treatment with DTT, as described below.
To determine the location of the intermolecular disulfide linkage(s)
found in the recombinant proteins, which are devoid of the N-terminal
region, the wild-type pro-GCAP-II (as a control) and
pro-GCAP-II-(12-86) were each digested with endoproteinase Arg-C and
the hydrolysates examined by HPLC (Fig.
5). A comparison of the HPLC profiles of
the digests of the wild-type pro-GCAP-II and pro-GCAP-II-(12-86)
revealed that the wild-type pro-GCAP-II comprises the native-type
Thr-Ile-Ala-uroguanylin covering the mature GCAP-II (observed mass
value, 1953.0; theoretical value, 1953.2), whereas pro-GCAP-II-(12-86)
contains a dimer (observed mass value, 3906.9; theoretical value,
3906.5) of Thr-Ile-Ala-uroguanylin. Two Cys residues at positions 41 and 54 in the pro-leader sequence of pro-GCAP-II were correctly bridged
in both the wild-type pro-GCAP-II and pro-GCAP-II-(12-86). This
clearly shows that the intermolecular disulfide linkage(s) in the
recombinant pro-GCAP-II-(12-86) were connected in its mature region.
The disulfide pairing in the dimer of Thr-Ile-Ala-uroguanylin in
pro-GCAP-II-(12-86) could not be further defined, because the peptide
was not soluble after purification by HPLC. The other N-terminal
deletion proteins also gave the same results as found in
pro-GCAP-II-(12-86) (data not shown). Consequently, these data
indicate that the deletion of the N-terminal region in the pro-leader
sequence of pro-GCAP-II greatly influenced the linking of the disulfide
bonds in the mature peptide of pro-GCAP-II, GCAP-II. In other words,
the N-terminal region (amino acid residues 1 to 6) in the pro-leader
sequence of pro-GCAP-II plays a critical role in the formation of the
three dimensional structure of pro-GCAP-II in vivo and in
turn, the folding of the mature peptide, GCAP-II.
In Vitro Disulfide-coupled Folding of the N-terminal Deletion
Mutants Expressed in 293T Cells--
The S-protein (amino acid
sequence 22-124) of RNase A folds complementarily with the S-peptide
(amino acid sequence 1-21) to a stable conformation similar to that of
intact RNase A (27-29). This led us to determine if
pro-GCAP-II-(7-86) or pro-GCAP-II-(12-86) were able to adopt a
tertiary structure similar to that of the intact protein by the aid of
the complementary N-terminal peptides, which consist of 6 or 11 amino
acid residues, respectively. The relative abundance of three disulfide
isomers of the refolded proteins, pro-GCAP-II-(7-86) or
pro-GCAP-II-(12-86), was nearly identical with those found in the
refolding of the mature GCAP-II (17) and
Met3-pro-GCAP-II-(4-86) (data not shown). Next, these
N-terminal deletion proteins were reduced with DTT and, after removal
of the reducing reagent, incubated with the corresponding peptides
under the same conditions that were used for the refolding of the
full-length protein. The N-terminal deletion proteins did not
efficiently adopt a native conformation in the presence of the
complementary peptides, as is the case for RNase A (data not shown). It
should be noted, however, that the possibility that the complementary refolding of the N-terminal deletion proteins with the rest of the
peptides could occur under conditions different from those used in this
experiment cannot be excluded. Insulin and chymotrypsin, in contrast to
their precursor proteins, have been observed to become
thermodynamically unstable after the release of their propeptides. In
this case, the mature proteins are required to fold to the proper
structure in the original single-chained precursor proteins with the
propeptides, which aid in guiding the proteins to the native
conformation (30, 31). It is likely in the case of those proteins that
the N-terminal portion in the pro-leader sequence of pro-GCAP-II
functions to stabilize the three-dimensional structure of
pro-GCAP-II.
In eukaryotic translation systems, a protein initiates co-translational
folding from the N-terminal region prior to the release of the nascent
chain from the ribosome, and achieves a native conformation after the
synthesis of the entire protein (32). As described above, the disulfide
bond between two Cys residues at positions 41 and 54 in the pro-leader
sequence of pro-GCAP-II was correctly formed in the N-terminal deletion
proteins both in vitro and in vivo. This implies
that the propeptide region in these proteins assemble the
three-dimensional structure in a manner similar to that in the
wild-type pro-GCAP-II. However, the N-terminal deletion proteins of
pro-GCAP-II gave rise to incorrect conformations of their mature
regions, when expressed in vivo, and the native disulfide
pairing was not predominant, when refolded in vitro. In
addition, the N-terminal deletion proteins of pro-GCAP-II were refolded
into only one type of disulfide isomer in vivo (Fig. 3),
whereas these were obtained as a mixture of three disulfide isomers
in vitro, as mentioned above. This may reflect a difference in the folding mechanism of pro-GCAP-II (or possibly proteins in
general) under in vivo versus in vitro
conditions. Considering these observations, we speculate that a
propeptide region in the pro-leader sequence of pro-GCAP-II is folded
at an earlier stage than the folding stage of the mature portion of
pro-GCAP-II in vivo. The N-terminal deletion proteins did
not efficiently achieve the proper tertiary structure but, rather, gave
rise to, largely, misfolded protein in the folding pathway in
vivo, because of the absence of the N-terminal region, which may
interact with the mature region in the final stage of the folding of
pro-GCAP-II. Indeed, our preliminary data for the CD analysis of the
folding intermediate suggested that the misfolded GCAP-II was produced during the initial folding and gradually converted to the native type
of pro-GCAP-II after the formation of the native conformation of the
propeptide. In this stage we conclude that the N-terminal region in the
pro-leader sequence of pro-GCAP-II may contribute toward the
thermodynamic control of the folding of pro-GCAP-II and regulates the
proper folding of the mature region of pro-GCAP-II, GCAP-II.
Dimerization of Pro-GCAP-II--
As is known in prosubtilisin,
numerous proteases, such as subtilisin and
In addition, we observed that the N-terminal deletion proteins do not
form intermolecularly disulfide-linked dimers in the presence of
protein disulfide isomerase in the in vitro refolding (data
not shown). This suggests that the dimerization of the N-terminal deletion proteins is not the result of compliance with protein disulfide isomerase, which functions in protein folding in
vivo (33, 34). Therefore, the dimeric form of the N-terminal
deletion proteins may represent an intermediate in the folding pathway of pro-GCAP-II and could be kinetically trapped during the folding of
the mutant proteins in vivo. Collectively, these results
imply that pro-GCAP-II forms a dimer as an intermediate(s) in the
folding pathway and suggests that pro-GCAP-II exists as a dimer in the final product. As described above, the deletion of the N-terminal region in the pro-leader sequence of pro-GCAP-II resulted in a failure
to form the correct disulfide linkages in the mature portion. Consequently, the mature portion in the N-terminal deletion protein results in a different conformation from that of the wild-type pro-GCAP-II and in turn is unlikely to interact with each other to
afford a dimer. This suggests that the propeptide portion, in
particular, the region (amino acid sequence 18-62), in the pro-leader
sequence of pro-GCAP-II might be involved in the creation of an
interface in the interaction between two molecules of pro-GCAP-II for
affording the dimer. Thus, it appears that the dimerization directly
regulates the folding of pro-GCAP-II and contributes to the formation
and stabilization of the three dimensional structure of both
pro-GCAP-II and the mature portion of pro-GCAP-II, GCAP-II.
Competitive Refolding of Pro-GCAP-II and
Pro-GCAP-II-(12-86)--
The observation that pro-GCAP-II exists as a
dimer in the intermediate and final states of the folding process
raises the question of whether pro-GCAP-II is folded to a dimer
intramolecularly (in cis) or intermolecularly (in
trans). We tested the in vitro refolding of
pro-GCAP-II in the presence of pro-GCAP-II-(12-86), which is devoid of
the 11 N-terminal amino acid residues. If there are intermolecular
interactions between the two proteins, pro-GCAP-II should yield both
the correctly refolded protein and the misfolded protein. Mixing
pro-GCAP-II with pro-GCAP-II-(12-86) in their unfolded states had no
effect on the yield and the nature of their refolding (data not shown).
This result demonstrates that pro-GCAP-II was refolded to the correct
conformation without interference by pro-GCAP-II-(12-86),
i.e. by an intramolecular interaction (in cis),
and vice versa under the conditions used in this experiment.
In order to determine whether pro-GCAP-II forms a dimer in
vivo intramolecularly or intermolecularly, pro-GCAP-II was
co-expressed with pro-GCAP-II-(12-86) in 293T cells and the culture
media were directly analyzed by HPLC, as shown in Fig.
7 (A-D). pro-GCAP-II was
expressed as a monomer (Fig. 7A, peak
a) and pro-GCAP-II-(12-86) as a dimer (Fig. 7A,
peak b). In addition, the formation of a hetero-dimer
between pro-GCAP-II and pro-GCAP-II-(12-86) or other species related
to these proteins have not been detected by HPLC. This indicates that
pro-GCAP-II was expressed and folded to the native conformation without
any influence by the co-existence of pro-GCAP-II-(12-86) in 293T
cells. However, pro-GCAP-II-(12-86) was recovered in a low yield in
the co-expression experiment, as shown in Fig. 7A. This
might be due to the low expression efficiency of pro-GCAP-II-(12-86),
but the precise reason for this is not clear. Thus, pro-GCAP-II was
expressed with pro-GCAP-II-(12-86) at the various ratios of their
expression vectors for transfection into the 293T cells. Original
yields of pro-GCAP-II-(12-86) were obtained when the amount of the
expression vector of pro-GCAP-II was decreased to 1/5 eq of that of
pro-GCAP-II-(12-86), as shown in Fig. 7C. The misfolded
pro-GCAP-II and other types of the proteins related to pro-GCAP-II and
pro-GCAP-II-(12-86) were no longer detected. These results are
consistent with pro-GCAP-II being intramolecularly (in cis)
folded to the native conformation without interference by
pro-GCAP-II-(12-86) in vivo.
Prosubtilisin, the precursor protein of subtilisin, forms a dimer
through an intermolecular interaction (in trans) between two
molecules, and has a "molten globule"-like structure, in the folding process (22). This dimer constitutes the hydrophobic interface
between the two molecules, which consists of the two
In the present study, we examined the amino acid residues in the
propeptide of pro-GCAP-II that are responsible for its folding. This
process exploited two intriguing findings, which are related to the
function of the propeptide in the pro-leader sequence of pro-GCAP-II in
the proper assembly of the protein molecule. The first is the
involvement of the one or two amino acid residues at the N terminus of
the pro-leader sequence of pro-GCAP-II in ensuring that the protein
folds to the correctly assembled conformation. This is strongly
supported by the in vitro folding experiment, which clearly
shows that pro-GCAP-II forms the correctly folded native structure,
whereas the proteins in which the N-terminal one or two amino acids are
absent, lead, largely, to the misfolded structure, despite the fact
that direct evidence from the in vivo folding experiment of
pro-GCAP-II, which lacks the N-terminal amino acid residues, has not
yet been obtained. The secondary structure analysis of pro-GCAP-I and
pro-GCAP-II predicted the existence of
Second, a propeptide in the pro-leader sequence of pro-GCAP-II is
tightly associated with its dimerization via the intermolecular interaction between the region involving the propeptide. The mature form of pro-GCAP-II, GCAP-II, obeys "non-Anfinsen" folding (10). This is analogous to the folding behavior of insulin-like growth factor
I (IGF-I) (10) but different from the propeptide-mediated folding of
proteins such as subtilisin, in which the propeptide appears to act at
the kinetic level by accelerating the folding rate (20). The
dimerization of IGF-I itself is not involved in the folding pathway,
but it has recently been reported that an IGF-binding protein can
facilitate the correct folding of IGF-I and that the heterodimer
between IGF-I (or a precursor form of IGF-I) and IGF-binding protein
thermodynamically stabilizes the native conformation of IGF-I (13).
pro-GCAP-II is not able to activate its receptor protein, guanylyl
cyclase C, indicating that the mature portion of pro-GCAP-II, GCAP-II,
is buried inside the structure of pro-GCAP-II and that the two
disulfide bonds in the mature region are not exposed to the surface of
the molecule or, if so, that they are concealed between the dimer of
pro-GCAP-II. Therefore, one can speculate that the native conformation
of pro-GCAP-II is thermodynamically stabilized by the dimerization of a
propeptide in the pro-leader sequence of pro-GCAP-II. Possibly, the
dimer might be formed at the intermediate(s) stage during the folding process. This might stabilize the rate-determining transition states,
as well as the propeptide in subtilisin, and prevent the incorrect
aggregation by protecting the hydrophobic surface of the protein
molecule from environmental solvents. Interactions with other proteins
may improve the kinetics of the appearance of the functional
conformation or to prevent the formation of incorrectly folded
structures, which might be lost to the folding pathway.
In conclusion, the present result shows that the propeptide of
pro-GCAP-II has two roles, a chaperone function and a dimerization function. The issue of whether these function independently or in a
concerted manner will require further study. In any event, the data
contribute to an explanation of the pathways by which pro-GCAP-I or
pro-GCAP-II attain the proper folding to provide the biologically
active mature peptides and generally, of the folding mechanism of
propeptide hormones to the matured hormones.
We thank Professor Katsuya Nagai (Division of
Protein Metabolism, Institute for Protein Research, Osaka University,
Osaka, Japan) for help in performing the expression of recombinant
proteins from human kidney 293T cells. Use of the facility at the Radio Isotope Research Center of Osaka University is acknowledged.
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Fax: 81-6-6879-8603;
E-mail: yuji@protein.osaka-u.ac.jp.
Published, JBC Papers in Press, May 25, 2000, DOI 10.1074/jbc.M000543200
The abbreviations used are:
GC-C, guanylyl
cyclase C;
GCAP-II, guanylyl cyclase-activating peptide II (the plasma
form of uroguanylin);
pro-GCAP-I, proguanylin;
pro-GCAP-II, prouroguanylin;
prepro-GCAP-I, preproguanylin;
prepro-GCAP-II, preprouroguanylin;
Arg-C, arginylendopeptidase C;
DMEM, Dulbecco's
modified Eagle's medium;
FBS, fetal bovine serum;
PCR, polymerase
chain reaction;
HPLC, high performance liquid chromatography;
DTT, dithiothreitol;
IGD, insulin-like growth factor.
Dual Function of the Propeptide of Prouroguanylin in the Folding
of the Mature Peptide
DISULFIDE-COUPLED FOLDING AND DIMERIZATION*
§,,,
,, and
Division of Organic Chemistry and
¶ Division of Protein Metabolism, Institute for Protein Research,
Osaka University, Yamadaoka 3-2, Suita, Osaka 565-0871, Japan and the
Lower Saxony Institute for Peptide Research,
Feodor-Lynen-Strasse 31, D-30625 Hannover, Germany
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
-lytic protease, etc.,
in which the peptides of the pro-leader sequences in the precursor
proteins aid the mature proteins in the proper assembly of the three
dimensional structures in vitro and are referred to as
"intramolecular chaperones" (18-20). The mature proteins are
produced by enzymatic cleavage of the peptides in the pro-leader sequences from the folded precursor proteins. In these examples, the
peptides in the pro-leader sequences function not only to diminish the
activation energy but also to stabilize the rate-determining transition
state(s) in the folding pathway (20, 21). Moreover, the N-terminal
peptide in the pro-leader sequence of prosubtilisin, the precursor
protein of subtilisin, mediates the folding of the protein
intermolecularly. Prosubtilisin exists as homodimer that is assembled
during the folding of the protein (21, 22). However, the mechanism, at
the molecular level, of the folding of these proteins via the peptides
in the pro-leader sequence remains unclear.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
-D-galactopyranoside at the mid-log phase of cell growth.
After incubation at 37 °C for 3 h, the cells were harvested and
washed with phosphate-buffered saline without magnesium and calcium
ions, containing 1% Triton and 1 mM phenylmethylsulfonyl
fluoride. The cells were resuspended in the same buffer, sonicated on
ice, and centrifuged (15,000 × g, 20 min). The mutant
proteins, isolated as an inclusion body, possessed the Met residue at
the N terminus derived from the NdeI site during subcloning.
The proteins thus prepared were characterized by mass spectrometry and
amino acid analysis.
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
-strands, not only in
pro-GCAP-II, but also in pro-GCAP-I. Schulz et al. (23)
recently demonstrated that the N-terminal region (amino acids 1-5) is
in close proximity to the C-terminal region (a portion of guanylin) in
the solution structure of pro-GCAP-I, as evidenced by NMR measurement.
This may be extended to the speculation that the N-terminal region shares a characteristic secondary structure of pro-GCAP-I with the
C-terminal mature region. A similar molecular conformation may be
imagined in the structure of pro-GCAP-II, since it is likely that
pro-GCAP-II has a conformation similar to that of pro-GCAP-I, i.e. it is possible that the N-terminal region (amino acids
1-23) in the pro-leader sequence of pro-GCAP-II interacts with the
C-terminal mature region. This interaction may lead to the proper
folding of pro-GCAP-II and contribute to the stabilization of the three dimensional structure of the mature portion of pro-GCAP-II,
GCAP-II.
View larger version (35K):
[in a new window]
Fig. 1.
Primary and predicted secondary structures of
prouroguanylin for human (8), pig (EMBL/GenBank/DDBJ accession number
O13009), rat (EMBL/GenBank/DDBJ accession number P70668), mouse (11),
opossum (12), and guinea pig (EMBL/GenBank/DDBJ accession number
P70107). Numbers on figure refer to the amino
acid sequence of human prouroguanylin. Completely matched amino acid
residues are shaded. Disulfide linkages are between
positions Cys41 and Cys54, Cys74
and Cys82, and Cys77 and Cys85
(17). Single-letter codes for amino acid residues
are used. The H, S, and T in the
secondary structure represent -helix, -sheet, and -turn,
respectively.
View larger version (35K):
[in a new window]
Fig. 2.
Schematic representation of the recombinant
wild-type prouroguanylin and N-terminal deletion mutant proteins
prepared in this study.
View larger version (38K):
[in a new window]
Fig. 3.
HPLC profiles of the culture supernatants of
293T cells, which express the wild-type pro-GCAP-II
(A), pro-GCAP-II-(7-86) (B),
pro-GCAP-II-(12-86) (C), and pro-GCAP-II-(18-86)
(D). The target proteins are indicated by
arrows. HPLC was performed as described under
"Experimental Procedures."
View larger version (18K):
[in a new window]
Fig. 4.
Matrix-assisted laser
desorption/ionization time-of-flight mass spectra of the
wild-type pro-GCAP-II (A) and the mutant protein,
pro-GCAP-II-(12-86) (B). Mass spectra
were obtained using a Voyager Elite XL TOF mass spectrometer equipped
with a delayed-extraction system (PerSeptive Biosystems, Framingham,
MA).
View larger version (23K):
[in a new window]
Fig. 5.
Arg-C digestion of wild-type pro-GCAP-II
(A) and pro-GCAP-II-(12-86)
(B). The position of Thr-Ile-Ala-uroguanylin is
indicated by arrows.
-lytic protease, are
synthesized in the form of enzymatically inactive precursor proteins
with pro-leader sequences, which then proceed to the active enzymes via
the cleavage of the pro-leader sequences, which functions as an
intramolecular chaperone. The precursor protein, prosubtilisin, forms a
dimer, not only as a folding intermediate but also in the product just
prior to processing to the mature protein (21, 22). Dimerization is an
important step in the construction of the native tertiary structure of
prosubtilisin. To understand the issue of whether pro-GCAP-II fits this
case, i.e. if pro-GCAP-II dimerizes both as an
intermediate(s) and as the final product in the folding process, we
first investigated the behavior of pro-GCAP-II, which was expressed
from 293T cells, and pro-GCAP-I (23) by size exclusion chromatography.
Fig. 6 shows that pro-GCAP-II (9.5 kDa)
and pro-GCAP-I (10.3 kDa) were eluted at retention times corresponding
to 15.5 and 21 kDa, respectively. This observation demonstrates that
these proteins behave as the homodimers in solution through
non-covalent interactions, rather than as monomeric forms, although the
observed molecular mass of pro-GCAP-II was smaller than the theoretical
value for the dimer of pro-GCAP-II (19 kDa). Second, to examine whether
dimerization is involved in the folding of pro-GCAP-II, we analyzed the
efficiency of the refolding of pro-GCAP-II at various concentrations
in vitro, since the dimerization of a protein is usually
concentration dependent. pro-GCAP-II was refolded to the correct
conformation in almost quantitative yield at
10
5 M protein concentration (17),
although in a rather low yield (less than 10%) at concentrations of
less than 106 M (data not shown).
This result suggests that dimer formation is involved in the folding
pathway of pro-GCAP-II.
View larger version (27K):
[in a new window]
Fig. 6.
The calibration curve of size exclusion
chromatogram. The molecular masses calculated from the amino acid
sequences are indicated in parentheses. BSA and
OVA represent bovine serum albumin and ovalbumin,
respectively.
View larger version (30K):
[in a new window]
Fig. 7.
HPLC profiles of the culture supernatants of
293T cells in which the wild-type pro-GCAP-II and the mutant protein,
pro-GCAP-II-(12-86), were co-expressed. The expression
vectors of pro-GCAP-II and pro-GCAP-II-(12-86) were
co-transfected into 293T cells by the ratios of 1 (A), 1/2
(B), 1/5 (C), and 1/10 (D).
pro-GCAP-II (in a monomer form) and pro-GCAP-II-(12-86) (in a dimer
form) were eluted at the positions shown by arrows
a and b, respectively.
-helices in the
mature region and the -strand in the propeptide region, which are
localized on the surface of each the constituent molecules, thus
stabilizing the substructure in prosubtilisin (9). The
propeptide plays an important role as an intramolecular chaperone for
the generation of the correctly assembled dimer of prosubtilisin, which
may prevent undesirable aggregation during the folding and, in
addition, serves as a shield for the enzymatic activity until
maturation. The three-dimensional structure of pro-GCAP-II remains
unknown but seems to retain an interface between two molecules in the
dimer. This structure allows the hydrophobic surface of the propeptide
region to be protected from exposure to solvent in an aqueous
environment, because the propeptide in the pro-leader sequence of
pro-GCAP-II tends to aggregate in aqueous solution (data not shown).
From this point of view, it is assumed that, as in the case of
prosubtilisin, the pro-GCAP-II dimer participates in the formation of
the functional structure for stabilizing the rate-determining
transition state in the folding of pro-GCAP-II and in protecting the
hydrophobic surface from environmental solvents, despite the fact that
pro-GCAP-II folds to a dimer via a mechanism different from that of prosubtilisin.
-strands at the N and C
termini, which might interact with one another to give a -sheet-like
structure. This is consistent with long range nuclear Overhauser
effects between N- and C-terminal amino acids in pro-GCAP-I, showing
that the N-terminal residues were in close proximity to the mature
region (23). Moreover, existing NMR data are consistent with our
findings that the N-terminal amino acids in the pro-leader sequence of
pro-GCAP-II is capable of directly participating in the
disulfide-coupled folding of pro-GCAP-II and in turn, its mature
peptide, GCAP-II. Therefore, the role of the N-terminal amino acid
residues in pro-GCAP-II may be to stabilize the native conformation of
pro-GCAP-II, in order to kinetically trap the correct tertiary
structure of the mature region, GCAP-II. The precise role of the
N-terminal region in the folding of pro-GCAP-II might be explained by
an analysis of the folding intermediates. This is currently under way
in our laboratory.
ACKNOWLEDGEMENTS
FOOTNOTES
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
1.
Lazure, C.,
Seidah, N. G.,
Pelaprat, D.,
and Chretien, M.
(1983)
Can. J. Biochem. Cell Biol.
61,
501-515
2.
Cuurie, M. G.,
Fok, K. F.,
Kato, J.,
Moore, R. J.,
Hamra, F. K.,
Duffin, K. L.,
and Smith, C. E.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
947-951
3.
Hamra, F. K.,
Forte, L. R.,
Eber, S. L.,
Pidhorodeckyj, N. V.,
Krause, W. J.,
Freeman, R. H.,
Chin, D. T.,
Tompkins, J. A.,
Fok, K. F.,
Smith, C. E.,
Duffin, K. L.,
Siegel, N. R.,
and Currie, M. G.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
10464-10468
4.
Hess, R.,
Kuhn, M.,
Schultz-Knappe, P.,
Raida, M.,
Fuchs, M.,
Klodt, J.,
Adermann, K.,
Kaever, V.,
Cetin, Y.,
and Forssmann, W.-G.
(1995)
FEBS Lett.
374,
34-38
5.
Shultz, S.,
Green, C. K.,
Yuen, P. S. T.,
and Garbers, D. L.
(1990)
Cell
63,
941-948
6.
Field, M.,
Graf, L. H.,
Laird, W. J.,
and Smith, P. L.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
2800-2804
7.
Forte, L. R.,
and Currie, M. G.
(1995)
FASEB J.
9,
643-650
8.
Hill, O.,
Cetin, Y.,
Cieslak, A.,
Magert, H. J.,
and Forssmann, W.-G.
(1995)
Biochim. Biophys. Acta
1253,
146-149
9.
Bryan, P.,
Wang, L.,
Hoskins, J.,
Ruvinov, S.,
Strausberg, S.,
Alexander, P.,
Almog, O.,
Gilliland, G.,
and Gallagher, T.
(1995)
Biochemistry
34,
10310-10318
10.
Hober, S.,
Uhlen, M.,
and Nilsson, B.
(1997)
Biochemistry
36,
4616-4622
11.
Whitaker, T. L.,
Witte, D. P.,
Scott, M. C.,
and Cohen, M. B.
(1997)
Gastroenterology
113,
1000-1006
12.
Fan, X.,
Hamra, F. K.,
Freeman, R. H.,
Eber, S. L.,
Krause, W. J.,
Lim, R. W.,
Pace, V. M.,
Currie, M. G.,
and Forte, L. R.
(1996)
Biochem. Biophys. Res. Commun.
219,
457-462
13.
Hober, S.,
Hansson, A.,
Uhlen, M.,
and Nilsson, B.
(1994)
Biochemistry
33,
6758-6761
14.
Hamra, F. K.,
Fan, X.,
Krause, W. J.,
Freeman, R. H.,
Chin, D. T.,
Smith, C. E.,
Currie, M. G.,
and Forte, L. R.
(1996)
Endocrinology
137,
257-265
15.
Shultz, S.,
Chrisman, T. D.,
and Garbers, D. L.
(1992)
J. Biol. Chem.
267,
16019-16021
16.
de Sauvage, F. J.,
Keshav, S.,
Kuang, W.-J.,
Gillett, N.,
Henzel, W.,
and Goeddel, D. V.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
9089-9093
17.
Hidaka, Y.,
Ohno, M.,
Hemmasi, B.,
Hill, O.,
Forssmann, W.-G.,
and Shimonishi, Y.
(1998)
Biochemistry
37,
8498-8507
18.
Zhu, X.,
Ohta, Y.,
Jordan, F.,
and Inouye, M.
(1989)
Nature
339,
483-484
19.
Sohl, J. L.,
Jaswal, S. S.,
and Agard, D. A.
(1998)
Nature
395,
817-819
20.
Shinde, U.,
and Inouye, M.
(1993)
Trends Biochem. Sci.
18,
442-446
21.
Hu, Z.,
Zhu, X.,
Jordan, F.,
and Inouye, M.
(1994)
Biochemistry
33,
562-569
22.
Hu, Z.,
Haghjoo, K.,
and Jordan, F.
(1996)
J. Biol. Chem.
271,
3375-3384
23.
Schulz, A.,
Marx, U. C.,
Hidaka, Y.,
Shimonishi, Y.,
Rosch, P.,
Forssmann, W.-G.,
and Adermann, K.
(1999)
Protein Sci.
8,
1850-1859
24.
Wada, A.,
Hirayama, T.,
Kitaura, H.,
Fujisawa, J.,
Hasegawa, M.,
Hidaka, Y.,
and Shimonishi, Y.
(1998)
Infect. Immun.
64,
5144-5150
25.
Chou, P. Y.,
and Fasman, G. D.
(1978)
Adv. Enzymol. Relat. Areas Mol. Biol.
47,
45-148
26.
Wulfing, C.,
and Pluckthun, A.
(1994)
Mol. Microbiol.
12,
685-692
27.
Kato, I.,
and Anfinsen, C. B.
(1969)
J. Biol. Chem.
244,
1004-1007
28.
Labhardt, A. M.
(1979)
J. Mol. Biol.
135,
231-244
29.
Labhardt, A. M.
(1979)
J. Mol. Biol.
135,
245-254
30.
Givol, D.,
de Lorenzo, F.,
Goldberger, R. F.,
and Anfinsen, C. B.
(1965)
Proc. Natl. Acad. Sci. U. S. A.
53,
676-684
31.
Steiner, D. F.,
and Clark, J.
(1968)
Proc. Natl. Acad. Sci. U. S. A.
60,
622-629
32.
Netzer, W. J.,
and Hartl, U.
(1997)
Nature
388,
343-349
33.
Ruoppolo, M.,
Lundstrom-Ljung, J.,
Talamo, F.,
Pucci, P.,
and Marino, G.
(1997)
Biochemistry
36,
12259-12267
34.
Wilson, R.,
Lees, J. F.,
and Bulleid, N. J.
(1998)
J. Biol. Chem.
273,
9637-9643
Copyright © 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  N. G. Moss, R. C. Fellner, X. Qian, S. J. Yu, Z. Li, M. Nakazato, and M. F. Goy Uroguanylin, an Intestinal Natriuretic Peptide, Is Delivered to the Kidney as an Unprocessed Propeptide Endocrinology, September 1, 2008; 149(9): 4486 - 4498. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Arita, T. Shimizu, H. Hashimoto, Y. Hidaka, M. Yamada, and M. Sato Structural basis for histone N-terminal recognition by human peptidylarginine deiminase 4 PNAS, April 4, 2006; 103(14): 5291 - 5296. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. K. Lee, V. R. Saldivia, T. Nguyen, R. Cheng, S. R. George, and B. F. O'Dowd Modification of the Terminal Residue of Apelin-13 Antagonizes Its Hypotensive Action Endocrinology, January 1, 2005; 146(1): 231 - 236. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Zschenker, D. Oezden, and D. Ameis Lysosomal Acid Lipase as a Preproprotein J. Biochem., July 1, 2004; 136(1): 65 - 72. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Lauber, P. Neudecker, P. Rosch, and U. C. Marx Solution Structure of Human Proguanylin: THE ROLE OF A HORMONE PROSEQUENCE J. Biol. Chem., June 20, 2003; 278(26): 24118 - 24124. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Nauze, L. Gonin, B. Chaminade, C. Peres, F. Hullin-Matsuda, B. Perret, H. Chap, and A. Gassama-Diagne Guinea Pig Phospholipase B, Identification of the Catalytic Serine and the Proregion Involved in Its Processing and Enzymatic Activity J. Biol. Chem., November 8, 2002; 277(46): 44093 - 44099. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. B. Rosenberg, S. L. Haberichter, M. A. Jozwiak, E. A. Vokac, P. A. Kroner, S. A. Fahs, Y. Kawai, and R. R. Montgomery The role of the D1 domain of the von Willebrand factor propeptide in multimerization of VWF Blood, August 13, 2002; 100(5): 1699 - 1706. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||
